| Previous changeset 15:6be888be75f9 (2023-11-20) Next changeset 17:32dc5f781059 (2024-09-08) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools/samtools_view commit e3de8bc1123bf4ce56818f2b7ad4b53080cb3bd8 |
|
modified:
samtools_view.xml test-data/test_1.bam test-data/test_11.sam test-data/test_12.sam test-data/test_15.cram test-data/test_17.bam test-data/test_19.bam test-data/test_2.bam test-data/test_20.bam test-data/test_21.sam test-data/test_22.sam test-data/test_23.sam test-data/test_24.bam test-data/test_25.sam test-data/test_26.bam test-data/test_27.bam test-data/test_28.bam test-data/test_29.bam test-data/test_3.bam test-data/test_30.bam test-data/test_31.bam test-data/test_4.bam test-data/test_5.bam test-data/test_7.bam test-data/test_8.bam |
|
added:
test-data/test_32.bam test-data/test_33.bam |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 samtools_view.xml --- a/samtools_view.xml Mon Nov 20 22:17:43 2023 +0000 +++ b/samtools_view.xml Fri Aug 30 10:24:46 2024 +0000 |
| [ |
| b'@@ -1,4 +1,4 @@\n-<tool id="samtools_view" name="Samtools view" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">\n+<tool id="samtools_view" name="Samtools view" version="@TOOL_VERSION@+galaxy3" profile="@PROFILE@">\n <description>- reformat, filter, or subsample SAM, BAM or CRAM</description>\n <macros>\n <import>macros.xml</import>\n@@ -136,6 +136,9 @@\n #if $mode.filter_config.qname_file:\n #set std_filters = $std_filters + " --qname-file \'%s\'" % $mode.filter_config.qname_file\n #end if\n+ #if str($cond_expr.select_expr) == "yes":\n+ #set std_filters = $std_filters + " -e \'%s\'" % $cond_expr.expression\n+ #end if\n #end if\n \n #if $with_subsampling:\n@@ -170,7 +173,6 @@\n \n ## filter options (except regions filter, which is the last parameter)\n $std_filters\n-\n #if $with_subsampling:\n --subsample-seed $seed\n #if str($mode.subsample_config.subsampling_mode.select_subsample) == "target":\n@@ -300,6 +302,24 @@\n <param name="rgfile" type="data" format="tabular" argument="-R" label="Filter by read groups in file" help="Output alignments in read groups listed in FILE." />\n </when>\n </conditional>\n+ <conditional name="cond_expr">\n+ <param name="select_expr" type="select" label="Filter by expression">\n+ <option value="no" selected="True">No</option>\n+ <option value="yes">Filter using an expression (see manual)</option>\n+ </param>\n+ <when value="no"/>\n+ <when value="yes">\n+ <param name="expression" type="text" argument="-e" label="Filter by expression - for example sclen>0 will filter all soft clipped reads" help="See Samtools manual for Filter expression syntax">\n+ <sanitizer invalid_char="">\n+ <valid initial="string.printable">\n+ <remove value=" "/>\n+ <remove value="\'"/>\n+ <remove value=\'"\'/>\n+ </valid>\n+ </sanitizer>\n+ </param>\n+ </when>\n+ </conditional>\n <param name="quality" type="integer" argument="-q" optional="true" min="0" label="Filter by quality" help="Skip alignments with MAPQ smaller than INT." />\n <param name="library" type="text" argument="-l" optional="true" label="Filter by library" help="Only output alignments in library STR" />\n <param