| Previous changeset 0:09e921a25c68 (2015-08-03) Next changeset 2:22d7b6019372 (2016-03-31) |
|
Commit message:
planemo upload for repository https://github.com/ErasmusMC-Bioinformatics/segmentation_fold_galaxy_wrapper commit 4f43c60fd8d3827382fa55c7b6174fa925d7f8e7 |
|
modified:
segmentation-fold.xml test-data/test_02.dbn test-data/test_03.dbn test-data/test_05.dbn test-data/test_06.dbn test-data/test_07.dbn test-data/test_08.dbn test-data/test_09.dbn test-data/test_10.dbn test-data/test_11.dbn test-data/test_12.dbn test-data/test_13.dbn test-data/test_14.dbn test-data/test_16.dbn test-data/test_17.dbn test-data/test_18.dbn test-data/test_19.dbn test-data/test_21.dbn test-data/test_23.dbn test-data/test_26.dbn tool_dependencies.xml |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 segmentation-fold.xml --- a/segmentation-fold.xml Mon Aug 03 08:28:39 2015 -0400 +++ b/segmentation-fold.xml Thu Dec 03 03:22:08 2015 -0500 |
| [ |
| @@ -1,13 +1,13 @@ -<tool id="segmentation_fold" name="segmentation-fold" version="0.2.0"> +<tool id="segmentation_fold" name="segmentation-fold" version="1.1.0_1"> <description>RNA-Folding including predefined segments including K-turns</description> <requirements> - <requirement type="package" version="1.0.0">segmentation-fold</requirement> + <requirement type="package" version="1.1.0">segmentation-fold</requirement> </requirements> <stdio></stdio> - <version_command>segmentation-fold -V | head -n 2 | tail -n 1 | sed -e 's/^[[:space:]]*//' -e 's/[[:space:]]*$//'</version_command> + <version_command>segmentation-fold --version | head -n 2 | tail -n 1 | sed -e 's/^[[:space:]]*//' -e 's/[[:space:]]*$//'</version_command> <command><![CDATA[ segmentation-fold @@ -22,17 +22,16 @@ -h $min_hairpin_size #if $parameters.settings == "default" - -x "${SEGMENTATION_FOLD_DEFAULT_XML}" + -x "\$SEGMENTATION_FOLD_DEFAULT_XML" #else - -x $parameters.input_xml + -x "${parameters.input_xml}" #end if - -t \${GALAXY_SLOTS:-2} + -t \${GALAXY_SLOTS:-4} > $output_dbn ]]></command> <inputs> - <conditional name="input"> <param name="method" type="select" label="Energy parameters"> <option value="fasta" selected="true">As FASTA-file</option> @@ -62,7 +61,8 @@ </inputs> <outputs> - <data format="dot-bracket" name="output_dbn" label="${tool.name} on ${input.input_fasta.hid + ': ' + input.input_fasta.name if $input.method == 'fasta' else $input.input_sequence.upper() }" /> + <data format="dot-bracket" name="output_dbn" label="asdasdasd" /> + <!--<data format="dot-bracket" name="output_dbn" label="${tool.name} on ${str(input.input_fasta.hid) + ': ' + input.input_fasta.name if $input.method == 'fasta' else $input.input_sequence.upper() }" />--> </outputs> <tests> @@ -184,13 +184,13 @@ Segmentation-fold is a bioinformatics application that predicts RNA 2D-structure with an extended version of the Zuker algorithm. This modification contains a new "structure element" named a segment and is -capable of folding a pre-defined substructure with multiple canonical +capable of folding a pre-defined substructures with multiple canonical or non-canonical pairings. -This allows folding of more complex structures like the K-turns, which -are also