Galaxy |

Changeset 1:288db50d1fb9 (2017-11-25)

Previous changeset 0:05ee0a74faef (2017-11-15) Next changeset 2:d1c340a5664b (2018-10-17)

Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/iqtree/ commit d4423a8641e86485dde733e8148c5bced4d8410c

modified:
iqtree.xml

diff -r 05ee0a74faef -r 288db50d1fb9 iqtree.xml
--- a/iqtree.xml Wed Nov 15 12:45:24 2017 -0500
+++ b/iqtree.xml Sat Nov 25 18:17:09 2017 -0500

[

b'@@ -1,4 +1,4 @@\n-<tool id="iqtree" name="IQ-TREE" version="1.5.5" >\n+<tool id="iqtree" name="IQ-TREE" version="1.5.5.1" >\n <description>Phylogenomic / evolutionary tree construction from multiple sequences</description>\n <requirements>\n <requirement type="package" version="1.5.5">iqtree</requirement>\n@@ -6,7 +6,7 @@\n <command detect_errors=\'exit_code\' ><![CDATA[\n iqtree\n -pre PREF\n- -nt AUTO\n+ -nt \\${GALAXY_SLOTS:-10}\n -redo\n \n ## file\n@@ -17,6 +17,27 @@\n ## file\n #if $general_options.t\n -t \'$general_options.t\'\n+ $tree_parameters.constructing_consensus.con\n+ $tree_parameters.constructing_consensus.net\n+ #if str($tree_parameters.constructing_consensus.bi) != \'\'\n+ -bi \'$tree_parameters.constructing_consensus.bi\'\n+ #end if\n+\n+ ## file\n+ #if $tree_parameters.constructing_consensus.sup\n+ -sup \'$tree_parameters.constructing_consensus.sup\'\n+ #end if\n+\n+ #if str($tree_parameters.constructing_consensus.suptag) != \'\'\n+ -suptag \'$tree_parameters.constructing_consensus.suptag\'\n+ #end if\n+\n+ ## file\n+ #if $tree_parameters.computing_robinson_foulds.rf\n+ -rf \'$tree_parameters.computing_robinson_foulds.rf\'\n+ $tree_parameters.computing_robinson_foulds.rf_all\n+ $tree_parameters.computing_robinson_foulds.rf_adj\n+ #end if\n #end if\n \n ## file\n@@ -53,15 +74,15 @@\n #if str($modelling_parameters.automatic_model.rcluster) != \'\'\n -rcluster \'$modelling_parameters.automatic_model.rcluster\'\n #end if\n- \n+\n #if str($modelling_parameters.automatic_model.mset) != \'\'\n -mset \'$modelling_parameters.automatic_model.mset\'\n #end if\n- \n+\n #if str($modelling_parameters.automatic_model.msub) != \'\'\n -msub \'$modelling_parameters.automatic_model.msub\'\n #end if\n- \n+\n #if str($modelling_parameters.automatic_model.mfreq) != \'\'\n -mfreq \'$modelling_parameters.automatic_model.mfreq\'\n #end if\n@@ -189,33 +210,10 @@\n $tree_parameters.tree_topology.zw\n $tree_parameters.tree_topology.au\n \n-$tree_parameters.constructing_consensus.con\n-$tree_parameters.constructing_consensus.net\n-\n #if str($tree_parameters.constructing_consensus.minsup) != \'\'\n -minsup \'$tree_parameters.constructing_consensus.minsup\'\n #end if\n \n-#if str($tree_parameters.constructing_consensus.bi) != \'\'\n- -bi \'$tree_parameters.constructing_consensus.bi\'\n-#end if\n-\n-## file\n-#if $tree_parameters.constructing_consensus.sup\n- -sup \'$tree_parameters.constructing_consensus.sup\'\n-#end if\n-\n-#if str($tree_parameters.constructing_consensus.suptag) != \'\'\n- -suptag \'$tree_parameters.constructing_consensus.suptag\'\n-#end if\n-\n-## file\n-#if $tree_parameters.computing_robinson_foulds.rf\n- -rf \'$tree_parameters.computing_robinson_foulds.rf\'\n-#end if\n-\n-$tree_parameters.computing_robinson_foulds.rf_all\n-$tree_parameters.computing_robinson_foulds.rf_adj\n \n #if str($tree_parameters.generating_random.r) != \'\'\n -r \'$tree_parameters.generating_random.r\'\n@@ -262,7 +260,7 @@\n #if str($bootstrap_parameters.nonparametric_bootstrap.b) != \'\'\n -b \'$bootstrap_parameters.nonparametric_bootstrap.b\'\n #end if\n- \n+\n $bootstrap_parameters.nonparametric_bootstrap.bc\n $bootstrap_parameters.nonparametric_bootstrap.bo\n \n@@ -273,46 +271,47 @@\n ]]>\n </command>\n <inputs>\n-\t<section name="general_options" expanded="True" title="General options">\n+ <section name="general_options" expanded="True" title="General options">\n <param argument="-s" type="data" format="txt" optional="true" label="Specify input alignment file in PHYLIP, FASTA, NEXUS, CLUSTAL or MSF format."