name="cigarcons" type="integer" argument="-m" optional="true" min="0" label="Filter by number of CIGAR bases consuming query sequence" help="Only output alignments with number of CIGAR bases consuming query sequence greater than or equal INT." />\n@@ -576,7 +596,7 @@\n <param name="addref_select" value="history" />\n <param name="ref" value="test.fa" />\n </conditional>\n- <output name="outputsam" file="test_15.cram" ftype="cram" compare="sim_size" delta="250" />\n+ <output name="outputsam" file="test_15.cram" ftype="cram" compare="sim_size" delta="500" />\n </test>\n <!-- 16) -->\n <test expect_num_outputs="1">\n@@ -908,6 +928,50 @@\n </assert_command>\n <output name="outputsam" file="test_31.bam" ftype="bam" lines_diff="2" />\n </test>\n+ <!-- 32) testing expression filters -->\n+ <test expect_num_outputs="1">\n+ <param name="input" value="in_test_30.bam" ftype="bam"/>\n+ <conditional name="mode">\n+ <para'..b'xt string Mate\'s reference name\n+ sclen int Number of soft-clipped bases\n+ seq string Sequence\n+ tlen int Template length (insert size)\n+ [XX] int / string XX tag value\n+\n+\n+Flags are returned either as the whole flag value or by checking for a single bit. Hence the filter expression flag.dup is equivalent to flag & 1024.\n+\n+"qlen" and "rlen" are measured using the CIGAR string to count the number of query (sequence) and reference bases consumed. Note "qlen" may not exactly\n+match the length of the "seq" field if the sequence is "*".\n+\n+"sclen" and "hclen" are the number of soft and hard-clipped bases respectively. The formula "qlen-sclen" gives the number of sequence bases used in the\n+alignment, distinguishing between global alignment and local alignment length.\n+\n+"endpos" is the (1-based inclusive) position of the rightmost mapped base of the read, as measured using the CIGAR string, and for mapped reads is\n+equivalent to "pos+rlen-1". For unmapped reads, it is the same as "pos".\n+\n+Reference names may be matched either by their string forms ("rname" and "mrname") or as the Nth @SQ line (counting from zero) as stored in BAM using\n+"tid" and "mtid" respectively.\n+\n+Auxiliary tags are described in square brackets and these expand to either integer or string as defined by the tag itself (XX:Z:string or XX:i:int).\n+For example [NM]>=10 can be used to look for alignments with many mismatches and [RG]=~"grp[ABC]-" will match the read-group string.\n+\n+If no comparison is used with an auxiliary tag it is taken simply to be a test for the existence of that tag. So [NM] will return any record containing\n+an NM tag, even if that tag is zero (NM:i:0). In htslib <= 1.15 negating this with ![NM] gave misleading results as it was true if the tag did not exist\n+or did exist but was zero. Now this is strictly does-not-exist. An explicit exists([NM]) and !exists([NM]) function has also been added to make\n+this intention clear.\n+\n+Similarly in htslib <= 1.15 using [NM]!=0 was true both when the tag existed and was not zero as well as when the tag did not exist. From 1.16 onwards\n+all comparison operators are only true for tags that exist, so [NM]!=0 works as expected.