part of the implemented free energy tables. These thermodynamic -parameters (free Gibbs energy levels) have been estimated using a -computational approach and therefore lack accuracy. +This allows folding of more complex structures like K-turns, which are +also part of the implemented free energy table. These thermodynamic +parameters (free Gibbs energy) have been estimated using a in silico +approach and therefore lack high resolution. ]]></help> <citations> |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 test-data/test_02.dbn --- a/test-data/test_02.dbn Mon Aug 03 08:28:39 2015 -0400 +++ b/test-data/test_02.dbn Thu Dec 03 03:22:08 2015 -0500 |
| b |
| @@ -1,3 +1,3 @@ >Sequence length: 34bp, dE: -34.4572 kcal/mole CCAGGGGGAGCCGGUAGCGGGCGUGGAUCCCUGG -((((((((((((..(...))))...))))))))) +((((((((((((.......)))...))))))))) |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 test-data/test_03.dbn --- a/test-data/test_03.dbn Mon Aug 03 08:28:39 2015 -0400 +++ b/test-data/test_03.dbn Thu Dec 03 03:22:08 2015 -0500 |
| b |
| @@ -1,3 +1,3 @@ >Sequence length: 35bp, dE: -31.2572 kcal/mole CGUCGGUAAGGUGAUAUGAACCGUUAUAACCGGCG -((((((((((((..(...)))))....)))))))) +((((((((((((.......))))....)))))))) |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 test-data/test_05.dbn --- a/test-data/test_05.dbn Mon Aug 03 08:28:39 2015 -0400 +++ b/test-data/test_05.dbn Thu Dec 03 03:22:08 2015 -0500 |
| b |
| @@ -1,3 +1,3 @@ ->Sequence length: 47bp, dE: -42.9072 kcal/mole +>Sequence length: 47bp, dE: -42.5072 kcal/mole CCCAUCAGCUAGUUGGUGGGGUAAUGGCCCACCAAGGCGACGACGGG -((((.(((((..(((((.((((....))))))))))))...)))))) +((((.(((((..((((((((.......)))))))))))...)))))) |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 test-data/test_06.dbn --- a/test-data/test_06.dbn Mon Aug 03 08:28:39 2015 -0400 +++ b/test-data/test_06.dbn Thu Dec 03 03:22:08 2015 -0500 |
| b |
| @@ -1,3 +1,3 @@ ->Sequence length: 47bp, dE: -41.3572 kcal/mole +>Sequence length: 47bp, dE: -40.3572 kcal/mole GGGAUUAGCUAGUAGGUGGGGUAACGGCUCACCUAGGCGACGAUCCC -((((.(((((..((((((.(((....))))))))))))...)))))) +((((.(((((..((((((((.......)))))))))))...)))))) |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 test-data/test_07.dbn --- a/test-data/test_07.dbn Mon Aug 03 08:28:39 2015 -0400 +++ b/test-data/test_07.dbn Thu Dec 03 03:22:08 2015 -0500 |
| b |
| @@ -1,3 +1,3 @@ ->Sequence length: 31bp, dE: -28.7072 kcal/mole +>Sequence length: 31bp, dE: -26.5072 kcal/mole AACCGAAGCCCUCACGGGCAAUGUGGUGUCA -.((((.(((((....))))...))))).... +..(((.(((((....))))...))))..... |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 test-data/test_08.dbn --- a/test-data/test_08.dbn Mon Aug 03 08:28:39 2015 -0400 +++ b/test-data/test_08.dbn Thu Dec 03 03:22:08 2015 -0500 |
| b |
| @@ -1,3 +1,3 @@ >Sequence length: 37bp, dE: -33.7572 kcal/mole UUCCCGGAGUAGCGGUGAAAUGCGCAGAUACCGGGAG -((((((((((((((.(...))))...))))))))))) +((((((((((((((......)))...))))))))))) |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 test-data/test_09.dbn --- a/test-data/test_09.dbn Mon Aug 03 08:28:39 2015 -0400 +++ b/test-data/test_09.dbn Thu Dec 03 03:22:08 2015 -0500 |
| b |
