Galaxy |

Changeset 1:420b57c3c185 (2015-07-10)

Previous changeset 0:3e19d0dfcf3e (2015-03-23) Next changeset 2:feb40a9a8eae (2015-07-10)

Commit message:
Uploaded

modified:
MDSplot/mdsplot.xml
tool_dependencies.xml

removed:
VCFToolFilter/VCFToolsFilter.pl
VCFToolFilter/test-data/result.log
VCFToolFilter/test-data/result.vcf
VCFToolFilter/test-data/sample.vcf
VCFToolFilter/vcfToolsFilter.sh
VCFToolFilter/vcfToolsFilter.xml
VCFToolsStats/VCFToolsStats.pl
VCFToolsStats/test-data/result.TsTv.summary
VCFToolsStats/test-data/result.annotation
VCFToolsStats/test-data/result.het
VCFToolsStats/test-data/result.imiss
VCFToolsStats/test-data/result.log
VCFToolsStats/test-data/sample.vcf
VCFToolsStats/vcfToolsStats.sh
VCFToolsStats/vcfToolsStats.xml
admixture/Admixture.pl
admixture/admixture.sh
admixture/admixture.xml
admixture/transpose.awk
snpEff/SnpEff.pl
snpEff/snpEff-pipe.sh
snpEff/snpEff.xml
tassel/tassel.sh
tassel/tassel.xml
tassel/tool-data/tool_dependencies.xml

diff -r 3e19d0dfcf3e -r 420b57c3c185 MDSplot/MDSbasedOnIBSmatrix.pl.org
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/MDSplot/MDSbasedOnIBSmatrix.pl.org Fri Jul 10 04:39:30 2015 -0400

[

@@ -0,0 +1,77 @@
+#!/usr/bin/perl
+
+use strict;
+use Switch;
+use Getopt::Long;
+use Bio::SeqIO;
+
+my $PLINK_EXE= "/apps/www/sniplay.cirad.fr/tools/plink/plink-1.07-x86_64/plink";
+
+my $usage = qq~Usage:$0 <args> [<opts>]
+where <args> are:
+    -i, --in         <input>
+    -o, --out        <output>
+~;
+$usage .= "\n";
+
+my ($in,$out);
+
+
+GetOptions(
+ "in=s"        => \$in,
+ "out=s"       => \$out
+);
+
+die $usage
+  if ( !$in || !$out);
+
+
+my $plink_command = $PLINK_EXE . " --file $in --noweb --cluster --matrix --mds-plot 2 --out $out >>$in.plink.log 2>&1";
+system($plink_command);
+
+my $awk_cmd = "awk \{\'print \$1\'\} $in.ped";
+my $inds = `$awk_cmd`;
+my @individuals = split("\n",$inds);
+
+
+open(my $OUT,">$out.mds_plot.txt");
+my $go = 0;
+open(my $O,"$out.mds");
+while(<$O>)
+{
+ if ($go)
+ {
+ my $line = $_;
+ $line =~s/\n//g;
+ $line =~s/\r//g;
+ my @i = split(/\s+/,$line);
+ my $ind = $i[1];
+ print $OUT "$ind ".$i[4]." ".$i[5]."\n";
+ }
+ if (/C1/){$go = 1;}
+}
+close($O);
+close($OUT);
+
+
+my $j = 0;
+open(my $IBS,">$out.ibs_matrix.txt");
+print $IBS "Individuals " . join("\t",@individuals)."\n";
+open(my $O2,"$out.mibs");
+while(<$O2>)
+{
+ my $line = $_;
+ $line =~s/\n//g;
+ $line =~s/\r//g;
+ my @i = split(/\s+/,$line);
+ print $IBS $individuals[$j]. " ". join("\t",@i)."\n";
+ $j++;
+}
+close($O2);
+close($IBS);
+
+
+
+
+
+

diff -r 3e19d0dfcf3e -r 420b57c3c185 MDSplot/mdsplot.xml
--- a/MDSplot/mdsplot.xml Mon Mar 23 05:57:27 2015 -0400
+++ b/MDSplot/mdsplot.xml Fri Jul 10 04:39:30 2015 -0400

[

@@ -6,7 +6,7 @@
     
     <requirements>
         <requirement type="binary">perl</requirement>
- <requirement type="package" version="0.1.13">plink</requirement>
+ <requirement type="package" version="1.07">plink</requirement>
     </requirements>

     
@@ -63,17 +63,31 @@
     
     <help>

+
.. class:: infomark

-**Authors**
+**Authors** plink_
+
+.. _plink: http://pngu.mgh.harvard.edu/purcell/plink/
+
+  | "PLINK: a toolset for whole-genome association and population-based linkage analysis.", **Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MAR, Bender D, Maller J, Sklar P, de Bakker PIW, Daly MJ, Sham PC.**, American Journal of Human Genetics, 81, 2007.
+
+
+.. class:: infomark
+
+**Galaxy integration** Andres Gwendoline, Institut Français de Bioinformatique.
+
+.. class:: infomark
+
+**Support** For any questions about Galaxy integration, please send an e-mail to support.abims@sb-roscoff.fr
+
+.. class:: infomark
+
+**Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1).

---------------------------------------------------

-.. class:: infomark

-**Please cite** If you use this tool, please cite dereeper et al. 2015 in prep.
-
----------------------------------------------------

========
MDS plot
@@ -90,20 +104,14 @@
Workflow position
-----------------

-**Upstream tools**
-
-=========== ========================== =======
-Name            output file(s)         format
-=========== ========================== =======
-=========== ========================== =======
+**Upstream tool**

-
-**Downstream tools**
+=============== ========================== ===============
+Name            output file(s)             format
+=============== ========================== ===============
+VCFtools Filter PED and MAP file    tabular and MAP
+=============== ========================== ===============

-=========== ========================== =======
-Name            output file(s)         format
-=========== ========================== =======
-=========== ========================== =======

----------
@@ -137,6 +145,11 @@
Output_name.log
Log file

+------------
+Dependencies
+------------
+plink
+ version 1.07

---------------------------------------------------

@@ -199,5 +212,21 @@

     </help>
+    <citations>
+        
+     <citation type="bibtex">@article{Dereeper03062015,
+author = {Dereeper, Alexis and Homa, Felix and Andres, Gwendoline and Sempere, Guilhem and Sarah, Gautier and Hueber, Yann and Dufayard, Jean-François and Ruiz, Manuel},
+title = {SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations},
+year = {2015},
+doi = {10.1093/nar/gkv351},
+abstract ={SNiPlay is a web-based tool for detection, management and analysis of genetic variants including both single nucleotide polymorphisms (SNPs) and InDels. Version 3 now extends functionalities in order to easily manage and exploit SNPs derived from next generation sequencing technologies, such as GBS (genotyping by sequencing), WGRS (whole gre-sequencing) and RNA-Seq technologies. Based on the standard VCF (variant call format) format, the application offers an intuitive interface for filtering and comparing polymorphisms using user-defined sets of individuals and then establishing a reliable genotyping data matrix for further analyses. Namely, in addition to the various scaled-up analyses allowed by the application (genomic annotation of SNP, diversity analysis, haplotype reconstruction and network, linkage disequilibrium), SNiPlay3 proposes new modules for GWAS (genome-wide association studies), population stratification, distance tree analysis and visualization of SNP density. Additionally, we developed a suite of Galaxy wrappers for each step of the SNiPlay3 process, so that the complete pipeline can also be deployed on a Galaxy instance using the Galaxy ToolShed procedure and then be computed as a Galaxy workflow. SNiPlay is accessible at http://sniplay.southgreen.fr.},
+URL = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.abstract},
+eprint = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.full.pdf+html},
+journal = {Nucleic Acids Research}
+}
+
+     </citation>
+
+    </citations>

</tool>

diff -r 3e19d0dfcf3e -r 420b57c3c185 PedToFasta/Ped2Fasta.pl
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/PedToFasta/Ped2Fasta.pl Fri Jul 10 04:39:30 2015 -0400

[

@@ -0,0 +1,70 @@
+
+#!/usr/bin/perl
+
+use strict;
+use Getopt::Long;
+
+my $usage = qq~Usage:$0 <args> [<opts>]
+
+where <args> are:
+
+    -i, --in           <PED input>
+    -o, --out          <Fasta output>
+~;
+$usage .= "\n";
+
+my ($input,$out);
+
+
+
+GetOptions(
+ "in=s"          => \$input,
+ "out=s"          => \$out,
+);
+
+
+die $usage
+  if ( !$input || !$out);
+
+
+my %IUPAC =
+(
+ '00'=> "?",
+ 'AA'=> "A",
+ 'CC'=> "C",
+ 'GG'=> "G",
+ 'TT'=> "T",
+        'AG'=> "R",
+        'GA'=> "R",
+        'CT'=> "Y",
+        'TC'=> "Y",
+        'TG'=> "K",
+        'GT'=> "K",
+        'CG'=> "S",
+        'GC'=> "S",
+        'AT'=> "W",
+        'TA'=> "W",
+        'AC'=> "M",
+        'CA'=> "M",
+);
+
+open(my $O,">$out");
+open(my $P,$input) or die "File does not exist";
+while(<$P>)
+{
+ my $line = $_;
+ $line =~s/\r//g;
+ $line =~s/\n//g;
+ my @infos = split("\t",$_);
+ my $ind = $infos[0];
+ print $O ">$ind\n";
+ for (my $i = 6; $i <= $#infos; $i= $i+2)
+ {
+ my $code = $infos[$i].$infos[$i+1];
+ my $letter = $IUPAC{$code};
+ print $O $letter;
+ }
+ print $O "\n";
+}
+close($P);
+close($O);

diff -r 3e19d0dfcf3e -r 420b57c3c185 PedToFasta/pedToFasta.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/PedToFasta/pedToFasta.xml Fri Jul 10 04:39:30 2015 -0400

[

@@ -0,0 +1,171 @@
+<tool id="sniplay_pedToFasta" name="Ped2Fasta" version="1.0.0">
+
+    
+    <description> Convert PED file to Fasta File </description>
+
+    
+    <requirements>
+        <requirement type="binary">perl</requirement>
+    </requirements>
+
+    
+    <version_command>
+
+    </version_command>
+
+    
+    <command interpreter="perl">
+ Ped2Fasta.pl --in $filein --out $fileout
+    </command>
+
+    
+    <inputs>
+ <param name="filein" type="data" format="txt" optional="false" label="PED input" />
+ <param name="fileout_label" type="text" value="filtered" optional="false" label="Output file name"/>
+    </inputs>
+
+    
+    <outputs>
+ <data name="fileout" type="data" format="fasta" label="${fileout_label}.fa" />
+    </outputs>
+
+    
+    <stdio>
+        
+        <exit_code range="1:" level="fatal" />
+    </stdio>
+
+    
+    <tests>
+        
+        <test>
+         <param name="filein" value="sample.ped" />
+         <output name="fileout" file="result.fa" />
+        </test>
+    </tests>
+
+    
+    <help>
+
+.. class:: infomark
+
+**Authors** Dereeper Alexis (alexis.dereeper@ird.fr), IRD, South Green platform
+
+ | **Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1).
+
+.. class:: infomark
+
+**Galaxy integration** Andres Gwendoline, Institut Français de Bioinformatique.
+
+.. class:: infomark
+
+**Support** For any questions, please send an e-mail to support.abims@sb-roscoff.fr
+
+---------------------------------------------------
+
+=========
+Ped2Fasta
+=========
+
+-----------
+Description
+-----------
+
+  Convert PED file to Fasta File
+
+-----------------
+Workflow position
+-----------------
+
+**Upstream tool**
+
+=============== ========================== =======
+Name            output file(s)             format
+=============== ========================== =======
+VCFtools Filter VCF file      VCF
+=============== ========================== =======
+
+
+**Downstream tool**
+
+=========== ========================== =======
+Name            input file(s)          format
+=========== ========================== =======
+Readseq     Fasta alignment        fasta
+=========== ========================== =======
+
+
+----------
+Input file
+----------
+
+PED file
+ PED file usually from VCF tools
+
+----------
+Parameters
+----------
+
+Output file name
+ Prefix for the output fasta file
+
+------------
+Output files
+------------
+
+Fasta file
+ PED file conversion
+
+---------------------------------------------------
+
+---------------
+Working example
+---------------
+
+Input files
+===========
+
+PED file
+---------
+
+::
+
+ CATB1   CATB1   0       0       0       0       C       T       T       A       C       T       A       T       A       T       A       G       G       A
+
+Parameters
+==========
+
+Output name -> pedFile
+
+Output files
+============
+
+pedFile.fa
+----------
+
+::
+
+        YWYWWRRSYYMKRRKMYRKSRKYRYRYKRKRSKKSYRWYSYRRYRRRWYWWYYWRRYRSRWSSRMYRRKSWMSKWRRYYWMYKYWRSYRWRYMWYYYMKYKYWRYRYRY
+
+
+    </help>
+
+    <citations>
+        
+     <citation type="bibtex">@article{Dereeper03062015,
+author = {Dereeper, Alexis and Homa, Felix and Andres, Gwendoline and Sempere, Guilhem and Sarah, Gautier and Hueber, Yann and Dufayard, Jean-François and Ruiz, Manuel},
+title = {SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations},
+year = {2015},
+doi = {10.1093/nar/gkv351},
+abstract ={SNiPlay is a web-based tool for detection, management and analysis of genetic variants including both single nucleotide polymorphisms (SNPs) and InDels. Version 3 now extends functionalities in order to easily manage and exploit SNPs derived from next generation sequencing technologies, such as GBS (genotyping by sequencing), WGRS (whole gre-sequencing) and RNA-Seq technologies. Based on the standard VCF (variant call format) format, the application offers an intuitive interface for filtering and comparing polymorphisms using user-defined sets of individuals and then establishing a reliable genotyping data matrix for further analyses. Namely, in addition to the various scaled-up analyses allowed by the application (genomic annotation of SNP, diversity analysis, haplotype reconstruction and network, linkage disequilibrium), SNiPlay3 proposes new modules for GWAS (genome-wide association studies), population stratification, distance tree analysis and visualization of SNP density. Additionally, we developed a suite of Galaxy wrappers for each step of the SNiPlay3 process, so that the complete pipeline can also be deployed on a Galaxy instance using the Galaxy ToolShed procedure and then be computed as a Galaxy workflow. SNiPlay is accessible at http://sniplay.southgreen.fr.},
+URL = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.abstract},
+eprint = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.full.pdf+html},
+journal = {Nucleic Acids Research}
+}
+
+     </citation>
+
+    </citations>
+</tool>