\n+\n+Some simple functions are available to operate on strings. These treat the strings as arrays of bytes, permitting their length, minimum, maximum and\n+average values to be computed. These are useful for processing Quality Scores.\n+\n+::\n+\n+ length(x) Length of the string (excluding nul char)\n+ min(x) Minimum byte value in the string\n+ max(x) Maximum byte value in the string\n+ avg(x) Average byte value in the string\n+\n+\n+Note that "avg" is a floating point value and it may be NAN for empty strings. This means that "avg(qual)" does not produce an error for records that\n+have both seq and qual of "*". NAN values will fail any conditional checks, so e.g. "avg(qual) > 20" works and will not report these records. NAN also\n+fails all equality, < and > comparisons, and returns zero when given as an argument to the exists function. It can be negated with !x in which case it\n+becomes true.\n+\n+Functions that operate on both strings and numerics:\n+\n+:: \n+\n+ exists(x) True if the value exists (or is explicitly true).\n+ default(x,d) Value x if it exists or d if not.\n+\n+Functions that apply only to numeric values:\n+\n+::\n+\n+ qrt(x) Square root of x\n+ og(x) Natural logarithm of x\n+ ow(x, y) Power function, x to the power of y\n+ xp(x) Base-e exponential, equivalent to pow(e,x)\n+\n </help>\n <expand macro="citations"/>\n </tool>\n' |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_1.bam |
| b |
| Binary file test-data/test_1.bam has changed |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_11.sam --- a/test-data/test_11.sam Mon Nov 20 22:17:43 2023 +0000 +++ b/test-data/test_11.sam Fri Aug 30 10:24:46 2024 +0000 |
| b |
| @@ -4,7 +4,7 @@ @SQ SN:chr8 LN:202 @RG ID:0 SM:Hi,Mom! @PG ID:1 PN:Hey! VN:2.0 -@PG ID:samtools PN:samtools PP:1 VN:1.12 CL:samtools view -@ 0 -h -o outfile infile +@PG ID:samtools PN:samtools PP:1 VN:1.15.1 CL:samtools view -@ 0 -h -o outfile infile both_reads_align_clip_marked 83 chr7 1 255 101M = 302 201 CAACAGAAGCNGGNATCTGTGTTTGTGTTTCGGATTTCCTGCTGAANNGNTTNTCGNNTCNNNNNNNNATCCCGATTTCNTTCCGCAGCTNACCTCCCAAN )'.*.+2,))&&'&*/)-&*-)&.-)&)&),/-&&..)./.,.).*&&,&.&&-)&&&0*&&&&&&&&/32/,01460&&/6/*0*/2/283//36868/& RG:Z:0 both_reads_present_only_first_aligns 89 chr7 1 255 101M * 0 0 CAACAGAAGCNGGNATCTGTGTTTGTGTTTCGGATTTCCTGCTGAANNGNTTNTCGNNTCNNNNNNNNATCCCGATTTCNTTCCGCAGCTNACCTCCCAAN )'.*.+2,))&&'&*/)-&*-)&.-)&)&),/-&&..)./.,.).*&&,&.&&-)&&&0*&&&&&&&&/32/,01460&&/6/*0*/2/283//36868/& RG:Z:0 read_2_too_many_gaps 83 chr7 1 255 101M = 302 201 CAACAGAAGCNGGNATCTGTGTTTGTGTTTCGGATTTCCTGCTGAANNGNTTNTCGNNTCNNNNNNNNATCCCGATTTCNTTCCGCAGCTNACCTCCCAAN )'.*.+2,))&&'&*/)-&*-)&.-)&)&),/-&&..)./.,.).*&&,&.&&-)&&&0*&&&&&&&&/32/,01460&&/6/*0*/2/283//36868/& RG:Z:0 |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_12.sam --- a/test-data/test_12.sam Mon Nov 20 22:17:43 2023 +0000 +++ b/test-data/test_12.sam Fri Aug 30 10:24:46 2024 +0000 |
| b |
| @@ -4,4 +4,4 @@ @SQ SN:chr8 LN:202 @RG ID:0 SM:Hi,Mom! @PG ID:1 PN:Hey! VN:2.0 -@PG ID:samtools PN:samtools PP:1 VN:1.12 CL:samtools view -H -o outfile infile +@PG ID:samtools PN:samtools PP:1 VN:1.15.1 CL:samtools view -H -o outfile infile |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_15.cram |