| @@ -1,3 +1,3 @@ >Sequence length: 37bp, dE: -30.8072 kcal/mole UUCCAGGUGUAGCGGUGAAAUGCGUAGAGAUCUGGAG -((((((((((((((.(...))))...))))))))))) +((((((((((((((......)))...))))))))))) |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 test-data/test_10.dbn --- a/test-data/test_10.dbn Mon Aug 03 08:28:39 2015 -0400 +++ b/test-data/test_10.dbn Thu Dec 03 03:22:08 2015 -0500 |
| b |
| @@ -1,3 +1,3 @@ ->Sequence length: 109bp, dE: -82.9072 kcal/mole +>Sequence length: 109bp, dE: -76.7072 kcal/mole CUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUGUGUCCGCCUCCGAGAGGAGUCGGCACACCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGG -((((((((((((.(((((((((((.((((.(((....))))).)).))))).(((.(((((.((((....))))..)))))...))))))))))))....))))))))) +((((((((((((.(((((((((...(((.(((..(..((((((.(((.((((....)))).)))))))))))))...)))....))))))))))))....))))))))) |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 test-data/test_11.dbn --- a/test-data/test_11.dbn Mon Aug 03 08:28:39 2015 -0400 +++ b/test-data/test_11.dbn Thu Dec 03 03:22:08 2015 -0500 |
| b |
| @@ -1,3 +1,3 @@ ->Sequence length: 53bp, dE: -49.0072 kcal/mole +>Sequence length: 53bp, dE: -46.6072 kcal/mole GGUGGUCUCGAGCCCUAGACAGCCGGUUUUUUCCGGCCGAGGUUUGAGGCGCC -(((.((((((((((...((.((((((......))))))))))))))))))))) +((((.(((((((((...((.((((((......))))))))))))))))))))) |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 test-data/test_12.dbn --- a/test-data/test_12.dbn Mon Aug 03 08:28:39 2015 -0400 +++ b/test-data/test_12.dbn Thu Dec 03 03:22:08 2015 -0500 |
| b |
| @@ -1,3 +1,3 @@ ->Sequence length: 53bp, dE: -51.5072 kcal/mole +>Sequence length: 53bp, dE: -50.2072 kcal/mole GGAUGUGGCGCCGCGAAGACAGCCAGUUUUUUCUGGUCGAGUGGCGCCGCGCC ((.(((((((((((...((.((((((......))))))))))))))))))))) |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 test-data/test_13.dbn --- a/test-data/test_13.dbn Mon Aug 03 08:28:39 2015 -0400 +++ b/test-data/test_13.dbn Thu Dec 03 03:22:08 2015 -0500 |
| b |
| @@ -1,3 +1,3 @@ ->Sequence length: 53bp, dE: -44.8072 kcal/mole +>Sequence length: 53bp, dE: -43.5072 kcal/mole GGAUGUGUCGUCGCAUAGACAGCCAGUUUUUUCUGGUCGAGUGACGAUGCGCC ((.(((((((((((...((.((((((......))))))))))))))))))))) |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 test-data/test_14.dbn --- a/test-data/test_14.dbn Mon Aug 03 08:28:39 2015 -0400 +++ b/test-data/test_14.dbn Thu Dec 03 03:22:08 2015 -0500 |
| b |
| @@ -1,3 +1,3 @@ ->Sequence length: 53bp, dE: -39.2072 kcal/mole +>Sequence length: 53bp, dE: -37.9072 kcal/mole CGAUGUGGGAAGGCCCAGACAGCCAGUUUUUUCUGGUCGAGUCGGCCUGCGCG ((.((..((..(((...((.((((((......)))))))))))..))..)))) |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 test-data/test_16.dbn --- a/test-data/test_16.dbn Mon Aug 03 08:28:39 2015 -0400 +++ b/test-data/test_16.dbn Thu Dec 03 03:22:08 2015 -0500 |
| b |
| @@ -1,3 +1,3 @@ ->Sequence length: 50bp, dE: -44.4072 kcal/mole +>Sequence length: 50bp, dE: -43.4072 kcal/mole UUCCCGAUGCCGAUGAAGGCCGACCCGCGAGGCGGCUGGAGGUAAGGGAA -(((((..((((...((((((((.((.....)))))))))))))).))))) +(((((...(((...((((((((..((....)))))))))))))..))))) |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 test-data/test_17.dbn --- a/test-data/test_17.dbn Mon Aug 03 08:28:39 2015 -0400 +++ b/test-data/test_17.dbn Thu Dec 03 03:22:08 2015 -0500 |
