| Next changeset 1:44f916528286 (2017-03-11) |
|
Commit message:
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/rnalien commit 5385435d8f4339d609f69076cc755e0dc2e7bc72 |
|
added:
rnalien.xml test-data/tcvh4.fa test-data/warnings |
| b |
| diff -r 000000000000 -r 368b2ff179fd rnalien.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/rnalien.xml Tue Mar 07 13:15:52 2017 -0500 |
| [ |
| @@ -0,0 +1,112 @@ +<tool id="RNAlien" name="RNAlien" version="1.3.5"> + <description> + Unsupervised covariance model construction from a single input sequence + </description> + <requirements> + <requirement type="package" version="1.3.5">rnalien</requirement> + </requirements> + <command detect_errors="aggressive"><![CDATA[ + RNAlien + -i '$input_sequence' + #if $t + -t $t + #end if + -o `pwd` + -d outdir + -c "\${GALAXY_SLOTS:-4}" + -z $z + -e $e + -b $blast_database + $s + $f + $a + > 'warnings' + ]]> + </command> + <inputs> + <param name="input_sequence" type="data" format="fasta" label="Input sequence"/> + <param argument="-t" type="integer" value="" + label="NCBI taxonomy id of input organism" optional="true" help="-t"/> + <param argument="-z" type="float" value="1.0" min="0.1" + label="Only candidate sequences with a nSCI higher than this value are accepted." help=""/> + <param argument="-e" type="float" value="0.001" min="0.000000000001" + label="Evalue cutoff for cmsearch filtering" help=""/> + <param name="blast_database" type="select" label="Specify name of blast database to use." + help="Blast databases, e.g. nt, refseq_genomic,.."> + <option value="nt">nt</option> + <option value="refseq_genomic">refseq_genomic</option> + <option value="refseq_rna">refseq_rna</option> + <option value="refseq_representative_genomes">refseq_representative_genomes</option> + </param> + <param argument="-a" truevalue="-a" falsevalue="" checked="True" type="boolean" + label="Filter blast hits by coverage of at least 80%." help=""/> + <param argument="-s" truevalue="-s" falsevalue="" checked="False" type="boolean" + label="Only the best blast hit per taxonomic entry is considered." help=""/> + <param argument="-f" truevalue="-f" falsevalue="" checked="True" type="boolean" + label="Toggles blast softmasking, meaning exclusion of low complexity (repetative) regions in lookup table." help=""/> + </inputs> + <outputs> + <data format="txt" name="log" from_work_dir="./outdir/Log" label="RNAlien construction summary"/> + <data format="cm" name="cm" from_work_dir="./outdir/result.cm" label="RNAlien result covariance model"/> + <data format="stockholm" name="stockholm" from_work_dir="./outdir/result.stockholm" label="RNAlien result stockholm alignment"/> + <data format="fasta" name="sequences" from_work_dir="./outdir/result.fa" label="RNAlien result sequences"/> + <data format="txt" name="warnings" from_work_dir="warnings" label="Warnings from tool dependencies"/> + </outputs> + <tests> + <test> + <param name="input_sequence" value="tcvh4.fa"/> + <param name="taxonomy_id" value="10239"/> + <output name="warnings" file="warnings"/> + </test> + </tests> + <help> + +<![CDATA[ + +**What it does** + +RNAlien is a tool for automatic construction of RNAfamily models from a single sequence. + +**Input** + +Example: + +>AJ243001.2 + +ATACTTACCTGGCACAGGGGATACCACGATCACCAAGGTGGTTCCCCCAAGACGAGGCTC + +ACCATTGCACTCCGGTGGCGCTGACCCTTGCAATGACCCCAAATGTGGGTTACTCGGGTG + +TGTAATTTCTGTTAGCTGGGGACTGCGTTCGCGCTTTCCCCTT + +**Options** +-i Path to input fasta file +-o Path to output directory +-t NCBI taxonomy ID number of input RNA organism +-z Only candidate sequences with a nSCI higher than this value are accepted. 1.0 +-e Evalue cutoff for cmsearch filtering. 0.001 +-b Specify name of blast database to use. nt +-a Filter blast hits by coverage of at least 80%. True +-s Only the best blast hit per taxonomic entry is considered. False +-f Toggles blast softmasking, meaning exclusion of low complexity (repetative) regions in lookup table. True +-r Restrict search space to taxonomic kingdom (bacteria,archea,eukaryia). + +**Output** + +RNAlien collects potential family members in multiple iterations. + +The output of RNAlien consists of a stockholm alignment, a covariance + +model and a Log file. + +For further questions please refer to the RNAlien Help page. + +.. _Userguide: http://nibiru.tbi.univie.ac.at/rnalien/help _. + + ]]> + + </help> + <citations> + <citation type="doi">10.1093/nar/gkw558</citation> + </citations> +</tool> |
| b |
| diff -r 000000000000 -r 368b2ff179fd test-data/warnings --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/warnings Tue Mar 07 13:15:52 2017 -0500 |
| b |
| @@ -0,0 +1,1 @@ +Error: Input fasta file is empty. |