diff -r 3e19d0dfcf3e -r 420b57c3c185 PedToFasta/test-data/result.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/PedToFasta/test-data/result.fa Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,2 @@
+>CATB1
+YWYWWRRSYYMKRRKMYRKSRKYRYRYKRKRSKKSYRWYSYRRYRRRWYWWYYWRRYRSRWSSRMYRRKSWMSKWRRYYWMYKYWRSYRWRYMWYYYMKYKYWRYRYRYYKKYWRMMWKYYSYYWRYSKRWRSRRRYYWYYYKYYKYRMKKRYYRKYKKWWKRYWRMYRSWYWYYWRRRRRYRSRKRWKWRKKYYYKMKYYYSWSSYRRKRMSKMKRRKRWRRRRYWRKKYWRKRYWWWKMRRRYRYYWWRYYRKKWYYRRWYYRKYSRRYWRYWSWYYWWKYYKYWYRMRYRYYRRWYYYSRYRRKRRYMMSSRRYYYSRMWRRRRSWRYYMYYRYWYRRSSYYMYRKKRKYWKRRYYRYRMMWYWRYSSWYYYRYWWWWWRYRRYRYWWMMYRYYYRSYYRRRRRYYYRYYRRKKMYMRRRRSYKYRRRYWYRRYWRYSYYRYRRYSRMMKRKYYYMMRWYKWYMRYRSWRYRYMYMMRRYSRYRRRSRRSRRMKRKYYYRRYMYYRYRRKYRRRRRYYRYYWYYSRRMKRYYYSYRRYYWRMYSRYYYMMRRYYRWKMWWWYRRWYYYSWRRYRYRYRRRYRYRYRYYYYRRRWMYKMWRRYYYYRMYSSRRRWYRWRRRWYRWYRKWYYMKRYRMYRYMRRYRYYYYYRMRRWYYRSYYSYRYYYYSWKYMRYYYYYYYRRKWYYMYRYMWYYYSYYMWYMWSYWWWYRYYYSYRYMMRRRYKYRWRYYRRRKYYYKRYYRYYMYRMRYYYKWYWWYYKYRYWWRYRMSSYYYYYKYRYRRYYRYYRYRKRYYKYYYWYRYRRYYYRMYYRRRYWRRKRYYYYRRRYRYYKYYRRRRWYKWRRRMYWRYRRSWSSYYYYRYYYYYSRYYMRRYSRWMYRYYYRRYRYWYYYMWWRRYMRYYYRRMYRRSKRRYYSRYKRRRMRWYYMWYYMRWYYWWYYYKSYKYYYYYYYWYYSRWSYYYYRRYSRMYYYRRYSWYYYYWRYYSRYYKRRYYYMWYYYRWWYKYMYRRRMYYSRKYMMYYRRRWRYRRRMYKYRKRYRYRSYYRYSRMYWWWWWWYKYRSYYWKMRWWYWSMMSMRKYRSWWMKWYYYWKRRKRWRWYWWWYSYRSYYYYYRRWMMRWYRYYWYKRMWRYRYYRRWWRYMYYYRYYYMRYYYRRYRWRYRYWWKWMRWRYYRRRYWSYWRSRYWYSRYKRRYRRKRYRYWSWWYRWRRRKYKYRYYWYKKRYYYRRYYYYYRKRYKYMYYRWYKRWMYRRKYRRRYRYRWYSYRYKYMSYYRWRMWKSRSYYRWSRRRRYSMSRRWKRRRYYYRRYWWYYRRYMYMRRYWWRYYYRMRKKYKWMYYRMYYKMWMYRWRKYRSRMKSYRSYYRWMMSSKRYMYKYRWRRRRRYYSRKYRYYYYRYRRKRYYYWYYWYYWRYRKMRKRRYRYWWMMRRRYYYYWSWSRMWWYRWYSYYWRYYRRYRRYYRRRWYSSRYRYYSRRKWYSMYSSKYYRMRRRYWMRYRKRRRRKYYWSYRYYYYRRMRRYWRRRRYSYRYYRRWSRMSRYSRWYRSRYRKKWYRYYWRWRRYMKRKRKKRKYMMKYRMRRRYRRYYRMWWRRRYYWWYRKRYYYRYYYYYRYYWRRYYMYSSWRRKYRRYYRRKYSMWMWRYRMRRYRMYRRWRWRKRYSKYSSRYSRYYMRRRRWKYRSRRKKYRRMMYRMRWRRRKRWRRYYKWYRKRRRMKRRSYYWSRKRRRMYWWWWKRYRRYYMWMYRRYRRMYYSWYMMYRYSKWWRYWYRWYWWYRRYRSSMYKMSYRSRRYYYYMKWWMKSRMRYRSRYMRRRYWRYMKYRYSWWMSKYYSWYRYRRRMYYWSRWWYYRYMSSYYYRYYWYYMRYSMWRYRYYRKRRRRMRYRRWYSYYWYYMWYRYYRWRYYYSRRYRRRMMMRSYKRWWKRYYRRKYRYWRRRYWRRRYMYYYWYWYYWRRRYRYRSRWMRRRWYYYKWYRRYSRKMRRRRSKYMWKRYMKKRSMKYYRRRRKRYRKYRYMYYYYRRRMKKMRWYYKWYMWYSWWRYRKYKWWRKYRRYMYRWRYWWRYWMRRRRRRRKRSYMKYRRKRKWRYYWKSSYYWYMSYSYRWRRRMRWMRWSWYSRYYYWWRRYRSWWSKSRYYYYYYMYRYSRWSWYYYMYWYRRYWRYYYWSYRYYRKWRYYRYRWKYMSYRRRKRRWYYWKSKSYMSRRYYYYYYYYRYRWSWMYWRKYMRWYRKYRRMMYYRMYMWYKWYYRWRRRYRYYRYYYRYSYYWWYYYRYRRRSRRYRMYMKYKYRYSYKYWRWRRYSYRWKRYYWRYYYYKYMWYMWRYMWSRKRWYRMRYYRYKRSRRRWRMRRKYRYRYRYRRYRKYYRRYRRMSKRKRWKRWMYMYKRWRSRYYYKRWYRRRKRYRRYWWKYYYRMRYRRMRWSYSYWWRYMWYKRKSYRMYWKSKSRWYYYRRRSRYRYKRYWWWRMWYYSYRRYKYYYSWYKRMYRKRRRYYWSKYSKYYMYYYYKRKYYYSSRRRYRSWYRYRKMSYRRWMRSYKRYKKWYYYYMKRYWYYRYRRMRSMMYSMKYYYSRKYRYMYSRKYKYYYKRKYWYKYYYRYRRKYWRRRYYSRYRWWRRRWYMRWRRRRRYSRWKYRMWYYYRYRYRRRRRYRRRYYYYWYYRRYYYRMKYYYWWMWRRRRYRYRRRWMKRRYWKKRYRYMYMYYRYYWRYRRWRWRMYYSRWRYRYYRMKRMWSRRKRRYYRYRKWWMSYRRRRSWKYSMKYWRSYSYSSYRKRRKSYYYRWRYWYYRYRRRYYYRYRYRRYRWWYYRYRSYRRYRMRKYSYWYMWYRYYRYYYSWYYRMRKRYSYWYRWYRYRYRYYYYRRMYRYWYYYYRYRSMRYKRYRYKMYYYYYRSWSMRRYRSWYYWWYYWYRYRRYSRRYYRYKYRYRYYYRRRSYKRMYRMYWWSRWYYMYKYRRMYWRKYRYRRYYRKRYYWYYWYRRRRSRYSYYRYYRWYRRWKRRYRWSYRRYYRYYRYRRRYRKMYWYMSRYRYYWSWKRWYYMSMRWRRYKYYYRYRKWYYRRKYRRMWMWYRSKKKKYRSKWWMYYSMYRRMWRKMKRYYRRKMRKKYYWRKWKYYRRRRMYRWRRWKSRKKYMRWYRSRRKYKSWRSRRRYKYWYWYYMYRYYRRYSRRRYRYKWRRYYKMWWKYYWMRMYRRRYSYYRWMYYRYSSYYYRSRWWRSKRYRRMKYWRRSRRYYSRYRYYRYRYMSYRRYMRYRYYRMRWYRYMWKWRYKYRRKRRKSYYMRRYYYYYYMYRRRRKYYKRRWYYWMRYYRRRYYYKRYYRYYRYMKRRYRYWWYRRRRYRYYSWMMWYWMYWSYYRWWWYRRRRYWYKSKRYSSYYYWRRRMMRSYYKYRKYYMYKRYYYKRYSMYYWYRSWRRWRYKRYRYYYRYRKYYYRYKYYYYRSYKWYMWSMRRYRMKRMRYSRYSRYYYRMYKRRRWRYYRRRRYYWYYWRRKWKKRYRWRWYSMYRRSMRWWWSMRMSRKYWRRYYYWYRYSYRMWMRSWRYKKRRWSSYYYYYRYYYMYYYYMRYKYYRWYYYRYYYYYYRMYYYRRRYYYYRRYKWRYRRRYWWYKMRKSYYYYYRYWRRRRKSYSYM

diff -r 3e19d0dfcf3e -r 420b57c3c185 PedToFasta/test-data/sample.ped
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/PedToFasta/test-data/sample.ped Fri Jul 10 04:39:30 2015 -0400