| b |
| @@ -1,3 +1,3 @@ ->Sequence length: 49bp, dE: -38.8072 kcal/mole +>Sequence length: 49bp, dE: -37.3072 kcal/mole UUCAGUCCGCGGUGAAGCCAUACCGGAAGGAGUGGUGGAGCCGACUGAA (((((((.((...((((((((.((....)).)))))))))).))))))) |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 test-data/test_18.dbn --- a/test-data/test_18.dbn Mon Aug 03 08:28:39 2015 -0400 +++ b/test-data/test_18.dbn Thu Dec 03 03:22:08 2015 -0500 |
| b |
| @@ -1,3 +1,3 @@ >Sequence length: 50bp, dE: -37.7072 kcal/mole UUCUGUAAGCCUGCGAAGGUGUGCUGUGAGGCAUGCUGGAGGUAUCAGAA -(((((.(.(((...(((((((((((....)))))))))))))).)))))) +(((((...(((...(((((((((((....))))))))))))))..))))) |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 test-data/test_19.dbn --- a/test-data/test_19.dbn Mon Aug 03 08:28:39 2015 -0400 +++ b/test-data/test_19.dbn Thu Dec 03 03:22:08 2015 -0500 |
| b |
| @@ -1,3 +1,3 @@ ->Sequence length: 30bp, dE: -29.8572 kcal/mole +>Sequence length: 30bp, dE: -28.4572 kcal/mole UCCGUGGAAGCCGUAAUGGCAGGAAGCGGA -((((((((.((((...))))..)))))))) +((((((((.(((.....)))..)))))))) |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 test-data/test_21.dbn --- a/test-data/test_21.dbn Mon Aug 03 08:28:39 2015 -0400 +++ b/test-data/test_21.dbn Thu Dec 03 03:22:08 2015 -0500 |
| b |
| @@ -1,3 +1,3 @@ ->Sequence length: 34bp, dE: -30.6072 kcal/mole +>Sequence length: 34bp, dE: -27.7072 kcal/mole ACGCAUAUCAGUGAGGAUUCGUCCGAGAUUGUGU (((((.(((...(((((....))))))))))))) |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 test-data/test_23.dbn --- a/test-data/test_23.dbn Mon Aug 03 08:28:39 2015 -0400 +++ b/test-data/test_23.dbn Thu Dec 03 03:22:08 2015 -0500 |
| b |
| @@ -1,3 +1,3 @@ ->Sequence length: 85bp, dE: -70.7144 kcal/mole +>Sequence length: 85bp, dE: -70.4144 kcal/mole GGGAGUCUUGUGAUGAGAAGUACUGGAUCUGAAGUAGCCCUUUUUGGGCUACUUGUGAUGAAACACUCAUGGUCUGAAGACUCCC -((((((((...(((((((.((...(..(((((((((((((.....))))))))...)))))..)))))....))))))))))))) +((((((((...(((((..(((......(((((((((((((.....))))))))...)))))...))).....))))))))))))) |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 test-data/test_26.dbn --- a/test-data/test_26.dbn Mon Aug 03 08:28:39 2015 -0400 +++ b/test-data/test_26.dbn Thu Dec 03 03:22:08 2015 -0500 |
| b |
| @@ -1,3 +1,3 @@ ->Sequence length: 55bp, dE: -43.9072 kcal/mole +>Sequence length: 55bp, dE: -42.1072 kcal/mole GGGAGUAAAGAUUGAGACAAGUAGGACUUCGGUCCGAAUACACUCAUGAACUCCC ((((((...(((((((....(((((((....))))...))).))))))))))))) |
| b |
| diff -r 09e921a25c68 -r 27f670a42ba2 tool_dependencies.xml --- a/tool_dependencies.xml Mon Aug 03 08:28:39 2015 -0400 +++ b/tool_dependencies.xml Thu Dec 03 03:22:08 2015 -0500 |
| b |
| @@ -1,6 +1,6 @@ <?xml version="1.0"?> <tool_dependency> - <package name="segmentation-fold" version="1.0.0"> - <repository changeset_revision="f4fce0d27352" name="package_segmentation_fold_1_0_0" owner="yhoogstrate" toolshed="https://toolshed.g2.bx.psu.edu" /> + <package name="segmentation-fold" version="1.1.0"> + <repository changeset_revision="2c69127ea0cd" name="package_segmentation_fold_1_1_0" owner="yhoogstrate" toolshed="https://toolshed.g2.bx.psu.edu" /> </package> </tool_dependency> |