| b |
| Binary file test-data/test_15.cram has changed |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_17.bam |
| b |
| Binary file test-data/test_17.bam has changed |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_19.bam |
| b |
| Binary file test-data/test_19.bam has changed |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_2.bam |
| b |
| Binary file test-data/test_2.bam has changed |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_20.bam |
| b |
| Binary file test-data/test_20.bam has changed |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_21.sam --- a/test-data/test_21.sam Mon Nov 20 22:17:43 2023 +0000 +++ b/test-data/test_21.sam Fri Aug 30 10:24:46 2024 +0000 |
| b |
| @@ -3,6 +3,6 @@ @RG ID:UNKNOWN SM:UNKNOWN @PG ID:bowtie2 PN:bowtie2 VN:2.0.0-beta5 @PG ID:0 CL:aaaaa/aaa/aaaaa/aaaaaa/aaaaaaaaa/aaa/iuc/package_aaaaaaaaa_x_y/aaaaaaaaaaaa/bin/aaaaaaaaaaaaaaaaa aaaaaaaaaa /aaaa/aaaaa/aaa/aaaaaaaaaaaaaaaaaaa/tools/aaaaaaaaa/test-data/test.cram aa /aaaa/aaaaa/aaa/aaaaaaaaaaaaaaaaaaa/tools/aaaaaaaaa/test-data/test.fa -O test PN:samtools VN:1.2 -@PG ID:samtools PN:samtools PP:0 VN:1.15.1 CL:samtools view -@ 1 -h -f 0 -F 0 -G 0 -s 5.20000000 -o outfile infile -SRR065390.1871511 16 CHROMOSOME_I 3 1 100M * 0 0 CTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAA <?@<@A8>0:BB@>B<=B@???@=8@B>BB@CA@DACDCBBCCCA@CCCCACCBCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC RG:Z:UNKNOWN XG:i:0 XM:i:0 XN:i:0 XO:i:0 AS:i:0 XS:i:0 YT:Z:UU -SRR065390.6905811 16 CHROMOSOME_I 3 1 100M * 0 0 CTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAA #######################BB@>A<BC>@@BCCB@=BACBCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC RG:Z:UNKNOWN XG:i:0 XM:i:0 XN:i:0 XO:i:0 AS:i:0 XS:i:0 YT:Z:UU +@PG ID:samtools PN:samtools PP:0 VN:1.15.1 CL:samtools view -@ 0 -h -f 0 -F 0 -G 0 --subsample-seed 24733 --subsample 0.20000000 -o outfile infile +SRR065390.3743423 16 CHROMOSOME_I 3 1 100M * 0 0 CTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAA ##################?6@:7<=@3=@ABAAB>BDBBABADABDDDBDDBCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC RG:Z:UNKNOWN XG:i:0 XM:i:0 XN:i:0 XO:i:0 AS:i:0 XS:i:0 YT:Z:UU +SRR065390.5238868 16 CHROMOSOME_I 3 1 100M * 0 0 CTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAA @,=@@D8D;?BBB>;?BBB==BB@D;>D>BBB>BBDDB<DABADCACDCCBCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC RG:Z:UNKNOWN XG:i:0 XM:i:0 XN:i:0 XO:i:0 AS:i:0 XS:i:0 YT:Z:UU |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_22.sam --- a/test-data/test_22.sam Mon Nov 20 22:17:43 2023 +0000 +++ b/test-data/test_22.sam Fri Aug 30 10:24:46 2024 +0000 |
| b |