b'@@ -0,0 +1,1 @@\n+CATB1\tCATB1\t0\t0\t0\t0\tC\tT\tT\tA\tC\tT\tA\tT\tA\tT\tA\tG\tG\tA\tC\tG\tC\tT\tT\tC\tA\tC\tT\tG\tA\tG\tA\tG\tT\tG\tA\tC\tC\tT\tA\tG\tT\tG\tC\tG\tA\tG\tT\tG\tT\tC\tA\tG\tC\tT\tG\tA\tT\tC\tG\tT\tG\tA\tG\tT\tG\tA\tG\tC\tT\tG\tT\tG\tC\tG\tC\tT\tA\tG\tA\tT\tC\tT\tG\tC\tT\tC\tG\tA\tA\tG\tC\tT\tG\tA\tA\tG\tG\tA\tA\tT\tT\tC\tA\tT\tA\tT\tC\tT\tC\tT\tA\tT\tA\tG\tG\tA\tC\tT\tA\tG\tG\tC\tA\tG\tA\tT\tG\tC\tC\tG\tG\tA\tC\tA\tT\tC\tA\tG\tA\tG\tT\tG\tG\tC\tA\tT\tA\tC\tG\tC\tG\tT\tA\tT\tG\tA\tG\tA\tC\tT\tC\tT\tA\tT\tC\tA\tC\tT\tT\tG\tT\tC\tA\tT\tG\tA\tC\tG\tT\tC\tG\tA\tT\tA\tA\tG\tC\tT\tC\tA\tT\tA\tC\tT\tC\tT\tT\tC\tA\tC\tG\tT\tC\tT\tT\tG\tC\tT\tA\tT\tA\tG\tC\tT\tA\tG\tC\tT\tA\tG\tC\tT\tT\tC\tT\tG\tG\tT\tC\tT\tT\tA\tA\tG\tC\tA\tA\tC\tA\tT\tT\tG\tC\tT\tC\tT\tC\tG\tC\tT\tT\tC\tT\tA\tA\tG\tT\tC\tC\tG\tT\tG\tA\tG\tA\tT\tG\tA\tG\tC\tA\tG\tA\tG\tG\tA\tC\tT\tT\tC\tT\tA\tC\tT\tT\tC\tT\tC\tT\tG\tT\tC\tT\tC\tG\tT\tT\tC\tA\tG\tA\tC\tT\tG\tG\tT\tG\tA\tC\tT\tC\tT\tA\tG\tT\tG\tT\tC\tT\tG\tT\tG\tA\tT\tT\tA\tT\tG\tG\tA\tC\tT\tT\tA\tA\tG\tC\tA\tT\tC\tG\tA\tC\tG\tA\tT\tC\tT\tT\tA\tT\tC\tT\tC\tT\tA\tG\tA\tA\tG\tA\tG\tA\tG\tA\tG\tT\tC\tG\tA\tG\tC\tA\tG\tG\tT\tG\tA\tA\tT\tT\tG\tA\tT\tA\tG\tG\tT\tT\tG\tC\tT\tT\tC\tT\tC\tG\tT\tA\tC\tG\tT\tC\tT\tT\tC\tT\tC\tG\tC\tT\tA\tC\tG\tC\tG\tC\tT\tA\tG\tG\tA\tT\tG\tG\tA\tA\tC\tC\tG\tG\tT\tA\tC\tT\tG\tA\tG\tG\tA\tG\tT\tA\tG\tA\tT\tG\tA\tG\tA\tA\tG\tG\tA\tT\tC\tA\tT\tA\tG\tG\tT\tT\tG\tC\tT\tT\tA\tA\tG\tT\tG\tG\tA\tT\tC\tT\tA\tA\tT\tT\tA\tG\tT\tA\tC\tG\tA\tG\tA\tA\tG\tC\tT\tA\tG\tC\tT\tT\tC\tT\tA\tA\tT\tA\tG\tT\tC\tT\tC\tA\tG\tT\tG\tG\tT\tT\tA\tT\tC\tT\tC\tA\tG\tG\tA\tT\tA\tT\tC\tT\tC\tA\tG\tT\tG\tC\tT\tC\tG\tA\tG\tG\tA\tC\tT\tA\tT\tA\tG\tT\tC\tA\tT\tG\tC\tA\tT\tT\tC\tC\tT\tA\tT\tA\tT\tG\tT\tT\tC\tT\tC\tG\tT\tT\tC\tA\tT\tT\tC\tG\tA\tC\tA\tA\tG\tC\tT\tA\tG\tT\tC\tC\tT\tA\tG\tA\tG\tA\tT\tC\tT\tC\tT\tT\tC\tG\tC\tG\tA\tC\tT\tA\tG\tG\tA\tT\tG\tA\tG\tG\tA\tC\tT\tA\tC\tC\tA\tG\tC\tC\tG\tG\tA\tA\tG\tC\tT\tC\tT\tC\tT\tC\tG\tA\tG\tA\tC\tA\tT\tG\tA\tG\tA\tA\tG\tA\tG\tG\tC\tA\tT\tG\tA\tC\tT\tT\tC\tC\tA\tC\tT\tT\tC\tA\tG\tT\tC\tA\tT\tC\tT\tG\tA\tG\tA\tG\tC\tC\tG\tC\tT\tC\tT\tA\tC\tT\tC\tA\tG\tT\tG\tG\tT\tA\tG\tT\tG\tC\tT\tT\tA\tG\tT\tA\tG\tG\tA\tC\tT\tT\tC\tG\tA\tT\tC\tA\tG\tC\tA\tA\tC\tA\tT\tT\tC\tT\tA\tG\tA\tT\tC\tG\tC\tG\tC\tT\tA\tC\tT\tT\tC\tT\tC\tA\tG\tT\tC\tA\tT\tA\tT\tT\tA\tA\tT\tT\tA\tG\tA\tT\tC\tG\tA\tA\tG\tT\tC\tG\tA\tC\tT\tA\tT\tA\tT\tA\tC\tA\tC\tC\tT\tA\tG\tT\tC\tT\tC\tT\tC\tA\tG\tC\tG\tC\tT\tC\tT\tG\tA\tG\tA\tG\tA\tG\tA\tG\tA\tC\tT\tT\tC\tC\tT\tA\tG\tC\tT\tT\tC\tA\tG\tA\tG\tG\tT\tG\tT\tC\tA\tC\tT\tC\tA\tG\tA\tG\tA\tG\tA\tA\tG\tC\tG\tT\tC\tT\tG\tT\tC\tG\tA\tA\tG\tG\tA\tT\tC\tT\tA\tT\tC\tA\tG\tG\tA\tT\tC\tT\tA\tA\tG\tC\tT\tG\tC\tC\tT\tC\tT\tG\tA\tT\tC\tG\tA\tG\tA\tC\tT\tG\tC\tA\tG\tA\tC\tA\tC\tG\tT\tG\tA\tG\tT\tT\tC\tT\tC\tT\tC\tC\tA\tC\tA\tG\tA\tA\tT\tC\tT\tT\tG\tT\tA\tT\tC\tA\tC\tA\tG\tT\tC\tG\tA\tC\tG\tA\tT\tA\tG\tT\tC\tA\tG\tT\tC\tA\tC\tC\tT\tC\tA\tA\tC\tG\tA\tA\tG\tT\tC\tG\tC\tG\tA\tC\tT\tG\tA\tG\tA\tA\tG\tG\tC\tA\tG\tA\tG\tG\tC\tA\tG\tA\tG\tA\tC\tG\tT\tG\tA\tG\tT\tC\tT\tC\tT\tT\tC\tG\tA\tA\tG\tC\tT\tA\tC\tC\tT\tC\tT\tA\tG\tC\tT\tG\tA\tG\tA\tG\tT\tC\tT\tG\tA\tG\tA\tG\tA\tG\tA\tG\tA\tC\tT\tT\tC\tG\tA\tC\tT\tT\tC\tA\tT\tC\tT\tT\tC\tG\tC\tG\tA\tG\tA\tA\tC\tG\tT\tG\tA\tC\tT\tC\tT\tT\tC\tC\tG\tT\tC\tG\tA\tA\tG\tT\tC\tT\tC\tA\tT\tG\tA\tC\tA\tT\tC\tG\tC\tG\tA\tC\tT\tC\tT\tC\tT\tC\tA\tC\tA\tG\tA\tG\tA\tC\tT\tC\tT\tG\tA\tT\tA\tT\tG\tA\tC\tA\tT\tT\tA\tA\tT\tC\tT\tA\tG\tG\tA\tT\tA\tC\tT\tT\tC\tT\tC\tC\tG\tT\tA\tG\tA\tG\tA\tT\tC\tA\tG\tT\tC\tG\tA\tC\tT\tA\tG\tA\tG\tG\tA\tT\tC\tG\tA\tT\tC\tA\tG\tC\tT\tG\tA\tT\tC\tC\tT\tC\tT\tT\tC\tG\tA\tA\tG\tG\tA\tA\tT\tC\tA\tT\tC\tT\tG\tC\tA\tA\tT\tA\tG\tG\tA\tC\tT\tC\tT\tC\tT\tC\tT\tG\tA\tC\tA\tT\tC\tC\tG\tG\tC\tA\tG\tG\tA\tG\tA\tT\tA\tC\tT\tG\tA\tT\tA\tA\tG\tG\tA\tA\tG\tA\tT\tT\tC\tA\tG\tA\tT\tT\tC\tA\tG\tT\tG\tA\tT\tC\tT\tC\tT\tC\tA\tG\tT\tG\tA\tC\tT\tG\tA\tC\tA\tC\tT\tG\tA\tC\tT\tC\tA\tG\tA\tG\tA\tC\tT\tA\tG\tT\tC\tT\tC\tC\tT\tC\tT\tC\tT\tG\tA\tA\tC\tA\tG\tA\tG\tA\tT\tC\tT\tC\tT\tG\tA\tG\tC\tC\tT\tT\tC\tC\tG\tT\tC\tA\tG\tT\tC\tC\tT\tT\tC\tC\tT\tG\tC\tA\tT\tG\tT\tC\tT\tA\tC\tA\tG\tC\tT\tT\tC\tC\tT\tC\tT\tC\tT\tT\tC\tC\tT\tG\tA\tG\tA\tG\tT\tA\tT\tC\tT\tT\tC\tC\tA\tC\tT\tG\tA\tC\tT\tC\tA\tT\tA\tC\tT\tC\tT\tT\tC\tC\tG\tC\tT\tT\tC\tA\tC\tT\tA\tC\tT\tA\tC\tA\tT\tC\tG\tT\tC\tT\tA\tA\tT\tT\tA\tT\tC\tG\tA\tC\tT\tC\tT\tT\tC\tC\tG\tT\tC\tG\tA\tC\tT\tA\tC\tC\tA\tG\tA\tG\tA\tG\tA\tT\tC\tT\tG\tT\tC\tA\tG\tA\tT\tG\tA\tT\tC\tC\tT\tG\tA\tA\tG\tA\tG\tT\tG\tC\tT\tC\tT\tT\tC\tT\tG\tG\tA\tC\tT\tC\tT\tG\tA\tC\tT\tC\tT\tC\tA\tT\tC\tG\tA\tC\tA\tG\tA\tC\tT\tT\tC\tT\tC\tG\tT\tA\tT\tC\tT\tT\tA\tT\tA\tT\tC\tC\tT\tT\tG\tC\tT\tG\tA\tT\tC\tA\tT\tT\tA\tA\tG\tT\tC\tG\tA\tA\tC\tG\tC\tG\tC\tC\tT\tT\tC\tC\tT\tC\tT\tC\tT\tT\tG\tT\tC\tA\tG\tT\tC\tA\tG\tA\tG\tC\tT\tC\tT\tA\tG\tC\tT\tT\tC\tG\tA\tC\tT\tG\tA\tG\tT\tG\tA\tC\tT\tC\tT\tG\tT\tC\tT\tC\tT\tC\tT\tT\tA\tC\tT\tA\tG\tT\tC\tG\tA\tG\tA\tC\tT\tT\tC\tC\tT\tG\tA\tA\tC\tC\tT\tC\tT\tA\tG\tG\tA\tG\tA\tC\tT\tA\tT\tA\tG\tA\tG\tG\tT\tA\tG\tC\tT\tC\tT\tC\tT\tC\tT\tA\tG\tA\tG\tG\tA\tC\tT\tG\tA\tC\tT\tC\tT\tG\tT\tC\tT\tT\tC\tG\tA\tG\tA\tG\tA\tG\tA\tT\tA\tC\tT\tG\tT\tT\tA\tG\tA\tG\tA\tG\tA\tC\tA\tT\tC\tA\tT\tG\tA\tT\tC\tA\tG\tG\tA\tC\tG\tA\tT\tC\tG\tG\tC\tC\tT\tC\tT\tC\tT\tC\tT\tG\tA\tT\tC\tC\tT\tC\tT\tT\tC\tC\tT\tC\tG\tA\tG\tT\tC\tT\tC\tC\tA\tG\tA\tA\tG\tC\tT\tC\tG\tG\tA\tA\tT\tA\tC\tT\tC\tA\tG\tC\tT\tC\tT\tC\tT\tG\tA\tG\tA\tC\tT\tA\tG\tC\tT\tT\tA\tC\tT\tT\tC\tC\tT\tA\tC\tA\tT\tA\tT\tG\tA\tG\tA\tC\tT\tA\tC\tG\tA\tT\tC\tC\tT\tC\tT\tG\tA\tG\tA\tA\tC\tC\tT\tG\tA\tG\tA\tG\tC\tT\tG\tG\tA\tA\tG\tC\tT\tC\tT\tG\tC\tG\tA\tT\tC\tG\tT\tG\tA\tG\tA\tG\tA\tA\tC\tA\tG\tT\tA\tT\tC\tT\tC\tC\tA\tT\tA\tC\tT\tC\tT\tA\tC\tG\tA\tT\tA\tC\tT\tC\tT\tT\tA\tT\tA\tT\tC\tT\tC\tT\tC\tG\tT\tC\tG\tT\tC\tT\tG\tT\tC\tC\tT\tC\tT\tT\tC\tC\tT\tC\tT\tT\tC\tT\tA\tC\tT\tT\tC\tC\tG\tA\tG\tT\tA\tC\tG\tC\tT\tC\tT\tC\tT\tT\tC\tG\tA\tG\tA\tT\tC\tG\tC\tA\tG\tA\tC\tT\tC\tC\tT\tT\tC\tG\tA\tG\tA\tT\tC\tC\tG\tA\tT\tC\tT\tC\tT\tT\tC\tC\tT\tA\tT\tG\tA\tC\tT\tC\tT\tC\tG\tA\tG\tT\t'..b'\tG\tG\tA\tA\tG\tG\tA\tC\tT\tC\tG\tG\tA\tT\tA\tG\tT\tT\tC\tA\tG\tA\tC\tT\tA\tC\tT\tC\tT\tT\tC\tA\tG\tT\tC\tA\tG\tT\tC\tG\tA\tA\tG\tA\tG\tA\tG\tG\tA\tC\tT\tA\tG\tG\tA\tA\tG\tC\tT\tC\tT\tT\tC\tC\tT\tA\tT\tT\tC\tC\tT\tA\tG\tG\tA\tC\tT\tT\tC\tT\tC\tG\tA\tC\tA\tG\tT\tT\tC\tT\tC\tT\tC\tT\tA\tA\tT\tC\tA\tA\tT\tA\tG\tA\tG\tA\tG\tA\tG\tC\tT\tA\tG\tC\tT\tA\tG\tA\tG\tA\tG\tA\tT\tA\tC\tT\tG\tG\tA\tA\tG\tT\tC\tT\tA\tG\tT\tT\tG\tA\tG\tT\tC\tA\tG\tT\tC\tC\tA\tC\tT\tC\tA\tT\tC\tT\tC\tA\tG\tC\tT\tT\tC\tT\tA\tA\tG\tC\tT\tA\tG\tG\tA\tT\tA\tG\tA\tA\tT\tA\tG\tA\tC\tT\tC\tC\tT\tG\tC\tG\tA\tT\tA\tG\tA\tC\tT\tA\tG\tT\tC\tC\tT\tG\tA\tC\tA\tG\tT\tG\tA\tC\tA\tA\tT\tC\tG\tG\tA\tA\tG\tG\tT\tA\tG\tG\tA\tC\tT\tT\tC\tG\tA\tC\tT\tA\tG\tG\tT\tA\tT\tT\tA\tA\tC\tC\tG\tC\tT\tG\tA\tG\tA\tA\tG\tA\tG\tC\tG\tT\tA\tG\tT\tC\tT\tG\tC\tA\tC\tT\tG\tT\tC\tT\tA\tA\tG\tC\tG\tC\tT\tG\tC\tT\tC\tC\tG\tG\tC\tC\tT\tG\tA\tT\tG\tG\tA\tA\tG\tT\tG\tC\tG\tC\tT\tC\tT\tT\tC\tA\tG\tA\tT\tA\tG\tT\tC\tA\tT\tC\tT\tC\tT\tG\tA\tC\tT\tG\tA\tG\tA\tA\tG\tC\tT\tT\tC\tT\tC\tA\tG\tT\tC\tG\tA\tT\tC\tA\tG\tA\tG\tC\tT\tG\tA\tA\tT\tA\tT\tT\tC\tT\tC\tG\tA\tT\tC\tA\tG\tG\tC\tC\tT\tG\tA\tA\tG\tT\tC\tG\tA\tA\tC\tA\tG\tG\tT\tT\tC\tG\tC\tC\tT\tT\tA\tC\tT\tC\tA\tA\tT\tC\tT\tG\tA\tC\tT\tT\tC\tG\tA\tT\tC\tT\tC\tT\tC\tC\tG\tA\tT\tT\tC\tC\tT\tG\tA\tA\tC\tG\tA\tT\tG\tG\tA\tT\tC\tG\tC\tC\tT\tA\tT\tC\tT\tA\tG\tA\tT\tT\tC\tA\tG\tC\tT\tG\tA\tC\tT\tG\tA\tC\tT\tT\tC\tC\tT\tC\tT\tG\tA\tG\tA\tA\tC\tC\tT\tG\tA\tC\tT\tT\tA\tC\tT\tC\tT\tT\tC\tT\tC\tG\tA\tC\tT\tG\tA\tG\tC\tA\tC\tG\tA\tT\tC\tT\tG\tG\tA\tC\tT\tG\tA\tT\tC\tT\tG\tC\tA\tC\tT\tC\tT\tT\tC\tC\tT\tT\tC\tA\tG\tC\tG\tT\tA\tC\tG\tA\tC\tA\tG\tA\tG\tC\tT\tG\tA\tG\tC\tA\tT\tT\tC\tC\tT\tT\tA\tA\tT\tT\tC\tC\tT\tT\tA\tC\tT\tG\tA\tC\tT\tG\tA\tA\tG\tT\tC\tC\tG\tG\tA\tG\tA\tT\tC\tT\tC\tA\tG\tC\tT\tT\tG\tC\tT\tA\tG\tC\tT\tA\tG\tT\tC\tT\tC\tT\tC\tA\tG\tG\tA\tG\tA\tC\tG\tC\tT\tT\tG\tA\tG\tC\tA\tC\tT\tA\tG\tC\tA\tT\tC\tA\tT\tT\tA\tG\tC\tA\tG\tT\tA\tT\tC\tC\tT\tC\tA\tT\tC\tT\tG\tT\tC\tA\tG\tA\tG\tC\tA\tC\tT\tA\tT\tA\tG\tG\tT\tT\tC\tG\tA\tC\tT\tG\tA\tG\tA\tC\tT\tC\tT\tG\tA\tG\tT\tG\tA\tT\tC\tT\tC\tT\tA\tC\tT\tC\tT\tA\tT\tC\tT\tG\tA\tA\tG\tG\tA\tG\tA\tG\tC\tA\tG\tT\tC\tC\tG\tC\tT\tC\tT\tG\tA\tC\tT\tC\tT\tG\tA\tA\tT\tC\tT\tG\tA\tA\tG\tT\tA\tT\tG\tG\tA\tG\tA\tC\tT\tG\tA\tT\tA\tG\tC\tC\tT\tG\tA\tG\tA\tT\tC\tC\tT\tG\tA\tT\tC\tT\tC\tG\tA\tC\tT\tG\tA\tG\tA\tG\tA\tT\tC\tA\tG\tT\tG\tA\tC\tC\tT\tT\tA\tT\tC\tC\tA\tG\tC\tG\tA\tC\tT\tG\tA\tC\tT\tC\tT\tT\tA\tC\tG\tT\tA\tT\tG\tG\tA\tT\tA\tC\tT\tC\tT\tA\tC\tG\tC\tA\tC\tG\tA\tA\tT\tA\tG\tA\tG\tT\tC\tG\tT\tC\tT\tC\tT\tT\tC\tA\tG\tT\tC\tA\tG\tT\tG\tA\tT\tT\tC\tC\tT\tG\tA\tA\tG\tG\tT\tT\tC\tA\tG\tG\tA\tA\tC\tA\tT\tA\tC\tT\tA\tC\tT\tA\tG\tG\tC\tT\tG\tG\tT\tG\tT\tG\tT\tT\tC\tA\tG\tG\tC\tT\tG\tT\tA\tA\tT\tA\tC\tT\tC\tC\tT\tG\tC\tC\tA\tC\tT\tA\tG\tA\tG\tA\tC\tT\tA\tA\tG\tT\tG\tA\tC\tT\tG\tG\tA\tT\tC\tT\tC\tA\tG\tG\tA\tT\tG\tC\tA\tA\tG\tG\tT\tG\tT\tC\tT\tC\tT\tT\tA\tG\tA\tT\tG\tA\tT\tT\tG\tC\tT\tC\tT\tA\tG\tG\tA\tG\tA\tG\tA\tA\tC\tC\tT\tG\tA\tT\tA\tA\tG\tG\tA\tA\tT\tT\tG\tG\tC\tA\tG\tT\tG\tG\tT\tT\tC\tA\tC\tG\tA\tT\tA\tT\tC\tG\tA\tC\tG\tA\tG\tG\tA\tG\tT\tC\tT\tG\tT\tC\tG\tA\tT\tG\tA\tG\tC\tG\tA\tA\tG\tG\tA\tT\tC\tG\tT\tC\tT\tA\tT\tT\tC\tA\tT\tT\tC\tT\tC\tA\tC\tT\tC\tG\tA\tT\tC\tC\tT\tG\tA\tG\tA\tC\tT\tC\tG\tG\tA\tG\tA\tA\tG\tC\tT\tG\tA\tT\tC\tT\tG\tA\tT\tA\tG\tA\tG\tC\tT\tT\tC\tG\tT\tA\tC\tT\tA\tT\tA\tG\tT\tC\tT\tC\tT\tT\tA\tA\tC\tG\tA\tC\tA\tC\tT\tA\tG\tG\tA\tA\tG\tC\tT\tC\tG\tC\tT\tC\tT\tG\tA\tT\tA\tC\tA\tT\tC\tC\tT\tA\tG\tT\tC\tG\tC\tC\tG\tC\tT\tC\tT\tC\tT\tG\tA\tC\tG\tG\tA\tA\tT\tA\tT\tG\tA\tC\tG\tG\tT\tA\tG\tC\tT\tA\tG\tA\tG\tC\tA\tG\tT\tC\tT\tA\tT\tA\tG\tA\tG\tC\tG\tG\tA\tA\tG\tC\tT\tC\tT\tG\tC\tG\tA\tC\tT\tA\tG\tT\tC\tT\tC\tA\tG\tT\tC\tG\tA\tC\tT\tA\tC\tC\tG\tC\tT\tA\tG\tA\tG\tC\tT\tC\tA\tG\tA\tT\tC\tA\tG\tC\tT\tT\tC\tG\tA\tC\tA\tA\tG\tA\tT\tT\tC\tA\tG\tC\tT\tC\tA\tT\tA\tG\tT\tT\tA\tG\tA\tT\tC\tT\tG\tC\tT\tG\tA\tG\tA\tG\tT\tG\tA\tG\tA\tG\tT\tG\tC\tC\tT\tC\tT\tA\tC\tA\tG\tG\tA\tC\tT\tC\tT\tC\tT\tC\tT\tC\tT\tT\tC\tC\tA\tC\tT\tG\tA\tG\tA\tG\tA\tG\tA\tG\tT\tT\tC\tT\tC\tG\tT\tA\tG\tG\tA\tA\tT\tT\tC\tT\tC\tA\tT\tA\tC\tA\tG\tT\tC\tC\tT\tG\tA\tG\tA\tA\tG\tC\tT\tT\tC\tT\tC\tG\tT\tG\tA\tT\tC\tC\tT\tA\tG\tT\tC\tT\tC\tA\tG\tC\tT\tA\tC\tT\tG\tG\tA\tA\tG\tC\tT\tA\tG\tC\tT\tT\tA\tT\tA\tC\tT\tG\tA\tA\tG\tA\tG\tG\tA\tC\tT\tG\tA\tC\tT\tT\tC\tC\tG\tA\tT\tA\tC\tC\tA\tT\tA\tC\tT\tT\tA\tC\tA\tT\tC\tA\tT\tC\tG\tT\tC\tT\tC\tG\tA\tT\tA\tT\tA\tT\tA\tT\tC\tG\tA\tA\tG\tA\tG\tG\tA\tC\tT\tT\tA\tC\tT\tG\tT\tG\tC\tT\tG\tG\tA\tT\tC\tG\tC\tG\tC\tC\tT\tC\tT\tT\tC\tA\tT\tG\tA\tG\tA\tG\tA\tA\tC\tA\tC\tA\tG\tC\tG\tT\tC\tT\tC\tT\tG\tC\tT\tA\tG\tG\tT\tC\tT\tC\tT\tC\tA\tC\tT\tT\tG\tA\tG\tT\tC\tC\tT\tT\tC\tT\tG\tG\tA\tC\tT\tG\tC\tC\tA\tT\tC\tT\tC\tT\tA\tT\tC\tG\tA\tG\tC\tA\tT\tG\tA\tA\tG\tT\tA\tA\tG\tC\tT\tG\tT\tA\tG\tC\tT\tA\tG\tT\tC\tT\tC\tT\tC\tA\tG\tT\tC\tA\tG\tG\tT\tC\tT\tT\tC\tT\tC\tA\tG\tC\tT\tT\tG\tC\tT\tC\tT\tC\tT\tC\tT\tG\tA\tG\tC\tC\tT\tG\tT\tT\tA\tC\tT\tA\tC\tT\tA\tG\tC\tA\tC\tG\tA\tA\tG\tC\tT\tA\tG\tC\tA\tT\tG\tG\tA\tA\tC\tA\tG\tT\tC\tG\tC\tG\tA\tC\tT\tC\tG\tA\tG\tC\tT\tC\tT\tT\tC\tG\tA\tC\tA\tT\tC\tT\tG\tA\tG\tG\tA\tG\tA\tA\tT\tA\tG\tC\tT\tC\tT\tG\tA\tG\tA\tG\tA\tA\tG\tT\tC\tT\tC\tA\tT\tT\tC\tT\tC\tA\tT\tA\tG\tG\tA\tT\tG\tA\tT\tG\tT\tT\tG\tA\tG\tT\tC\tA\tG\tA\tT\tA\tG\tA\tT\tC\tT\tC\tG\tC\tA\tC\tT\tG\tA\tG\tA\tG\tC\tC\tA\tG\tA\tA\tT\tT\tA\tA\tT\tC\tG\tC\tA\tA\tG\tC\tA\tC\tG\tG\tA\tG\tT\tC\tT\tT\tA\tA\tG\tG\tA\tC\tT\tT\tC\tC\tT\tA\tT\tC\tT\tA\tG\tT\tC\tC\tG\tC\tT\tA\tG\tA\tC\tT\tA\tA\tC\tA\tG\tG\tC\tA\tT\tA\tG\tC\tT\tT\tG\tT\tG\tA\tG\tA\tG\tT\tA\tC\tG\tG\tC\tC\tT\tT\tC\tT\tC\tC\tT\tT\tC\tG\tA\tT\tC\tT\tC\tT\tC\tC\tA\tC\tT\tC\tT\tT\tC\tT\tC\tA\tC\tA\tG\tC\tT\tG\tT\tT\tC\tT\tC\tA\tG\tT\tA\tC\tT\tT\tC\tC\tT\tA\tG\tC\tT\tC\tT\tC\tT\tC\tT\tC\tT\tC\tT\tG\tA\tA\tC\tC\tT\tC\tT\tC\tT\tG\tA\tG\tA\tG\tA\tC\tT\tT\tC\tC\tT\tT\tC\tA\tG\tA\tG\tC\tT\tT\tG\tT\tA\tG\tA\tC\tT\tG\tA\tA\tG\tG\tA\tC\tT\tA\tT\tA\tT\tT\tC\tT\tG\tA\tC\tG\tA\tG\tT\tC\tG\tC\tT\tT\tC\tT\tC\tT\tC\tT\tC\tG\tA\tC\tT\tT\tA\tG\tA\tG\tA\tA\tG\tA\tG\tT\tG\tG\tC\tT\tC\tC\tG\tT\tC\tC\tA\tG\tA\n'

