| Previous changeset 1:d77c9c6ecf68 (2013-12-03) Next changeset 3:bbb007a39ac2 (2018-05-08) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7 |
|
modified:
fastx_trimmer.xml tool_dependencies.xml |
| b |
| diff -r d77c9c6ecf68 -r 377ac2829eac fastx_trimmer.xml --- a/fastx_trimmer.xml Tue Dec 03 12:36:14 2013 -0500 +++ b/fastx_trimmer.xml Wed Nov 11 12:40:14 2015 -0500 |
| [ |
| @@ -1,51 +1,52 @@ <tool id="cshl_fastx_trimmer" version="1.0.0" name="Trim sequences"> - <description></description> + <description></description> <requirements> <requirement type="package" version="0.0.13">fastx_toolkit</requirement> </requirements> - <command>zcat -f '$input' | fastx_trimmer -v -f $first -l $last -o $output + <command> +<![CDATA[ +zcat -f < '$input' | fastx_trimmer -v -f $first -l $last -o '$output' #if $input.ext == "fastqsanger": --Q 33 + -Q 33 #end if - </command> - - <inputs> - <param format="fasta,fastqsolexa,fastqsanger" name="input" type="data" label="Library to clip" /> +]]> + </command> - <param name="first" size="4" type="integer" value="1"> - <label>First base to keep</label> - </param> + <inputs> + <param format="fasta,fastqsolexa,fastqsanger" name="input" type="data" label="Library to clip" /> - <param name="last" size="4" type="integer" value="21"> - <label>Last base to keep</label> - </param> - </inputs> + <param name="first" type="integer" value="1"> + <label>First base to keep</label> + </param> - <tests> - <test> - <!-- Trim a FASTA file - remove first four bases (e.g. a barcode) --> - <param name="input" value="fastx_trimmer1.fasta" /> - <param name="first" value="5"/> - <param name="last" value="36"/> - <param name="output" file="fastx_trimmer1.out" /> - </test> - <test> - <!-- Trim a FASTQ file - remove last 9 bases (e.g. keep only miRNA length sequences) --> - <param name="input" value="fastx_trimmer2.fastq" ftype="fastqsolexa"/> - <param name="first" value="1"/> - <param name="last" value="27"/> - <param name="output" file="fastx_trimmer2.out" /> - </test> - </tests> - - <outputs> - <data format="input" name="output" metadata_source="input" /> - </outputs> - <help> + <param name="last" type="integer" value="21"> + <label>Last base to keep</label> + </param> + </inputs> + <outputs> + <data format_source="input" name="output" metadata_source="input" /> + </outputs> + <tests> + <test> + <!-- Trim a FASTA file - remove first four bases (e.g. a barcode) --> + <param name="input" value="fastx_trimmer1.fasta" /> + <param name="first" value="5"/> + <param name="last" value="36"/> + <output name="output" ftype="fasta" file="fastx_trimmer1.out" /> + </test> + <test> + <!-- Trim a FASTQ file - remove last 9 bases (e.g. keep only miRNA length sequences) --> + <param name="input" value="fastx_trimmer2.fastq" ftype="fastqsolexa"/> + <param name="first" value="1"/> + <param name="last" value="27"/> + <output name="output" ftype="fastqsolexa" file="fastx_trimmer2.out" /> + </test> + </tests> + <help> **What it does** This tool trims (cut bases from) sequences in a FASTA/Q file. - + -------- **Example** @@ -56,7 +57,7 @@ TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC >2-1 CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA - + Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base):: @@ -71,13 +72,12 @@ TCAGA >2-1 AGGCT - + ------ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. .. __: http://hannonlab.cshl.edu/fastx_toolkit/ - -</help> + </help> <!-- FASTX-Trimmer is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> </tool> |
| b |
| diff -r d77c9c6ecf68 -r 377ac2829eac tool_dependencies.xml --- a/tool_dependencies.xml Tue Dec 03 12:36:14 2013 -0500 +++ b/tool_dependencies.xml Wed Nov 11 12:40:14 2015 -0500 |
| b |
| @@ -1,6 +1,6 @@ <?xml version="1.0"?> <tool_dependency> <package name="fastx_toolkit" version="0.0.13"> - <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="http://toolshed.g2.bx.psu.edu" /> + <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" /> </package> </tool_dependency> |