| Next changeset 1:32b19379cd25 (2022-04-06) |
|
Commit message:
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/justgzip commit cb119427c41b729c90572c410f717282ad9cb8a7 |
|
added:
gzip.xml test-data/file1 test-data/file1.gz |
| b |
| diff -r 000000000000 -r 401afd3c5220 gzip.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gzip.xml Wed May 16 12:59:10 2018 -0400 |
| [ |
| @@ -0,0 +1,49 @@ +<tool id="justgzip" name="Gzip sequence datasets" version="0.1.0"> + <description></description> + <stdio> + <exit_code range="1:" level="fatal" description="Tool exception" /> + </stdio> + <command detect_errors="exit_code"><![CDATA[ +gzip -ck '${input1}' > $output + ]]></command> + <inputs> + <param format="fastq" name="input1" type="data" label="Input file" help="file to compress" /> + <param name="datatype" type="select" label="Input file datatype" help="Input file datatype" > + <option value="sanger" >fastqsanger </option> + <option value="illumina" >fastqillumina </option> + <option value="fastq" selected="true" >fastq </option> + </param> + </inputs> + <outputs> + + <data name="output" format="fastq.gz" label="$input1.name " > + <change_format> + <when input="datatype" value="sanger" format="fastqsanger.gz" /> + <when input="datatype" value="illumina" format="fastqillumina.gz" /> + </change_format> + </data> + </outputs> + <tests> + <test> + <param name="input1" value="file1" ftype="fastq" /> + <param name="datatype" value="fastq" /> + <output name="output" file="file1.gz" decompress="True" ftype="fastq.gz"/> + </test> + <test> + <param name="input1" value="file1" ftype="fastqsanger" /> + <param name="datatype" value="sanger" /> + <output name="output" file="file1.gz" decompress="True" ftype="fastqsanger.gz" /> + </test> + + </tests> + <help> + +.. class:: infomark + +**What it does** + +Just **gzip** fastq, fastqillumina and fastqsanger datasets. + + </help> +</tool> + |
| b |
| diff -r 000000000000 -r 401afd3c5220 test-data/file1 --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/file1 Wed May 16 12:59:10 2018 -0400 |
| b |
| @@ -0,0 +1,8 @@ +@1831_573_1004/1 +AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG ++ +><C&&9952+C>5<.?<79,=42<292:<(9/-7 +@1831_573_1050/1 +TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT ++ +;@@17?@=>7??@A8?==@4A?A4)&+.'&+'1, \ No newline at end of file |
| b |
| diff -r 000000000000 -r 401afd3c5220 test-data/file1.gz |
| b |
| Binary file test-data/file1.gz has changed |