diff -r 3e19d0dfcf3e -r 420b57c3c185 Rooting/Rooting.pl
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/Rooting/Rooting.pl Fri Jul 10 04:39:30 2015 -0400

[

@@ -0,0 +1,59 @@
+#!/usr/bin/perl
+
+use strict;
+use Switch;
+use Getopt::Long;
+use Bio::SeqIO;
+use Cwd ;
+use FindBin qw ( $Bin $Script );
+
+my $CURRENT_DIR = $Bin;
+
+my $ROOTING_EXE = "java -jar ". $CURRENT_DIR . "/Rootings_54.jar";
+
+my $usage = qq~Usage:$0 <args> [<opts>]
+where <args> are:
+    -i, --input         <newick input>
+    -o, --output        <newick output>
+~;
+$usage .= "\n";
+
+my ($input,$outfile);
+
+
+GetOptions(
+ "input=s"    => \$input,
+ "output=s"   => \$outfile
+);
+
+
+die $usage
+  if ( !$input || !$outfile);
+
+my $treefile = $input;
+
+
+# replace negative values by 0
+open(T,$treefile);
+open(T2,">$treefile.2");
+while(<T>)
+{
+ my $line = $_;
+ $line =~s/\-\d+\.*\d*\,/0,/g;
+ $line =~s/\-\d+\.*\d*\)/0\)/g;
+ print T2 $line;
+}
+close(T);
+close(T2);
+
+my $rooting_command = $ROOTING_EXE . " -input $treefile.2 -output $treefile.all -midpoint $treefile.midpoint >>$treefile.rooting.log 2>&1";
+system($rooting_command);
+
+unlink("$treefile.all");
+unlink("$treefile.2");
+rename("$treefile.midpoint",$outfile);
+
+
+
+
+

diff -r 3e19d0dfcf3e -r 420b57c3c185 Rooting/Rootings_54.jar

Binary file Rooting/Rootings_54.jar has changed

diff -r 3e19d0dfcf3e -r 420b57c3c185 Rooting/rooting.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/Rooting/rooting.xml Fri Jul 10 04:39:30 2015 -0400

[

@@ -0,0 +1,193 @@
+<tool id="sniplay_rooting" name="Rooting" version="1.0.2">
+
+    
+    <description> Midpoint rooting of newick tree </description>
+
+    
+    <requirements>
+        <requirement type="binary">perl</requirement>
+ <requirement type="package">Rootings_54.jar</requirement>
+    </requirements>
+
+    
+    <version_command>
+
+    </version_command>
+
+    
+    <command interpreter="perl">
+ Rooting.pl -i $filein -o $fileout && mv ${filein}.rooting.log $fileout_log
+    </command>
+
+    
+    <inputs>
+ <param name="filein" type="data" format="txt" optional="false" label="Fasta alignment input" />
+ <param name="fileout_label" type="text" value="out tree" label="Output name" help="Output name for files" />
+    </inputs>
+
+    
+    <outputs>
+ <data name="fileout_log" type="data" format="txt" label="${fileout_label}.log" />
+ <data name="fileout" type="data" format="txt" label="${fileout_label}" />
+    </outputs>
+
+    
+    <stdio>
+        
+        <exit_code range="1:" level="fatal" />
+    </stdio>
+
+    
+    <tests>
+        
+
+        <test>
+         <param name="filein" value="newick" />
+         <output name="fileout" file="out_tree" />
+ <output name="fileout_log" file="out_tree.log" />
+        </test>
+
+        
+
+    </tests>
+
+    
+    <help>
+
+
+.. class:: infomark
+
+**Authors** Jean-François Dufayard, CIRAD, South Green platform
+
+
+.. class:: infomark
+
+**Galaxy integration** Andres Gwendoline, Institut Français de Bioinformatique.
+
+.. class:: infomark
+
+**Support** For any questions about Galaxy integration, please send an e-mail to support.abims@sb-roscoff.fr
+
+.. class:: infomark
+
+**Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1).
+
+---------------------------------------------------
+
+
+
+
+=======
+Rooting
+=======
+
+-----------
+Description
+-----------
+
+  Compute a midpoint newick rooted tree.
+
+
+-----------------
+Workflow position
+-----------------
+
+**Upstream tool**
+
+=========== ========================== =======
+Name            output file(s)         format
+=========== ========================== =======
+fastme      Newick tree                Newick
+=========== ========================== =======
+
+
+
+----------
+Input file
+----------
+
+Newick file
+
+
+----------
+Parameters
+----------
+
+Output name
+        Output base name for the ouput files
+
+
+------------
+Output files
+------------
+
+Output_name
+ Resulting tree rooted in newick format
+
+Output_name.log
+ Log file
+
+------------
+Dependencies
+------------
+Rooting
+ CIRAD tool. Contact jean-francois.dufayard@cirad.fr
+
+---------------------------------------------------
+
+---------------
+Working example
+---------------
+
+Input files
+===========
+
+Newick file
+-----------
+
+::
+
+ (((((((((((((((((((((((((GOGOLEMPUK:0.001198,GOGOLEMPAK:0.002128):0.030378,TREMBESE:0.013258):0.055246,(((JIMBRUKJOL:0.045219,KETANKONIR:0.035298):0.006267, ...
+
+
+Parameters
+==========
+
+Output name -> out tree
+
+
+Output files
+============
+
+out tree
+--------
+
+::
+
+ (ref:0.9384270000000001,(((((((((((((((((((((((((((((((((((IRAT257:0.044246,IRAT112:0.023421):0.009006,ARAGUAIA:0.093061):0.004662...
+
+
+    </help>
+    <citations>
+        
+     <citation type="bibtex">@article{Dereeper03062015,
+author = {Dereeper, Alexis and Homa, Felix and Andres, Gwendoline and Sempere, Guilhem and Sarah, Gautier and Hueber, Yann and Dufayard, Jean-François and Ruiz, Manuel},
+title = {SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations},
+year = {2015},
+doi = {10.1093/nar/gkv351},
+abstract ={SNiPlay is a web-based tool for detection, management and analysis of genetic variants including both single nucleotide polymorphisms (SNPs) and InDels. Version 3 now extends functionalities in order to easily manage and exploit SNPs derived from next generation sequencing technologies, such as GBS (genotyping by sequencing), WGRS (whole gre-sequencing) and RNA-Seq technologies. Based on the standard VCF (variant call format) format, the application offers an intuitive interface for filtering and comparing polymorphisms using user-defined sets of individuals and then establishing a reliable genotyping data matrix for further analyses. Namely, in addition to the various scaled-up analyses allowed by the application (genomic annotation of SNP, diversity analysis, haplotype reconstruction and network, linkage disequilibrium), SNiPlay3 proposes new modules for GWAS (genome-wide association studies), population stratification, distance tree analysis and visualization of SNP density. Additionally, we developed a suite of Galaxy wrappers for each step of the SNiPlay3 process, so that the complete pipeline can also be deployed on a Galaxy instance using the Galaxy ToolShed procedure and then be computed as a Galaxy workflow. SNiPlay is accessible at http://sniplay.southgreen.fr.},
+URL = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.abstract},
+eprint = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.full.pdf+html},
+journal = {Nucleic Acids Research}
+}
+
+     </citation>
+
+    </citations>
+
+</tool>

diff -r 3e19d0dfcf3e -r 420b57c3c185 Rooting/test-data/newick
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/Rooting/test-data/newick Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,2 @@
+(((((((((((((((((((((((((GOGOLEMPUK:0.001198,GOGOLEMPAK:0.002128):0.030378,TREMBESE:0.013258):0.055246,(((JIMBRUKJOL:0.045219,KETANKONIR:0.035298):0.006267,KANIRANGA:0.042518):0.020121,(VARYMADINI:0.039903,BENGALYVAK:0.032305):0.012408):0.004740):0.001841,(((YANCAOUSSA:0.006364,PATEBLANCM:0.008832):0.000858,MOROBEREKA:0.004615):0.013114,VARYMALADY:0.026086):0.024153):0.015663,WAB706-3-4:0.050598):0.004174,(MAINTIMOLO:0.044761,(FOHISOMOTR:0.005656,VARYSOMOTR:0.006949):0.030574):0.009217):0.006248,IRAT364:0.047033):0.003654,((IRAT366:0.033773,CIRAD358:0.093382):0.015822,(((MANANELATR:0.040437,(ARROZCEBAD:0.027110,GRAZI:0.022678):0.000763):0.009870,KOMOJAMANI:0.049216):0.006713,((TSIPALA89:-0.000887,VARYLAVADE:0.037778):0.044182,MITSANGANA:0.082664):0.068968):0.000971):0.009442):0.002985,(((((((((JUMALI:0.077650,LAMBAYQUE1:0.170057):0.027742,(GOMPA2:0.049418,KAKANI2:0.052752):0.024526):0.081123,JUMULA2:0.075284):0.027607,ref:0.722923):0.015245,((((NPE826:0.019317,NPE253:0.017161):0.033863,((GIZA171:0.023894,NIPPONBARE:0.027998):0.013954,M202:0.053155):0.016691):0.020398,NEPHOAVANG:0.097913):0.011042,BABER:0.155657):0.024483):0.043699,((((((((DAM:0.054359,((((VIETNAM3:0.030951,SENG:0.038876):0.007914,(NABESHI:0.010252,KARASUKARA:0.010553):0.032650):0.012575,VIETNAM1:0.049323):0.003110,(PEHPINUO:0.070737,(CHUAN3:0.020631,CHUAN4:0.024135):0.014450):0.010970):0.020849):0.002227,(((((JAOHAW:0.044517,KHAODAM:0.031174):0.017389,MAHAE:0.041633):0.006695,(KHAOKAPXAN:0.005767,HAWMOM:0.009429):0.031367):0.015885,CHAPHUMA:0.071266):0.005503,KU115:0.043819):0.007631):0.009768,NHTA10:0.061745):0.006241,INDANE:0.079646):0.007679,(((GEMJYAJYAN:0.012403,YANGKUMRED:0.014267):0.008479,DANGREY:0.024493):0.020552,DAWASANRED:0.030369):0.065249):0.006240,CHALOYOE:0.058075):0.012844,NHTA5:0.138764):0.005686,YUNLU7:0.079119):0.012627):0.020665,CUIABANA:0.066182):0.018877,((GANIGI:0.040448,PULULAPA:0.039840):0.020258,GOGO:0.060904):0.005609):0.001416,(((((GUNDILKUNI:0.019719,(CICIHBETON:0.021620,BULUPANDAK:0.016924):0.008554):0.028704,PADIBOENAR:0.052396):0.002882,(REKETMAUN:0.059430,((POENOETHIT:0.042637,KETANLUMBU:0.035696):0.016617,MOLOK:0.055674):0.015506):0.001164):0.024179,PADIKASALL:0.093595):0.063014,RATHAL:0.090729):0.015609):0.008281):0.005079,RT1031-69:0.043520):0.002593,MANDRIRAVI:0.049833):0.005647,IRAT234:0.037316):0.007912,((((EARLYMUTAN:0.015218,(IAC25:0.007986,(DOURADOAGU:0.001563,DOURADOPRE:0.001763):0.010062):0.002688):0.011250,(((IAC47:0.007321,(IAC165:0.000500,VARYLAVA90:0.001650):0.006263):0.003063,HD1-4:0.015932):0.006876,GUARANI:0.013831):0.005817):0.007843,IGUAPECATE:0.036421):0.002898,BICOBRANCO:0.031026):0.008082):0.001457,((((((((IR60080-46:0.102166,IR71525-19:0.037083):0.071364,IR68704-14:0.144370):0.009188,((IR66421-10:0.104309,IR66421-09:0.112363):0.044923,CNA-7_BO_1:0.097756):0.030658):0.043160,(((((((CIRAD403:0.043568,MARAVILHA:0.105095):0.009135,CURINCA:0.140813):0.023139,CIRAD409:0.038172):0.045565,PCT4_SA_4_:0.177389):0.024197,(PCT11_0_0_:0.075858,P5589-1-1-:0.044714):0.022844):0.006949,ESPERANZA:0.077139):0.022033,((CT13582-15:0.086985,((((((IRAT216:0.017956,IR47684-05:0.006483):0.014180,((IR63372-08:0.008257,IR65907-18:0.049347):0.060968,IR65907-20:0.025334):0.004085):0.028888,COLOMBIA1:0.106747):0.009488,WAB56-50:0.048646):0.019308,IDSA77:0.026889):0.022776,WAB56-125:0.057970):0.025793):0.017149,IRAT362:0.030612):0.021338):0.005273):0.007474,((IR65261-19:0.088569,IR63380-16:0.060828):0.017377,ORYZICASAB:0.059793):0.020771):0.010205,((((IRAT2:0.006656,(62667:0.002564,(IRAT177:0.003065,IRAT13:0.006564):0.001422):0.001435):0.014034,IRAT109:0.079089):0.006041,IRAT170:0.013368):0.020262,63-104:0.022825):0.010789):0.003440,(((((KUROKA:0.096901,IRAT144:0.032372):0.040630,CIRAD488:0.062971):0.026055,(IRAT212:0.041268,PRIMAVERA:0.059109):0.012806):0.027141,((CIRAD392:0.025487,IRAT380:0.024721):0.028822,CIRAD394:0.055046):0.034180):0.011060,CAIAPO:0.072220):0.009469):0.006119,((ARAGUAIA:0.084755,(IRAT335:0.077784,IRAT112:0.027346):0.006445):0.007072,IRAT257:0.036873):0.020075):0.002575):0.004673,((IR47686-09:0.045565,IRAT104:0.041351):0.019777,IR71524-44:0.058741):0.008141):0.006303,((OS4:0.021016,OS6:0.015670):0.010953,(CANAROXA:0.018385,KINANDANGP:0.047364):0.022379):0.007502):0.001209,TRESMESES:0.028972):0.002988,PACHOLINHA:0.042509):0.002897,CANELADEFE:0.050931):0.011439,CAAWA/FORT:0.055630):0.006838,((LUDAN:0.054230,((CUBA65:0.037658,(IR53236-27:0.026784,AZUCENA:0.025318):0.020859):0.017556,DAVAO:0.045931):0.005774):0.010335,(BINULAWAN:0.059589,MALAGKITPI:0.062856):0.004216):0.000088):0.004898,DINORADO:0.065206):0.004869,(BAGANANASA:0.049455,BAKUNGH:0.048193):0.021502):0.004581,((SPEAKER:0.057882,(KEDAYAN:0.065817,ARIAS:0.074161):0.019154):0.012584,(TANDUI:0.078177,KETANMENAH:0.079797):0.013169):0.003598):0.031721,PALAWAN:0.032789,KENDINGA5H:0.028863);
+