| @@ -3,7 +3,7 @@ @RG ID:UNKNOWN SM:UNKNOWN @PG ID:bowtie2 PN:bowtie2 VN:2.0.0-beta5 @PG ID:0 CL:aaaaa/aaa/aaaaa/aaaaaa/aaaaaaaaa/aaa/iuc/package_aaaaaaaaa_x_y/aaaaaaaaaaaa/bin/aaaaaaaaaaaaaaaaa aaaaaaaaaa /aaaa/aaaaa/aaa/aaaaaaaaaaaaaaaaaaa/tools/aaaaaaaaa/test-data/test.cram aa /aaaa/aaaaa/aaa/aaaaaaaaaaaaaaaaaaa/tools/aaaaaaaaa/test-data/test.fa -O test PN:samtools VN:1.2 -@PG ID:samtools PN:samtools PP:0 VN:1.15.1 CL:samtools view -@ 1 -h -f 0 -F 0 -G 0 -s 0.00000000 -o outfile infile +@PG ID:samtools PN:samtools PP:0 VN:1.15.1 CL:samtools view -@ 0 -h -f 0 -F 0 -G 0 --subsample-seed 5206 --subsample 1.00000000 -o outfile infile SRR065390.14978392 16 CHROMOSOME_I 2 1 27M1D73M * 0 0 CCTAGCCCTAACCCTAACCCTAACCCTAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAA #############################@B?8B?BA@@DDBCDDCBC@CDCDCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC RG:Z:UNKNOWN XG:i:1 XM:i:5 XN:i:0 XO:i:1 AS:i:-18 XS:i:-18 YT:Z:UU SRR065390.921023 16 CHROMOSOME_I 3 12 100M * 0 0 CTAAGCCTAAATCTAAGCCTAACCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAA ###############################################???88:;98768700000<>:BBA?BBAB?BBBBBBBB>B>BB::;?:00000 RG:Z:UNKNOWN XG:i:0 XM:i:3 XN:i:0 XO:i:0 AS:i:-6 XS:i:-13 YT:Z:UU SRR065390.1871511 16 CHROMOSOME_I 3 1 100M * 0 0 CTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAA <?@<@A8>0:BB@>B<=B@???@=8@B>BB@CA@DACDCBBCCCA@CCCCACCBCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC RG:Z:UNKNOWN XG:i:0 XM:i:0 XN:i:0 XO:i:0 AS:i:0 XS:i:0 YT:Z:UU |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_23.sam --- a/test-data/test_23.sam Mon Nov 20 22:17:43 2023 +0000 +++ b/test-data/test_23.sam Fri Aug 30 10:24:46 2024 +0000 |
| b |
| @@ -4,4 +4,4 @@ @PG ID:bowtie2 PN:bowtie2 VN:2.0.0-beta5 @PG ID:0 CL:aaaaa/aaa/aaaaa/aaaaaa/aaaaaaaaa/aaa/iuc/package_aaaaaaaaa_x_y/aaaaaaaaaaaa/bin/aaaaaaaaaaaaaaaaa aaaaaaaaaa /aaaa/aaaaa/aaa/aaaaaaaaaaaaaaaaaaa/tools/aaaaaaaaa/test-data/test.cram aa /aaaa/aaaaa/aaa/aaaaaaaaaaaaaaaaaaa/tools/aaaaaaaaa/test-data/test.fa -O test PN:samtools VN:1.2 @PG ID:samtools PN:samtools PP:0 VN:1.12 CL:samtools view -@ 0 -h -s .0 -o outfile infile -@PG ID:samtools.1 PN:samtools PP:samtools VN:1.12 CL:samtools view -@ 0 -h -s .0 -o outfile infile +@PG ID:samtools.1 PN:samtools PP:samtools VN:1.15.1 CL:samtools view -@ 0 -h -f 0 -F 0 -G 0 --subsample-seed 23916 --subsample 1.00000000 -o outfile infile |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_24.bam |
| b |
| Binary file test-data/test_24.bam has changed |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_25.sam --- a/test-data/test_25.sam Mon Nov 20 22:17:43 2023 +0000 +++ b/test-data/test_25.sam Fri Aug 30 10:24:46 2024 +0000 |
| b |
| @@ -3,7 +3,7 @@ @RG ID:UNKNOWN SM:UNKNOWN @PG ID:bowtie2 PN:bowtie2 VN:2.0.0-beta5 @PG ID:0 CL:aaaaa/aaa/aaaaa/aaaaaa/aaaaaaaaa/aaa/iuc/package_aaaaaaaaa_x_y/aaaaaaaaaaaa/bin/aaaaaaaaaaaaaaaaa aaaaaaaaaa /aaaa/aaaaa/aaa/aaaaaaaaaaaaaaaaaaa/tools/aaaaaaaaa/test-data/test.cram aa /aaaa/aaaaa/aaa/aaaaaaaaaaaaaaaaaaa/tools/aaaaaaaaa/test-data/test.fa -O test PN:samtools VN:1.2 -@PG ID:samtools PN:samtools PP:0 VN:1.15.1 CL:samtools view -@ 1 -h -f 0 -F 0 -G 0 -s 7.20000000 -o outfile infile +@PG ID:samtools PN:samtools PP:0 VN:1.15.1 CL:samtools view -@ 0 -h -f 0 -F 0 -G 0 --subsample-seed 7 --subsample 0.20000000 -o outfile infile SRR065390.14978392 16 CHROMOSOME_I 2 1 27M1D73M * 0 0 CCTAGCCCTAACCCTAACCCTAACCCTAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAA #############################@B?8B?BA@@DDBCDDCBC@CDCDCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC RG:Z:UNKNOWN XG:i:1 XM:i:5 XN:i:0 XO:i:1 AS:i:-18 XS:i:-18 YT:Z:UU SRR065390.921023 16 CHROMOSOME_I 3 12 100M * 0 0 CTAAGCCTAAATCTAAGCCTAACCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAA ###############################################???88:;98768700000<>:BBA?BBAB?BBBBBBBB>B>BB::;?:00000 RG:Z:UNKNOWN XG:i:0 XM:i:3 XN:i:0 XO:i:0 AS:i:-6 XS:i:-13 YT:Z:UU SRR065390.6023338 0 CHROMOSOME_I 3 1 100M * 0 0 CTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAAGCTAC CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC@CCDDDBCCABB=DABBA?################ RG:Z:UNKNOWN XG:i:0 XM:i:3 XN:i:0 XO:i:0 AS:i:-6 XS:i:-6 YT:Z:UU |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_26.bam |
| b |
| Binary file test-data/test_26.bam has changed |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_27.bam |
| b |
| Binary file test-data/test_27.bam has changed |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_28.bam |
| b |
| Binary file test-data/test_28.bam has changed |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_29.bam |
| b |
| Binary file test-data/test_29.bam has changed |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_3.bam |
| b |
| Binary file test-data/test_3.bam has changed |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_30.bam |
| b |
| Binary file test-data/test_30.bam has changed |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_31.bam |
| b |
| Binary file test-data/test_31.bam has changed |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_32.bam |
| b |
| Binary file test-data/test_32.bam has changed |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_33.bam |
| b |
| Binary file test-data/test_33.bam has changed |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_4.bam |
| b |
| Binary file test-data/test_4.bam has changed |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_5.bam |
| b |
| Binary file test-data/test_5.bam has changed |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_7.bam |
| b |
| Binary file test-data/test_7.bam has changed |
| b |
| diff -r 6be888be75f9 -r 2dce91e11ca7 test-data/test_8.bam --- a/test-data/test_8.bam Mon Nov 20 22:17:43 2023 +0000 +++ b/test-data/test_8.bam Fri Aug 30 10:24:46 2024 +0000 |
| b |
| @@ -167,7 +167,7 @@ @SQ SN:GCCAAACCCCAAAAACAAGACTAAACAATGCACAATACTTCATGAAGCTT LN:0 @SQ SN:GAACTTTCCCCCCGCCATTAATACCAACATGCTACTTTAATCAATAAAAT LN:0 @SQ SN:TTCTTCCCCC LN:0 -@PG ID:samtools PN:samtools VN:1.12 CL:samtools view -@ 0 -h -o outfile infile +@PG ID:samtools PN:samtools VN:1.15.1 CL:samtools view -@ 0 -h -o outfile infile HWI-EAS91_1_30788AAXX:1:1:1218:141 16 * 14062 25 36M * 0 0 ACAAAACTAACAACAAAAATAACACTCNNAATAAAC I+IIII1IIIIIIIIIIIIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 HWI-EAS91_1_30788AAXX:1:1:1310:991 16 * 10002 25 36M * 0 0 CTCCTATGCCTAGAAGGAATAATACTANNACTATTC I:2IEI:IIDIIIIII4IIIIIIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 HWI-EAS91_1_30788AAXX:1:1:1398:854 16 * 3921 25 36M * 0 0 CACCCTTCCCGTACTAATAAATCCCCTNNTCTTCAC IIIII=AIIIIIIIIIIIIIIBIIIII""IIIIIII NM:i:1 X1:i:1 MD:Z:7N0N27 |