/>\n <param argument="-st" type="select" label="Specify sequence type as either of DNA, AA, BIN, MORPH, CODON or NT2AA for DNA, amino-acid, binary, morphological, codon or DNA-to-AA-translated sequences">\n-\t\t<help><![CDATA[\n+ <help><![CDATA[\n Note that -st CODON is always necessary when using codon models and you also need to specify a genetic code like this if differed from the stand'..b"GAT\n- >Turtle \n+ >Turtle\n CTTCCACACCCCAGGACTCAGCAGTGAT\n- >Bird \n+ >Bird\n CTACCACACCCCAGGACTCAGCAGTAAT\n- >Human \n+ >Human\n CTACCACACCCCAGGAAACAGCAGTGAT\n- >Cow \n+ >Cow\n CTACCACACCCCAGGAAACAGCAGTGAC\n- >Whale \n+ >Whale\n CTACCACGCCCCAGGACACAGCAGTGAT\n- >Mouse \n+ >Mouse\n CTACCACACCCCAGGACTCAGCAGTGAT\n- \n+\n **NOTE**: If you have raw sequences, you need to first apply alignment programs like MAFFT_ or ClustalW_ to align the sequences, before feeding them into IQ-TREE.\n \n .. _MAFFT: http://mafft.cbrc.jp/alignment/software/\n@@ -656,10 +724,10 @@\n * **-merit** asserts the type of optimality criterion\n \n * **-bb** defines the number of replicates\n- \n+\n \n Each of these parameters are available under the relevant sub-sections in the main tool interface.\n- \n+\n At the end of the run IQ-TREE will write several output files including:\n \n * **example.phy.iqtree**: the main report file that is self-readable. You should look at this file to see the computational results. It also contains a textual representation of the final tree (see below).\n@@ -706,7 +774,7 @@\n +----------|\n | +----------------Platypus\n +---|\n- +-------------Opossum \n+ +-------------Opossum\n \n \n This makes sense as the mammals (**Human** to **Opossum**) form a clade, whereas the reptiles **Turtle** to **Crocodile**) and **Bird** form a separate sister clade. Here the tree is drawn at the *outgroup* Lungfish which is more accient than other species in this example. However, please note that IQ-TREE always produces an **unrooted tree** as it knows nothing about this biological background; IQ-TREE simply draws the tree this way as **LngfishAu** is the first sequence occuring in the alignment.\n@@ -731,15 +799,15 @@\n \n ::\n \n- iqtree -s coding_gene.phy -st CODON \n+ iqtree -s coding_gene.phy -st CODON\n \n If your alignment length is not divisible by 3, IQ-TREE will stop with an error message. IQ-TREE will group sites 1,2,3 into codon site 1; sites 4,5,6 to codon site 2; etc. Moreover, any codon, which has at least one gap/unknown/ambiguous nucleotide, will be treated as unknown codon character.\n \n Note that the above command assumes the standard genetic code. If your sequences follow 'The Invertebrate Mitochondrial Code', then run:\n \n ::\n- \n- iqtree -s coding_gene.phy -st CODON5 \n+\n+ iqtree -s coding_gene.phy -st CODON5\n \n Note that ModelFinder works for codon alignments. IQ-TREE version >= 1.5.4 will automatically invokes ModelFinder to find the best-fit codon model.\n \n@@ -749,7 +817,7 @@\n \n To overcome the computational burden required by the nonparametric bootstrap, IQ-TREE introduces an ultrafast bootstrap approximation (UFBoot) ([Minh et al., 2013]) that is orders of magnitude faster than the standard procedure and provides relatively unbiased branch support values. Citation for UFBoot:\n \n- B.Q. Minh, M.A.T. Nguyen, and A. von Haeseler (2013) Ultrafast approximation for phylogenetic bootstrap. _Mol. Biol. Evol., 30:1188-1195. \n+ B.Q. Minh, M.A.T. Nguyen, and A. von Haeseler (2013) Ultrafast approximation for phylogenetic bootstrap. _Mol. Biol. Evol., 30:1188-1195.\n \n ::\n \n@@ -788,7 +856,7 @@\n iqtree -s example.phy -m TIM2+I+G -b 100\n \n **-b** specifies the number of bootstrap replicates where 100\n-is the minimum recommended number. The output files are similar to those produced by the UFBoot procedure. \n+is the minimum recommended number. The output files are similar to those produced by the UFBoot procedure.\n \n \n \n@@ -801,7 +869,7 @@\n \n iqtree -s example.phy -m TIM2+I+G -alrt 1000\n \n-**-alrt** specifies the number of bootstrap replicates for SH-aLRT where 1000 is the minimum number recommended. \n+**-alrt** specifies the number of bootstrap replicates for SH-aLRT where 1000 is the minimum number recommended.\n \n IQ-TREE also supports other tests such as the aBayes test (Anisimova et al., 2011) and the local bootstrap test (Adachi and Hasegawa, 1996).\n \n"