diff -r 3e19d0dfcf3e -r 420b57c3c185 Rooting/test-data/out_tree
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/Rooting/test-data/out_tree Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,1 @@
+(ref:0.575788,(((((((((((((((((((((((PALAWAN:0.032789,KENDINGA5H:0.028863):0.031721,((SPEAKER:0.057882,(KEDAYAN:0.065817,ARIAS:0.074161):0.019154):0.012584,(TANDUI:0.078177,KETANMENAH:0.079797):0.013169):0.003598):0.004581,(BAGANANASA:0.049455,BAKUNGH:0.048193):0.021502):0.004869,DINORADO:0.065206):0.004898,((LUDAN:0.05423,((CUBA65:0.037658,(IR53236-27:0.026784,AZUCENA:0.025318):0.020859):0.017556,DAVAO:0.045931):0.005774):0.010335,(BINULAWAN:0.059589,MALAGKITPI:0.062856):0.004216):8.8E-5):0.006838,CAAWA/FORT:0.05563):0.011439,CANELADEFE:0.050931):0.002897,PACHOLINHA:0.042509):0.002988,TRESMESES:0.028972):0.001209,((OS4:0.021016,OS6:0.01567):0.010953,(CANAROXA:0.018385,KINANDANGP:0.047364):0.022379):0.007502):0.006303,((IR47686-09:0.045565,IRAT104:0.041351):0.019777,IR71524-44:0.058741):0.008141):0.004673,((((((((IR60080-46:0.102166,IR71525-19:0.037083):0.071364,IR68704-14:0.14437):0.009188,((IR66421-10:0.104309,IR66421-09:0.112363):0.044923,CNA-7_BO_1:0.097756):0.030658):0.04316,(((((((CIRAD403:0.043568,MARAVILHA:0.105095):0.009135,CURINCA:0.140813):0.023139,CIRAD409:0.038172):0.045565,PCT4_SA_4_:0.177389):0.024197,(PCT11_0_0_:0.075858,P5589-1-1-:0.044714):0.022844):0.006949,ESPERANZA:0.077139):0.022033,((CT13582-15:0.086985,((((((IRAT216:0.017956,IR47684-05:0.006483):0.01418,((IR63372-08:0.008257,IR65907-18:0.049347):0.060968,IR65907-20:0.025334):0.004085):0.028888,COLOMBIA1:0.106747):0.009488,WAB56-50:0.048646):0.019308,IDSA77:0.026889):0.022776,WAB56-125:0.05797):0.025793):0.017149,IRAT362:0.030612):0.021338):0.005273):0.007474,((IR65261-19:0.088569,IR63380-16:0.060828):0.017377,ORYZICASAB:0.059793):0.020771):0.010205,((((IRAT2:0.006656,(62667:0.002564,(IRAT177:0.003065,IRAT13:0.006564):0.001422):0.001435):0.014034,IRAT109:0.079089):0.006041,IRAT170:0.013368):0.020262,63-104:0.022825):0.010789):0.00344,(((((KUROKA:0.096901,IRAT144:0.032372):0.04063,CIRAD488:0.062971):0.026055,(IRAT212:0.041268,PRIMAVERA:0.059109):0.012806):0.027141,((CIRAD392:0.025487,IRAT380:0.024721):0.028822,CIRAD394:0.055046):0.03418):0.01106,CAIAPO:0.07222):0.009469):0.006119,((ARAGUAIA:0.084755,(IRAT335:0.077784,IRAT112:0.027346):0.006445):0.007072,IRAT257:0.036873):0.020075):0.002575):0.001457,((((EARLYMUTAN:0.015218,(IAC25:0.007986,(DOURADOAGU:0.001563,DOURADOPRE:0.001763):0.010062):0.002688):0.01125,(((IAC47:0.007321,(IAC165:5.0E-4,VARYLAVA90:0.00165):0.006263):0.003063,HD1-4:0.015932):0.006876,GUARANI:0.013831):0.005817):0.007843,IGUAPECATE:0.036421):0.002898,BICOBRANCO:0.031026):0.008082):0.007912,IRAT234:0.037316):0.005647,MANDRIRAVI:0.049833):0.002593,RT1031-69:0.04352):0.005079,((((((((GOGOLEMPUK:0.001198,GOGOLEMPAK:0.002128):0.030378,TREMBESE:0.013258):0.055246,(((JIMBRUKJOL:0.045219,KETANKONIR:0.035298):0.006267,KANIRANGA:0.042518):0.020121,(VARYMADINI:0.039903,BENGALYVAK:0.032305):0.012408):0.00474):0.001841,(((YANCAOUSSA:0.006364,PATEBLANCM:0.008832):8.58E-4,MOROBEREKA:0.004615):0.013114,VARYMALADY:0.026086):0.024153):0.015663,WAB706-3-4:0.050598):0.004174,(MAINTIMOLO:0.044761,(FOHISOMOTR:0.005656,VARYSOMOTR:0.006949):0.030574):0.009217):0.006248,IRAT364:0.047033):0.003654,((IRAT366:0.033773,CIRAD358:0.093382):0.015822,(((MANANELATR:0.040437,(ARROZCEBAD:0.02711,GRAZI:0.022678):7.63E-4):0.00987,KOMOJAMANI:0.049216):0.006713,((TSIPALA89:0.0,VARYLAVADE:0.037778):0.044182,MITSANGANA:0.082664):0.068968):9.71E-4):0.009442):0.002985):0.008281,(((((GUNDILKUNI:0.019719,(CICIHBETON:0.02162,BULUPANDAK:0.016924):0.008554):0.028704,PADIBOENAR:0.052396):0.002882,(REKETMAUN:0.05943,((POENOETHIT:0.042637,KETANLUMBU:0.035696):0.016617,MOLOK:0.055674):0.015506):0.001164):0.024179,PADIKASALL:0.093595):0.063014,RATHAL:0.090729):0.015609):0.001416,((GANIGI:0.040448,PULULAPA:0.03984):0.020258,GOGO:0.060904):0.005609):0.018877,CUIABANA:0.066182):0.020665,((((((((DAM:0.054359,((((VIETNAM3:0.030951,SENG:0.038876):0.007914,(NABESHI:0.010252,KARASUKARA:0.010553):0.03265):0.012575,VIETNAM1:0.049323):0.00311,(PEHPINUO:0.070737,(CHUAN3:0.020631,CHUAN4:0.024135):0.01445):0.01097):0.020849):0.002227,(((((JAOHAW:0.044517,KHAODAM:0.031174):0.017389,MAHAE:0.041633):0.006695,(KHAOKAPXAN:0.005767,HAWMOM:0.009429):0.031367):0.015885,CHAPHUMA:0.071266):0.005503,KU115:0.043819):0.007631):0.009768,NHTA10:0.061745):0.006241,INDANE:0.079646):0.007679,(((GEMJYAJYAN:0.012403,YANGKUMRED:0.014267):0.008479,DANGREY:0.024493):0.020552,DAWASANRED:0.030369):0.065249):0.00624,CHALOYOE:0.058075):0.012844,NHTA5:0.138764):0.005686,YUNLU7:0.079119):0.012627):0.043699,((((NPE826:0.019317,NPE253:0.017161):0.033863,((GIZA171:0.023894,NIPPONBARE:0.027998):0.013954,M202:0.053155):0.016691):0.020398,NEPHOAVANG:0.097913):0.011042,BABER:0.155657):0.024483):0.015245,(((JUMALI:0.07765,LAMBAYQUE1:0.170057):0.027742,(GOMPA2:0.049418,KAKANI2:0.052752):0.024526):0.081123,JUMULA2:0.075284):0.027607):0.14713500000000007);

diff -r 3e19d0dfcf3e -r 420b57c3c185 SNP_density/CalculateSlidingWindowsSNPdensitiesFromHapmap.pl
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/SNP_density/CalculateSlidingWindowsSNPdensitiesFromHapmap.pl Fri Jul 10 04:39:30 2015 -0400

[

@@ -0,0 +1,124 @@
+#!/usr/bin/perl
+
+use strict;
+use Switch;
+use Getopt::Long;
+use Bio::SeqIO;
+
+my $usage = qq~Usage:$0 <args> [<opts>]
+where <args> are:
+    -i, --input         <Hapmap input>
+    -o, --out           <output in tabular format>
+    -s, --step          <step (in bp)>
+~;
+$usage .= "\n";
+
+my ($input,$out,$step);
+
+GetOptions(
+ "input=s"    => \$input,
+ "out=s"      => \$out,
+ "step=s"     => \$step,
+);
+
+
+die $usage
+  if ( !$input || !$step || !$out );
+
+my $max_chr_num = 100;
+
+my %counts;
+my %counts_by_ind;
+open(my $HAPMAP,$input);
+my $headers= <$HAPMAP>;
+$headers=~s/\n//g;
+$headers=~s/\r//g;
+my @ind_names = split(/\t/,$headers);
+my @individual_names;
+for (my $i = 12; $i <= $#ind_names; $i++)
+{
+ push(@individual_names,$ind_names[$i]);
+}
+my %maximums;
+while(<$HAPMAP>)
+{
+ my $line = $_;
+ $line=~s/\n//g;
+ $line=~s/\r//g;
+ my @infos = split(/\t/,$line);
+ my $chrom = $infos[2];
+ my $position = $infos[3];
+ if ($position > $maximums{$chrom}){$maximums{$chrom}=$position;}
+ my $classe_position = int($position/$step);
+ $counts{$chrom}{$classe_position}++;
+
+ my $ref_allele = $infos[11];
+ for (my $i = 12; $i <= $#infos; $i++)
+ {
+ if (!$counts_by_ind{$chrom}{$classe_position}{$i}){$counts_by_ind{$chrom}{$classe_position}{$i} = 0;}
+ if ($infos[$i] ne $ref_allele)
+ {
+ $counts_by_ind{$chrom}{$classe_position}{$i}++;
+ }
+ }
+}
+close($HAPMAP);
+
+#######################################################
+# global
+#######################################################
+open(my $OUT,">$out");
+print $OUT "Chromosome Position SNPs\n";
+my $chr_num = 0;
+foreach my $chrom(sort keys(%counts))
+{
+ $chr_num++;
+ my $ref_counts = $counts{$chrom};
+ my %final_counts = %$ref_counts;
+ my $x = 0;
+ #foreach my $classe_position(sort {$a<=>$b} keys(%final_counts))
+ for (my $classe_position = 0; $classe_position <= $maximums{$chrom}/$step;$classe_position++)
+ {
+ my $nb = 0;
+ if ($counts{$chrom}{$classe_position})
+ {
+ $nb = $counts{$chrom}{$classe_position};
+ }
+ $x += $step;
+ print $OUT "$chrom $x $nb\n";
+ }
+ if ($chr_num >= $max_chr_num){last;}
+}
+close($OUT);
+
+#######################################################
+# For each individual
+#######################################################
+open(my $OUT2,">$out.by_sample");
+$chr_num = 0;
+print $OUT2 "Chromosome ".join("\t",@individual_names) . "\n";
+foreach my $chrom(sort keys(%counts_by_ind))
+{
+ $chr_num++;
+        my $ref_counts = $counts_by_ind{$chrom};
+        my %final_counts = %$ref_counts;
+ for (my $classe_position = 0; $classe_position <= $maximums{$chrom}/$step;$classe_position++)
+        {
+ print $OUT2 "$chrom";
+ my $num_ind = 12;
+ foreach my $indiv(@individual_names)
+ {
+ my $val = 0;
+
+ if ($counts_by_ind{$chrom}{$classe_position}{$num_ind})
+ {
+ $val = $counts_by_ind{$chrom}{$classe_position}{$num_ind};
+ }
+ print $OUT2 " $val";
+ $num_ind++;
+ }
+ print $OUT2 "\n";
+        }
+ if ($chr_num >= $max_chr_num){last;}
+}
+close($OUT2);

diff -r 3e19d0dfcf3e -r 420b57c3c185 SNP_density/calculateSlidingWindowsSNPdensitiesFromHapMap_wrapper.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/SNP_density/calculateSlidingWindowsSNPdensitiesFromHapMap_wrapper.xml Fri Jul 10 04:39:30 2015 -0400

[

@@ -0,0 +1,207 @@
+<tool id="sniplay_density" name="SNP density" version="1.2.0">
+
+    
+    <description> Calculate SNP densities along chromosome from HapMap</description>
+
+    
+    <requirements>
+        <requirement type="binary">perl</requirement>
+    </requirements>
+
+    
+    <version_command>
+
+    </version_command>
+
+    
+    <command interpreter="bash">
+ calculateSlidingWindowsSNPdensitiesFromHapmap.sh $filein $fileout $fileout_bysample $step
+    </command>
+
+    
+    <inputs>
+ <param name="filein" type="data" format="txt" optional="false" label="Hapmap input" />
+ <param name="step" type="integer" value="200000" label="Step" help="Step in bp"/>
+ <param name="fileout_label" type="text" value="densities" label="Output name" help="Output name for tabular files" />
+    </inputs>
+
+    
+    <outputs>
+ <data name="fileout" type="data" format="tabular" label="${fileout_label}" />
+ <data name="fileout_bysample" type="data" format="tabular" label="${fileout_label}.by_sample" />
+    </outputs>
+
+    
+    <stdio>
+        
+        <exit_code range="1:" level="fatal" />
+    </stdio>
+
+    
+    <tests>
+        
+
+        
+
+    </tests>
+
+    
+    <help>
+
+.. class:: infomark
+
+**Authors** Dereeper Alexis (alexis.dereeper@ird.fr), IRD, South Green platform
+
+ | **Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1).
+
+
+.. class:: infomark
+
+**Galaxy integration** Andres Gwendoline, Institut Français de Bioinformatique.
+
+.. class:: infomark
+
+**Support** For any questions about Galaxy integration, please send an e-mail to support.abims@sb-roscoff.fr
+
+---------------------------------------------------
+
+
+
+=============
+SNP densities
+=============
+
+-----------
+Description
+-----------
+
+  Calculate SNP densities along chromosome from HapMap
+
+
+-----------------
+Workflow position
+-----------------
+
+**Upstream tool**
+
+=============== ====================== ===========
+Name            output file(s)         format
+=============== ====================== ===========
+VCF to Hapmap   Hapmap file        hapmap
+=============== ====================== ===========
+
+
+----------
+Input file
+----------
+
+Hapmap file
+ File with SNPs
+
+
+----------
+Parameters
+----------
+
+Step
+        Step in bp for the window to calculate SNP density
+
+Output name
+        Output base name for the two ouput files
+
+
+------------
+Output files
+------------
+
+Output_name
+ Tabular file with SNP density in each postion
+
+Output_name.by_sample
+ Tabular file with SNP density for each sample
+
+
+---------------------------------------------------
+
+---------------
+Working example
+---------------
+
+Input files
+===========
+
+hapmap file
+-----------
+
+::
+
+ rs#       alleles chrom pos  strand          assembly# center                protLSID assayLSID panelLSID QCcode ref BA58 BA59 BD54
+ chr1:1774 [G/T]   chr1  1774 Cc01_g00010:47  exon      NON_SYNONYMOUS_CODING gCg/gAg  A/E       25.0%     4      GG  TT   TT   TT
+ chr1:1640 [G/A]   chr1  1640 Cc01_g00010:127 exon      NON_SYNONYMOUS_CODING Ccg/Tcg  P/S       37.5%     4      GG  GG   AA   GA
+ chr1:1629 [A/C]   chr1  1629 Cc01_g00010:138 exon      SYNONYMOUS_CODING     ctT/ctG  L/L       37.5%     4      AA  CC   CC   AC
+ chr1:1628 [C/G]   chr1  1628 Cc01_g00010:139 exon      NON_SYNONYMOUS_CODING Ggg/Cgg  G/R       12.5%     4      CC  CC   CC   CG
+ chr1:1619 [T/G]   chr1  1619 Cc01_g00010:148 exon      NON_SYNONYMOUS_CODING Aaa/Caa  K/Q       37.5%     4      TT  TT   GG   TG
+ chr1:1405 [C/T]   chr1  1405 Cc01_g00010:362 exon      NON_SYNONYMOUS_CODING cGg/cAg  R/Q       16.7%     3      CC  CC   NN   CT
+
+Parameters
+==========
+
+Step -> 200000
+
+Output name -> densities
+
+
+Output files
+============
+
+densities
+---------
+
+::
+
+ Chromosome Position SNPs
+ chr1       200000   355
+ chr1       400000   228
+ chr1       600000   63
+ chr1       800000   191
+
+
+densities.by_sample
+-------------------
+
+::
+
+ Chromosome BA58 BA59 BD54
+ chr1       220  197  225
+ chr1       130  119  133
+ chr1       43   43   40
+ chr1       139  167  141
+
+    </help>
+    <citations>
+        
+     <citation type="bibtex">@article{Dereeper03062015,
+author = {Dereeper, Alexis and Homa, Felix and Andres, Gwendoline and Sempere, Guilhem and Sarah, Gautier and Hueber, Yann and Dufayard, Jean-François and Ruiz, Manuel},
+title = {SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations},
+year = {2015},
+doi = {10.1093/nar/gkv351},
+abstract ={SNiPlay is a web-based tool for detection, management and analysis of genetic variants including both single nucleotide polymorphisms (SNPs) and InDels. Version 3 now extends functionalities in order to easily manage and exploit SNPs derived from next generation sequencing technologies, such as GBS (genotyping by sequencing), WGRS (whole gre-sequencing) and RNA-Seq technologies. Based on the standard VCF (variant call format) format, the application offers an intuitive interface for filtering and comparing polymorphisms using user-defined sets of individuals and then establishing a reliable genotyping data matrix for further analyses. Namely, in addition to the various scaled-up analyses allowed by the application (genomic annotation of SNP, diversity analysis, haplotype reconstruction and network, linkage disequilibrium), SNiPlay3 proposes new modules for GWAS (genome-wide association studies), population stratification, distance tree analysis and visualization of SNP density. Additionally, we developed a suite of Galaxy wrappers for each step of the SNiPlay3 process, so that the complete pipeline can also be deployed on a Galaxy instance using the Galaxy ToolShed procedure and then be computed as a Galaxy workflow. SNiPlay is accessible at http://sniplay.southgreen.fr.},
+URL = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.abstract},
+eprint = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.full.pdf+html},
+journal = {Nucleic Acids Research}
+}
+
+     </citation>
+
+    </citations>
+</tool>

diff -r 3e19d0dfcf3e -r 420b57c3c185 SNP_density/calculateSlidingWindowsSNPdensitiesFromHapmap.sh
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/SNP_density/calculateSlidingWindowsSNPdensitiesFromHapmap.sh Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,13 @@
+#!/bin/bash
+
+tool_path=$(dirname $0)
+hapmap=$1
+fileout=$2
+fileout_bysample=$3
+step=$4
+
+perl $tool_path/CalculateSlidingWindowsSNPdensitiesFromHapmap.pl -i $hapmap -o $fileout -s $step
+
+cp $fileout.by_sample $fileout_bysample
+rm $fileout.by_sample
+

diff -r 3e19d0dfcf3e -r 420b57c3c185 SNP_density/test-data/.svn/entries
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/SNP_density/test-data/.svn/entries Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,130 @@
+10
+
+dir
+39
+svn+ssh://svn.sb-roscoff.fr/svn/logiciel/galaxy/galaxy4sniplay/SNP_density/test-data
+svn+ssh://svn.sb-roscoff.fr/svn/logiciel/galaxy
+
+
+
+2014-12-05T15:19:39.834618Z
+39
+gandres
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+0f93037e-e277-4375-988d-e0ab8f9fda44
+
+hapmap
+file
+
+
+
+
+2014-10-10T14:09:09.000000Z
+65d1c4316f6d483a62c8bea0f5b9ef2a
+2014-12-05T15:19:39.834618Z
+39
+gandres
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+376118
+
+result_bysample.txt
+file
+
+
+
+
+2014-12-05T14:21:25.000000Z
+4c3d447481c9e55ef17337836c42fc38
+2014-12-05T15:19:39.834618Z
+39
+gandres
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+336
+
+result.txt
+file
+
+
+
+
+2014-12-05T14:21:32.000000Z
+436c5356d4acc99f8ed023bc681bb787
+2014-12-05T15:19:39.834618Z
+39
+gandres
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+357
+

diff -r 3e19d0dfcf3e -r 420b57c3c185 SNP_density/test-data/.svn/text-base/hapmap.svn-base
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/SNP_density/test-data/.svn/text-base/hapmap.svn-base Fri Jul 10 04:39:30 2015 -0400

[

b'@@ -0,0 +1,3584 @@\n+rs#\talleles\tchrom\tpos\tstrand\tassembly#\tcenter\tprotLSID\tassayLSID\tpanelLSID\tQCcode\tref\tBA58\tBA59\tBD54\n+chr1:1774\t[G/T]\tchr1\t1774\tCc01_g00010:47\texon\tNON_SYNONYMOUS_CODING\tgCg/gAg\tA/E\t25.0%\t4\tGG\tTT\tTT\tTT\n+chr1:1640\t[G/A]\tchr1\t1640\tCc01_g00010:127\texon\tNON_SYNONYMOUS_CODING\tCcg/Tcg\tP/S\t37.5%\t4\tGG\tGG\tAA\tGA\n+chr1:1629\t[A/C]\tchr1\t1629\tCc01_g00010:138\texon\tSYNONYMOUS_CODING\tctT/ctG\tL/L\t37.5%\t4\tAA\tCC\tCC\tAC\n+chr1:1628\t[C/G]\tchr1\t1628\tCc01_g00010:139\texon\tNON_SYNONYMOUS_CODING\tGgg/Cgg\tG/R\t12.5%\t4\tCC\tCC\tCC\tCG\n+chr1:1619\t[T/G]\tchr1\t1619\tCc01_g00010:148\texon\tNON_SYNONYMOUS_CODING\tAaa/Caa\tK/Q\t37.5%\t4\tTT\tTT\tGG\tTG\n+chr1:1405\t[C/T]\tchr1\t1405\tCc01_g00010:362\texon\tNON_SYNONYMOUS_CODING\tcGg/cAg\tR/Q\t16.7%\t3\tCC\tCC\tNN\tCT\n+chr1:1398\t[T/G]\tchr1\t1398\tCc01_g00010:369\texon\tSYNONYMOUS_CODING\tgcA/gcC\tA/A\t16.7%\t3\tTT\tTT\tNN\tTG\n+chr1:1394\t[G/C]\tchr1\t1394\tCc01_g00010:373\texon\tNON_SYNONYMOUS_CODING\tCgt/Ggt\tR/G\t16.7%\t3\tGG\tGG\tNN\tGC\n+chr1:1379\t[A/T]\tchr1\t1379\tCc01_g00010:388\texon\tNON_SYNONYMOUS_CODING\tTac/Aac\tY/N\t16.7%\t3\tAA\tAA\tNN\tAT\n+chr1:1352\t[T/C]\tchr1\t1352\tCc01_g00010:415\texon\tNON_SYNONYMOUS_CODING\tAct/Gct\tT/A\t33.3%\t3\tTT\tCC\tNN\tCC\n+chr1:1252\t[T/A]\tchr1\t1252\tCc01_g00010:515\texon\tNON_SYNONYMOUS_CODING\taAg/aTg\tK/M\t12.5%\t4\tTT\tTT\tTT\tTA\n+chr1:17176\t[T/G]\tchr1\t17176\tCc01_g00030:504\texon\tSYNONYMOUS_CODING\tggT/ggG\tG/G\t12.5%\t4\tTT\tTT\tTG\tTT\n+chr1:18041\t[A/G]\tchr1\t18041\tCc01_g00030:661\texon\tNON_SYNONYMOUS_CODING\tAtc/Gtc\tI/V\t37.5%\t4\tAA\tAA\tGG\tAG\n+chr1:18442\t[C/A]\tchr1\t18442\tCc01_g00030:929\texon\tNON_SYNONYMOUS_CODING\ttCc/tAc\tS/Y\t25.0%\t4\tCC\tCC\tCA\tCA\n+chr1:18478\t[T/C]\tchr1\t18478\tCc01_g00030:965\texon\tNON_SYNONYMOUS_CODING\tcTa/cCa\tL/P\t25.0%\t4\tTT\tTT\tTC\tTC\n+chr1:18554\t[T/G]\tchr1\t18554\tCc01_g00030:1041\texon\tSYNONYMOUS_CODING\ttcT/tcG\tS/S\t25.0%\t4\tTT\tTT\tTG\tTG\n+chr1:19062\t[T/A]\tchr1\t19062\tCc01_g00030:1151\texon\tNON_SYNONYMOUS_CODING\ttTc/tAc\tF/Y\t33.3%\t3\tTT\tNN\tTT\tAA\n+chr1:19078\t[A/G]\tchr1\t19078\tCc01_g00030:1167\texon\tSYNONYMOUS_CODING\taaA/aaG\tK/K\t12.5%\t4\tAA\tAA\tAG\tAA\n+chr1:19138\t[T/C]\tchr1\t19138\tCc01_g00030:1227\texon\tSYNONYMOUS_CODING\ttaT/taC\tY/Y\t25.0%\t4\tTT\tTT\tCT\tTC\n+chr1:22125\t[C/T]\tchr1\t22125\tCc01_g00030:1773\texon\tSYNONYMOUS_CODING\tccC/ccT\tP/P\t25.0%\t4\tCC\tCC\tCT\tCT\n+chr1:22212\t[T/C]\tchr1\t22212\tCc01_g00030:1860\texon\tSYNONYMOUS_CODING\tagT/agC\tS/S\t12.5%\t4\tTT\tTT\tTC\tTT\n+chr1:22342\t[T/A]\tchr1\t22342\tCc01_g00030:1990\texon\tNON_SYNONYMOUS_CODING\tTca/Aca\tS/T\t25.0%\t4\tTT\tTT\tTA\tTA\n+chr1:22404\t[C/T]\tchr1\t22404\tCc01_g00030:2052\texon\tSYNONYMOUS_CODING\ttgC/tgT\tC/C\t25.0%\t4\tCC\tCC\tCT\tCT\n+chr1:22478\t[C/G]\tchr1\t22478\tCc01_g00030:2126\texon\tNON_SYNONYMOUS_CODING\taCt/aGt\tT/S\t25.0%\t4\tCC\tGG\tCC\tCC\n+chr1:22613\t[C/T]\tchr1\t22613\tCc01_g00030:2261\texon\tNON_SYNONYMOUS_CODING\tgCg/gTg\tA/V\t25.0%\t4\tCC\tTT\tCC\tCC\n+chr1:22657\t[C/T]\tchr1\t22657\tCc01_g00030:2305\texon\tSYNONYMOUS_CODING\tCta/Tta\tL/L\t12.5%\t4\tCC\tCC\tCT\tCC\n+chr1:22758\t[A/G]\tchr1\t22758\tCc01_g00030:2406\texon\tSYNONYMOUS_CODING\tgaA/gaG\tE/E\t25.0%\t4\tAA\tAA\tAG\tAG\n+chr1:22903\t[C/A]\tchr1\t22903\tCc01_g00030:2551\texon\tNON_SYNONYMOUS_CODING\tCtt/Att\tL/I\t25.0%\t4\tCC\tCC\tCA\tCA\n+chr1:22965\t[G/T]\tchr1\t22965\tCc01_g00030:2613\texon\tNON_SYNONYMOUS_CODING\tatG/atT\tM/I\t12.5%\t4\tGG\tGG\tTG\tGG\n+chr1:23037\t[A/G]\tchr1\t23037\tCc01_g00030:2685\texon\tSYNONYMOUS_CODING\taaA/aaG\tK/K\t25.0%\t4\tAA\tAA\tAG\tAG\n+chr1:24151\t[A/G]\tchr1\t24151\tCc01_g00030:3063\texon\tSYNONYMOUS_CODING\tgcA/gcG\tA/A\t25.0%\t4\tAA\tAA\tAG\tAG\n+chr1:24436\t[T/C]\tchr1\t24436\tCc01_g00030:3240\texon\tSYNONYMOUS_CODING\tagT/agC\tS/S\t25.0%\t4\tTT\tTT\tTC\tTC\n+chr1:25763\t[G/C]\tchr1\t25763\tCc01_g00030:3610\texon\tNON_SYNONYMOUS_CODING\tGta/Cta\tV/L\t25.0%\t4\tGG\tGG\tGC\tGC\n+chr1:26910\t[T/G]\tchr1\t26910\tCc01_g00030:3889\texon\tNON_SYNONYMOUS_CODING\tTct/Gct\tS/A\t25.0%\t4\tTT\tTT\tTG\tTG\n+chr1:26996\t[C/T]\tchr1\t26996\tCc01_g00030:3975\texon\tSYNONYMOUS_CODING\tgaC/gaT\tD/D\t25.0%\t4\tCC\tCC\tCT\tCT\n+chr1:27095\t[A/T]\tchr1\t27095\tCc01_g00030:4074\texon\tSYNONYMOUS_CODING\tccA/ccT\tP/P\t37.5%\t4\tAA\tAA\tTT\tAT\n+chr1:27755\t[C/T]\tchr1\t27755\tCc01_g00030:4734\texon\tSYNONYMOUS_CODING\tagC/agT\tS/S\t25.0%\t4\tCC\tCC\tCT\tCT\n+chr1:30493\t[C/T]\tchr1\t30493\tCc01_g00030:4992\texon\tSYNONYMOUS_CODING\tgaC/gaT\tD/D\t12.5%\t4\tCC\tCC\tCT\tC'..b'n\tSYNONYMOUS_CODING\tacG/acA\tT/T\t25.0%\t4\tCC\tTT\tCC\tCC\n+chr1:3940278\t[G/A]\tchr1\t3940278\tCc01_g02140:861\texon\tSYNONYMOUS_CODING\taaC/aaT\tN/N\t25.0%\t4\tGG\tAA\tGG\tGG\n+chr1:3940190\t[T/C]\tchr1\t3940190\tCc01_g02140:949\texon\tNON_SYNONYMOUS_CODING\tAtc/Gtc\tI/V\t12.5%\t4\tTT\tTT\tTC\tTT\n+chr1:3940062\t[G/A]\tchr1\t3940062\tCc01_g02140:1077\texon\tSYNONYMOUS_CODING\taaC/aaT\tN/N\t37.5%\t4\tGG\tAA\tGA\tAA\n+chr1:3939962\t[C/A]\tchr1\t3939962\tCc01_g02140:1177\texon\tNON_SYNONYMOUS_CODING\tGcc/Tcc\tA/S\t12.5%\t4\tCC\tCA\tCC\tCC\n+chr1:3939959\t[G/T]\tchr1\t3939959\tCc01_g02140:1180\texon\tNON_SYNONYMOUS_CODING\tCtt/Att\tL/I\t25.0%\t4\tGG\tTT\tGG\tGG\n+chr1:3939916\t[C/T]\tchr1\t3939916\tCc01_g02140:1223\texon\tNON_SYNONYMOUS_CODING\taGt/aAt\tS/N\t25.0%\t4\tCC\tTT\tCC\tCC\n+chr1:3938977\t[G/C]\tchr1\t3938977\tCc01_g02140:1335\texon\tSYNONYMOUS_CODING\ttcC/tcG\tS/S\t12.5%\t4\tGG\tGC\tGG\tGG\n+chr1:3938798\t[T/G]\tchr1\t3938798\tCc01_g02140:1369\texon\tNON_SYNONYMOUS_CODING\tAgt/Cgt\tS/R\t37.5%\t4\tTT\tGG\tTG\tTT\n+chr1:3938797\t[C/G]\tchr1\t3938797\tCc01_g02140:1370\texon\tNON_SYNONYMOUS_CODING\taGt/aCt\tS/T\t12.5%\t4\tCC\tCC\tCC\tCG\n+chr1:3938792\t[G/A]\tchr1\t3938792\tCc01_g02140:1375\texon\tSYNONYMOUS_CODING\tCta/Tta\tL/L\t12.5%\t4\tGG\tGG\tGG\tAG\n+chr1:3938784\t[C/T]\tchr1\t3938784\tCc01_g02140:1383\texon\tSYNONYMOUS_CODING\tccG/ccA\tP/P\t25.0%\t4\tCC\tTC\tCT\tCC\n+chr1:3938738\t[C/T]\tchr1\t3938738\tCc01_g02140:1429\texon\tNON_SYNONYMOUS_CODING\tGtt/Att\tV/I\t12.5%\t4\tCC\tCC\tCT\tCC\n+chr1:3938734\t[T/C]\tchr1\t3938734\tCc01_g02140:1433\texon\tNON_SYNONYMOUS_CODING\tcAa/cGa\tQ/R\t25.0%\t4\tTT\tTT\tTC\tCT\n+chr1:3938731\t[A/G]\tchr1\t3938731\tCc01_g02140:1436\texon\tNON_SYNONYMOUS_CODING\tgTg/gCg\tV/A\t12.5%\t4\tAA\tAA\tAG\tAA\n+chr1:3938674\t[C/T]\tchr1\t3938674\tCc01_g02140:1493\texon\tNON_SYNONYMOUS_CODING\taGt/aAt\tS/N\t12.5%\t4\tCC\tCC\tCT\tCC\n+chr1:3950327\t[A/C]\tchr1\t3950327\tCc01_g02150:300\texon\tNON_SYNONYMOUS_CODING\tcaT/caG\tH/Q\t37.5%\t4\tAA\tCC\tAC\tAA\n+chr1:3949508\t[G/T]\tchr1\t3949508\tCc01_g02150:438\texon\tSYNONYMOUS_CODING\ttcC/tcA\tS/S\t12.5%\t4\tGG\tGT\tGG\tGG\n+chr1:3949500\t[T/C]\tchr1\t3949500\tCc01_g02150:446\texon\tNON_SYNONYMOUS_CODING\ttAt/tGt\tY/C\t12.5%\t4\tTT\tTT\tTC\tTT\n+chr1:3949478\t[G/A]\tchr1\t3949478\tCc01_g02150:468\texon\tSYNONYMOUS_CODING\tcgC/cgT\tR/R\t12.5%\t4\tGG\tGG\tGA\tGG\n+chr1:3949470\t[C/T]\tchr1\t3949470\tCc01_g02150:476\texon\tNON_SYNONYMOUS_CODING\taGg/aAg\tR/K\t25.0%\t4\tCC\tTT\tCC\tCC\n+chr1:3949465\t[C/G]\tchr1\t3949465\tCc01_g02150:481\texon\tNON_SYNONYMOUS_CODING\tGgt/Cgt\tG/R\t37.5%\t4\tCC\tGG\tCG\tCC\n+chr1:3949086\t[C/T]\tchr1\t3949086\tCc01_g02150:541\texon\tNON_SYNONYMOUS_CODING\tGtc/Atc\tV/I\t12.5%\t4\tCC\tCC\tCT\tCC\n+chr1:3967535\t[C/T]\tchr1\t3967535\tCc01_g02160:57\texon\tSYNONYMOUS_CODING\tcgG/cgA\tR/R\t12.5%\t4\tCC\tCT\tCC\tCC\n+chr1:3967530\t[A/T]\tchr1\t3967530\tCc01_g02160:62\texon\tNON_SYNONYMOUS_CODING\tcTg/cAg\tL/Q\t12.5%\t4\tAA\tAA\tAA\tAT\n+chr1:3967524\t[G/A]\tchr1\t3967524\tCc01_g02160:68\texon\tNON_SYNONYMOUS_CODING\tcCa/cTa\tP/L\t37.5%\t4\tGG\tAG\tGA\tAG\n+chr1:3967512\t[A/G]\tchr1\t3967512\tCc01_g02160:80\texon\tNON_SYNONYMOUS_CODING\taTa/aCa\tI/T\t12.5%\t4\tAA\tAA\tAG\tAA\n+chr1:3967435\t[A/G]\tchr1\t3967435\tCc01_g02160:157\texon\tNON_SYNONYMOUS_CODING\tTcc/Ccc\tS/P\t25.0%\t4\tAA\tAG\tAA\tAG\n+chr1:3967421\t[G/A]\tchr1\t3967421\tCc01_g02160:171\texon\tSYNONYMOUS_CODING\tacC/acT\tT/T\t12.5%\t4\tGG\tAG\tGG\tGG\n+chr1:3967412\t[A/C]\tchr1\t3967412\tCc01_g02160:180\texon\tSTOP_GAINED\ttaT/taG\tY/0\t37.5%\t4\tAA\tAC\tAC\tAC\n+chr1:3967382\t[A/G]\tchr1\t3967382\tCc01_g02160:210\texon\tSYNONYMOUS_CODING\tccT/ccC\tP/P\t25.0%\t4\tAA\tGA\tGA\tAA\n+chr1:3967354\t[G/T]\tchr1\t3967354\tCc01_g02160:238\texon\tNON_SYNONYMOUS_CODING\tCaa/Aaa\tQ/K\t12.5%\t4\tGG\tGG\tGG\tGT\n+chr1:3967352\t[T/C]\tchr1\t3967352\tCc01_g02160:240\texon\tSYNONYMOUS_CODING\tcaA/caG\tQ/Q\t37.5%\t4\tTT\tCC\tCT\tCC\n+chr1:3967310\t[G/C]\tchr1\t3967310\tCc01_g02160:282\texon\tNON_SYNONYMOUS_CODING\tatC/atG\tI/M\t37.5%\t4\tGG\tGC\tGC\tGC\n+chr1:3967300\t[C/T]\tchr1\t3967300\tCc01_g02160:292\texon\tNON_SYNONYMOUS_CODING\tGat/Aat\tD/N\t12.5%\t4\tCC\tCC\tCC\tTC\n+chr1:3967295\t[G/A]\tchr1\t3967295\tCc01_g02160:297\texon\tSYNONYMOUS_CODING\tatC/atT\tI/I\t12.5%\t4\tGG\tGG\tGA\tGG\n+chr1:3966909\t[T/A]\tchr1\t3966909\tCc01_g02160:683\texon\tNON_SYNONYMOUS_CODING\ttAt/tTt\tY/F\t12.5%\t4\tTT\tTA\tTT\tTT\n+chr1:3966784\t[G/A]\tchr1\t3966784\tCc01_g02160:808\texon\tNON_SYNONYMOUS_CODING\tCtt/Ttt\tL/F\t16.7%\t3\tGG\tNN\tGA\tGG\n'

diff -r 3e19d0dfcf3e -r 420b57c3c185 SNP_density/test-data/.svn/text-base/result.txt.svn-base
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/SNP_density/test-data/.svn/text-base/result.txt.svn-base Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,21 @@
+Chromosome Position SNPs
+chr1 200000 355
+chr1 400000 228
+chr1 600000 63
+chr1 800000 191
+chr1 1000000 88
+chr1 1200000 90
+chr1 1400000 190
+chr1 1600000 267
+chr1 1800000 226
+chr1 2000000 163
+chr1 2200000 357
+chr1 2400000 132
+chr1 2600000 158
+chr1 2800000 104
+chr1 3000000 146
+chr1 3200000 331
+chr1 3400000 181
+chr1 3600000 36
+chr1 3800000 167
+chr1 4000000 110

diff -r 3e19d0dfcf3e -r 420b57c3c185 SNP_density/test-data/.svn/text-base/result_bysample.txt.svn-base
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/SNP_density/test-data/.svn/text-base/result_bysample.txt.svn-base Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,21 @@
+Chromosome BA58 BA59 BD54
+chr1 220 197 225
+chr1 130 119 133
+chr1 43 43 40
+chr1 139 167 141
+chr1 62 72 78
+chr1 35 76 38
+chr1 98 123 82
+chr1 133 205 135
+chr1 94 141 151
+chr1 112 116 117
+chr1 228 238 204
+chr1 86 95 96
+chr1 60 106 82
+chr1 60 74 64
+chr1 106 112 115
+chr1 199 220 228
+chr1 151 94 64
+chr1 18 32 27
+chr1 87 90 100
+chr1 54 75 47

diff -r 3e19d0dfcf3e -r 420b57c3c185 SNP_density/test-data/hapmap
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/SNP_density/test-data/hapmap Fri Jul 10 04:39:30 2015 -0400

[

diff -r 3e19d0dfcf3e -r 420b57c3c185 SNP_density/test-data/result.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/SNP_density/test-data/result.txt Fri Jul 10 04:39:30 2015 -0400

diff -r 3e19d0dfcf3e -r 420b57c3c185 SNP_density/test-data/result_bysample.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/SNP_density/test-data/result_bysample.txt Fri Jul 10 04:39:30 2015 -0400

diff -r 3e19d0dfcf3e -r 420b57c3c185 VCF2Hapmap/VCF2FastaAndHapmap.pl
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/VCF2Hapmap/VCF2FastaAndHapmap.pl Fri Jul 10 04:39:30 2015 -0400

[

b'@@ -0,0 +1,525 @@\n+\n+#!/usr/bin/perl\n+\n+use strict;\n+use Getopt::Long;\n+\n+my $usage = qq~Usage:$0 <args> [<opts>]\n+\n+where <args> are:\n+\n+ -v, --vcf <VCF input>\n+ -o, --out <Output basename>\n+ \n+<opts> are:\n+\n+ -r, --reference <Reference fasta file>\n+ -g, --gff <GFF input file to create alignments of genes>\n+~;\n+$usage .= "\\n";\n+\n+my ($input,$out,$reference,$gff);\n+\n+\n+\n+GetOptions(\n+\t"vcf=s" => \\$input,\n+\t"out=s" => \\$out,\n+\t"reference=s" => \\$reference,\n+\t"gff=s" => \\$gff\n+);\n+\n+\n+die $usage\n+ if ( !$input || !$out);\n+ \n+if ($gff && !$reference)\n+{\n+\tdie "You must provide a Fasta reference file when providing GFF annotation\\n";\n+}\n+\n+ \n+my %ref_sequences; \n+if ($reference)\n+{\n+\tmy $id;\n+\tmy $sequence = "";\n+\topen(my $R,$reference) or die "cannot open file: $reference";\n+\twhile(<$R>)\n+\t{\n+\t\tmy $line =$_;\n+\t\t$line =~s/\\n//g;\n+\t\t$line =~s/\\r//g;\n+\t\tif ($line =~ />([^\\s]+)/){\n+\t\t\t$ref_sequences{$id} = $sequence;\n+\t\t\t$id=$1;$sequence="";\n+\t\t}\n+\t\telse\n+\t\t{\n+\t\t\t$sequence .= $line;\n+\t\t}\n+\t}\n+\tclose($R);\n+\t$ref_sequences{$id} = $sequence;\n+}\n+\n+\n+my %chr_of_gene;\n+my %ann;\n+if ($gff)\n+{\n+\topen(my $G,$gff) or die "cannot open file: $gff";\n+\twhile(<$G>)\n+\t{\n+\t\tmy $line =$_;\n+\t\t$line =~s/\\n//g;\n+\t\t$line =~s/\\r//g;\n+\t\tmy @i = split(/\\t/,$line);\n+\t\tmy $chr = $i[0];\n+\t\tmy $feature = $i[2];\n+\t\tmy $strand = $i[6];\n+\t\tmy $start = $i[3];\n+\t\tmy $stop = $i[4];\n+\t\tmy $inf = $i[8];\n+\t\tif ($feature eq \'gene\')\n+\t\t{\n+\t\t\t if ($inf =~/Name=([\\w\\-\\.]+)[;\\s]*/){$inf = $1;}\n+\t\t\t$ann{$inf}{"start"}=$start;\n+\t\t\t$ann{$inf}{"stop"}=$stop;\n+\t\t\t$ann{$inf}{"strand"}=$strand;\n+\t\t\t$chr_of_gene{$inf} = $chr;\n+\t\t}\n+\t}\n+\tclose($G);\n+}\n+\n+\n+\n+my %IUPAC =\n+(\n+ \'[A/G]\'=> "R",\n+ \'[G/A]\'=> "R",\n+ \'[C/T]\'=> "Y",\n+ \'[T/C]\'=> "Y",\n+ \'[T/G]\'=> "K",\n+ \'[G/T]\'=> "K",\n+ \'[C/G]\'=> "S",\n+ \'[G/C]\'=> "S",\n+ \'[A/T]\'=> "W",\n+ \'[T/A]\'=> "W",\n+ \'[A/C]\'=> "M",\n+ \'[C/A]\'=> "M",\n+ \'[C/A/T]\'=> "H",\n+ \'[A/T/C]\'=> "H",\n+ \'[A/C/T]\'=> "H",\n+ \'[C/T/A]\'=> "H",\n+ \'[T/C/A]\'=> "H",\n+ \'[T/A/C]\'=> "H",\n+ \'[C/A/G]\'=> "V",\n+ \'[A/G/C]\'=> "V",\n+ \'[A/C/G]\'=> "V",\n+ \'[C/G/A]\'=> "V",\n+ \'[G/C/A]\'=> "V",\n+ \'[G/A/C]\'=> "V",\n+ \'[C/T/G]\'=> "B",\n+ \'[T/G/C]\'=> "B",\n+ \'[T/C/G]\'=> "B",\n+ \'[C/G/T]\'=> "B",\n+ \'[G/C/T]\'=> "B",\n+ \'[G/T/C]\'=> "B",\n+ \'[T/A/G]\'=> "D",\n+ \'[A/G/T]\'=> "D",\n+ \'[A/T/G]\'=> "D",\n+ \'[T/G/A]\'=> "D",\n+ \'[G/T/A]\'=> "D",\n+ \'[G/A/T]\'=> "D",\n+);\n+\n+my %snps_of_gene;\n+my %snps_of_gene2;\n+my %indiv_order;\n+my $indiv_list;\n+my %genotyping_infos;\n+my $num_line = 0;\n+my $genename_rank_in_snpeff = 4;\n+\n+my $find_annotations = `grep -c \'EFF=\' $input`;\n+\n+open(my $HAPMAP,">$out.hapmap");\n+print $HAPMAP "rs#\talleles\tchrom\tpos\tgene\tfeature\teffect\tcodon_change\tamino_acid_change\tMAF\tmissing_data";\n+open(my $VCF,$input);\n+while(<$VCF>)\n+{\n+\tmy $line = $_;\n+\tchomp($line);\n+\tmy @infos = split(/\\t/,$line);\n+\t\n+\tif (/^##INFO=\\<ID=EFF/ && /Amino_Acid_length \\| Gene_Name \\| Transcript_BioType \\| Gene_Coding/)\n+\t{\n+\t\t$genename_rank_in_snpeff = 8;\n+\t}\n+\n+\tif (scalar @infos > 9)\n+\t{\n+\t\tif (/#CHROM/)\n+\t\t{\n+\t\t\tfor (my $j=9;$j<=$#infos;$j++)\n+\t\t\t{\n+\t\t\t\tmy $individu = $infos[$j];\n+\t\t\t\t$indiv_list .= "\t$individu";\n+\t\t\t\t$indiv_order{$j} = $individu;\n+\t\t\t}\n+\t\t\tprint $HAPMAP "$indiv_list\\n";\n+\t\t}\n+\t\telsif (!/^#/)\n+\t\t{\n+\t\t\t$num_line++;\n+\n+\t\t\tmy $chromosome = $infos[0];\n+\t\t\tmy $chromosome_position = $infos[1];\n+\t\t\tmy $ref_allele = $infos[3];\n+\t\t\tmy $alt_allele = $infos[4];\n+ \t\n+\t\t\tif ($ref_allele =~/\\w\\w+/)\n+\t\t\t{\n+\t\t\t\t$ref_allele = "A";\n+\t\t\t\t$alt_allele = "T";\n+\t\t\t}\n+\t\t\telsif ($alt_allele =~/\\w\\w+/)\n+\t\t\t{\n+\t\t\t\t$ref_allele = "T";\n+\t\t\t\t$alt_allele = "A";\n+\t\t\t}\n+\t\t\t\n+\t\t\tmy $info = $infos[7];\n+\t\t\tmy $is_in_exon = "#";\n+\t\t\tmy $is_synonyme = "#";\n+\t\t\tmy $gene;\n+\t\t\tif ($find_annotations > 1)\n+\t\t\t{\n+'..b'\n+\t\t\tmy $stop = $ann{$seq}{"stop"};\n+\t\t\tmy $strand = $ann{$seq}{"strand"};\n+\t\t\tmy $genelength = $stop - $start+1;\n+\t\t\tmy $chr = $chr_of_gene{$seq};\n+\t\tmy $refseq = substr($ref_sequences{$chr},$start-1,$genelength);\n+\t\tif ($strand eq \'-\')\n+\t\t{\n+\t\t\t$refseq =~ tr /atcgATCG/tagcTAGC/; $refseq = reverse($refseq);\n+\t\t}\t\n+\t\t#print "$seq $chr $start $stop $refseq \\n";\n+\t\tmy $previous = 0;\n+\t\tforeach my $pos(sort {$a<=>$b} keys(%hashreal))\n+\t\t{\n+\t\t\tmy $length = $pos - $previous - 1;\n+\t\t\t$flanking5{$pos} = substr($refseq,$previous,$length);\n+\t\t\t$previous = $pos;\n+\t\t}\n+\t\tmy $length = length($refseq) - $previous;\n+\t\tmy $flanking3 = substr($refseq,$previous,$length);\n+\t\tforeach my $ind(@individuals_list)\n+\t\t{\n+\t\t\tmy $nb_missing_data_for_this_individual = 0;\n+\t\t\tif ($ind)\n+\t\t\t{\n+ my $alignment_for_ind = "";\n+ my $seq_without_underscore = $seq;\n+ $seq_without_underscore =~s/_//g;\n+ $alignment_for_ind .= ">$seq_without_underscore" . "_$ind" . "_1\\n";\n+ foreach my $pos(sort {$a<=>$b} keys(%hashreal))\n+ {\n+ $alignment_for_ind .= $flanking5{$pos};\n+ my $geno = $snps_of_gene{$seq}{$pos}{$ind};\n+ $geno =~s/N/?/g;\n+ if ($geno =~/\\?/){$nb_missing_data_for_this_individual++;}\n+ my @alleles = split("",$geno);\n+ $alignment_for_ind .= $alleles[0];\n+ if ($alleles[0] eq $alleles[1])\n+ {\n+ $alignments_ind{$ind} .= $alleles[1];\n+ }\n+ else\n+ {\n+ my $snp_type = "[" . $alleles[0] . "/" . $alleles[1] . "]";\n+ $alignments_ind{$ind} .= $IUPAC{$snp_type};\n+ }\n+ }\n+ $alignment_for_ind .= $flanking3;\n+\t\t\t\t\t\t$alignment_for_ind .= "\\n";\n+\t\t\t\n+\t\t\t\n+ $alignment_for_ind .= ">$seq_without_underscore" . "_$ind" . "_2\\n";\n+ foreach my $pos(sort {$a<=>$b} keys(%hashreal))\n+ {\n+ $alignment_for_ind .= $flanking5{$pos};\n+ my $geno = $snps_of_gene{$seq}{$pos}{$ind};\n+ $geno =~s/N/?/g;\n+ my @alleles = split("",$geno);\n+ $alignment_for_ind .= $alleles[1];\n+ }\n+ $alignment_for_ind .= $flanking3;\n+\t\t\t\t\t\t$alignment_for_ind .= "\\n";\n+ if (keys(%hashreal) != $nb_missing_data_for_this_individual)\n+ {\n+ print $ALIGN_EGGLIB $alignment_for_ind;\n+ }\n+\t\t\t}\n+\t\t}\n+\t}\n+}\n+close($ALIGN_EGGLIB);\n+\n+\n+\n'

diff -r 3e19d0dfcf3e -r 420b57c3c185 VCF2Hapmap/vcf2FastaAndHapmap.sh
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/VCF2Hapmap/vcf2FastaAndHapmap.sh Fri Jul 10 04:39:30 2015 -0400

[

@@ -0,0 +1,45 @@
+#!/bin/bash
+
+tool_path=$(dirname $0)
+
+
+
+filein=$1
+fileout_label=$2
+fileout=$3
+option=$4
+
+option_text=''
+
+
+if [ "$option" != "none" ]
+then fileout_seq=$5
+ fileout_fa1=$6
+ filefasta=$7
+ if [ "$option" == "fasta_gff" ]
+ then filegff=$8
+ fi
+fi
+
+if [ "$option" == "fasta" ]
+then option_text="--reference $filefasta"
+fi
+
+if [ "$option" == "fasta_gff" ]
+then option_text="--reference $filefasta --gff $filegff"
+fi
+
+
+perl $tool_path/VCF2FastaAndHapmap.pl --vcf $filein --out $fileout_label $option_text
+
+
+cp  $fileout_label.hapmap $fileout ; rm $fileout_label.hapmap
+
+if [ "$option" == "fasta_gff" ]
+then cp  $fileout_label.flanking.txt $fileout_seq ; rm $fileout_label.flanking.txt ; cp  $fileout_label.gene_alignment.fas $fileout_fa1 ; rm $fileout_label.gene_alignment.fas ;
+fi
+
+if [ "$option" == "fasta" ]
+then cp  $fileout_label.flanking.txt $fileout_seq ; rm $fileout_label.flanking.txt ;
+fi
+

diff -r 3e19d0dfcf3e -r 420b57c3c185 VCF2Hapmap/vcf2FastaAndHapmap.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/VCF2Hapmap/vcf2FastaAndHapmap.xml Fri Jul 10 04:39:30 2015 -0400

[

b'@@ -0,0 +1,251 @@\n+<tool id="sniplay_vcf2fastaandhapmap" name="VCF to Hapmap" version="1.1.0">\n+ \n+ \n+ <description> Convert VCF to Hapmap </description>\n+ \n+ \n+ <requirements>\n+ <requirement type="binary">perl</requirement>\n+ </requirements>\n+ \n+ \n+ <version_command>\n+\n+ </version_command>\n+ \n+ \n+ <command interpreter="bash">\n+\tvcf2FastaAndHapmap.sh $filein $fileout_label $fileout $optional.file_opt \n+\t#if str( $optional.file_opt ) != "none":\n+\t\t$fileout_seq $fileout_fa1 $filefasta \n+\t\t#if str( $optional.file_opt ) == "fasta_gff":\n+\t\t$filegff\n+\t\t#end if\n+\t#end if\n+ </command>\n+ \n+ \n+ <inputs>\n+\t<param name="filein" type="data" format="vcf" optional="false" label="VCF input" />\n+\t<param name="fileout_label" type="text" value="input" optional="false" label="Output file basename"/>\n+\t<conditional name="optional" >\n+\t <param name="file_opt" type="select" label="Optional files" >\n+\t \t<option value="none" selected="true">No</option>\n+\t \t<option value="fasta">Fasta</option>\n+ \t<option value="fasta_gff">Fasta and GFF</option>\n+ </param>\n+\t <when value="none" />\n+ <when value="fasta">\n+\t\t<param name="filefasta" type="data" format="fasta" optional="false" label="Fasta file input" />\n+ </when>\n+\t <when value="fasta_gff">\n+\t\t<param name="filefasta" type="data" format="fasta" optional="false" label="Fasta file input" />\n+\t\t<param name="filegff" type="data" format="gff" optional="false" label="GFF file input" help="VCF file must be annotated" />\n+ </when>\n+ </conditional>\n+ </inputs>\n+ \n+ \n+ <outputs>\n+\t<data name="fileout" format="txt" label="${fileout_label}.hapmap" />\n+\t<data name="fileout_seq" format="txt" label="${fileout_label}.flanking.txt">\n+\t\t<filter>(optional[\'file_opt\'] != \'none\')</filter>\n+\t</data>\n+\t<data name="fileout_fa1" format="fasta" label="${fileout_label}.gene_alignment.fas">\n+\t\t<filter>(optional[\'file_opt\'] == \'fasta_gff\')</filter>\n+\t</data>\n+ </outputs>\n+ \n+ \n+ <stdio>\n+ \n+ <exit_code range="1:" level="fatal" />\n+ </stdio>\n+ \n+ \n+ <tests>\n+ \n+ <test>\n+ <param name="filein" value="sample.vcf" />\n+ <param name="otpional.file_opt" value="none" />\n+ <output name="fileout" file="result1.hapmap" />\n+ </test>\n+\t<test>\n+ <param name="filein" value="sample.vcf" />\n+\t <param name="otpional.file_opt" value="fasta" />\n+ <param name="filefasta" value="reference.fa" />\n+ <output name="fileout" file="result2.hapmap" />\n+ <output name="fileout_seq" file="result2.flanking.txt" />\n+ <output name="fileout_fa1" file="result2.gene_alignment.fas" />\n+ </test>\n+ </tests>\n+ \n+ \n+ <help>\n+\n+\n+.. class:: infomark\n+\n+**Authors** Dereeper Alexis (alexis.dereeper@ird.fr), IRD, South Green platform\n+\n+ | **Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1).\n+\n+.. class:: infomark\n+\n+**Galaxy integration** Andres Gwendoline, Institut Fran\xc3\xa7ais de Bioinformatique. \n+\n+.. class:: infomark\n+\n+**Support** For any questions, please send an e-mail '..b's fasta file and GFF file.\n+\n+------------\n+Output files\n+------------\n+\n+Hapmap file \n+\tHapmap converted file\n+\n+Additional files \n+\tIf you add fasta and/or GFF file as reference, you obtain 3 more files : One with flanking sequence and a fasta file\n+\n+---------------------------------------------------\n+\n+---------------\n+Working example\n+---------------\n+\n+Input files\n+===========\n+\n+VCF file\n+---------\n+\n+::\n+\n+\t#fileformat=VCFv4.1\n+\t#FILTER=<ID=LowQual,Description="Low quality">\n+\t#FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">\n+\t[...]\n+\tCHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO\tFORMAT\tCATB1\n+\tchr1\t2209\t.\tG\tT\t213.84\t.\tAC=2;AF=1.00;AN=2;DP=7;Dels=0.00;FS=0.000;HaplotypeScore=0.0000;MLEAC=2;MLEAF=1.00;MQ=41.50;MQ0=0;QD=30.55;EFF=DOWNSTREAM(MODIFIER||||Cc01g00020|mRNA||GSCOCT00012438001|),UPSTREAM(MODIFIER||||Cc01g00010|mRNA||GSCOCT00012439001|)\tGT:AD:DP:GQ:PL\t1/1:0,7:7:18:242,18,0\n+\n+Fasta file\n+----------\n+\n+\n+::\n+\n+\t>chr1\n+\tCAGTAAAGTTTGCAAAGAGATTCTGGCAAAGTT\n+\n+Parameters\n+==========\n+\n+Output name -> input\n+\n+Optional files -> Fasta\n+\n+\n+Output files\n+============\n+\n+input.hapmap\n+------------\n+\n+::\n+\n+ rs#\talleles\tchrom\tpos\tstrand\tassembly#\tcenter\tprotLSID\tassayLSID\tpanelLSID\tQCcode\tCATB1\n+\tchr1:2209\tG/T\tchr1\t2209\t+\tNA\tNA\tNA\tNA\tNA\tNA\tGG\tTT\n+\tchr1:2232\tA/C\tchr1\t2232\t+\tNA\tNA\tNA\tNA\tNA\tNA\tAA\tCC\n+\n+input.flanking.txt\n+------------------\n+\n+::\n+\n+\tchr1-2209,GTCGCATCTGCAGCATATAGCCAACCTTCAACTTGCAGCTAAAACTCATCATCTCTTTCT[G/T]ACTGGCTTAACGATATTGTAAGMTGACTCAGAGGCCCACTTTTTTTTTAAAAATYAGCCT,0,0,0,Project_name,0,diploid,Other,Forward\n+\tchr1-2232,ACCTTCAACTTGCAGCTAAAACTCATCATCTCTTTCTKACTGGCTTAACGATATTGTAAG[A/C]TGACTCAGAGGCCCACTTTTTTTTTAAAAATYAGCCTGTCCCCAGCCGTGCTGACTGGGC,0,0,0,Project_name,0,diploid,Other,Forward\n+\n+input.gene_alignment.fas\n+------------------------\n+\n+::\n+\n+\t>chr1_CATB1_1\n+\tTCCTCAAACTTTCTTCAGCGCCTATGAATACAGCGTGCTATAGTTACGTGGGGCGTTT\n+\n+\t\n+ </help>\n+\n+ <citations>\n+ \n+ \t<citation type="bibtex">@article{Dereeper03062015,\n+author = {Dereeper, Alexis and Homa, Felix and Andres, Gwendoline and Sempere, Guilhem and Sarah, Gautier and Hueber, Yann and Dufayard, Jean-Fran\xc3\xa7ois and Ruiz, Manuel}, \n+title = {SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations},\n+year = {2015}, \n+doi = {10.1093/nar/gkv351}, \n+abstract ={SNiPlay is a web-based tool for detection, management and analysis of genetic variants including both single nucleotide polymorphisms (SNPs) and InDels. Version 3 now extends functionalities in order to easily manage and exploit SNPs derived from next generation sequencing technologies, such as GBS (genotyping by sequencing), WGRS (whole gre-sequencing) and RNA-Seq technologies. Based on the standard VCF (variant call format) format, the application offers an intuitive interface for filtering and comparing polymorphisms using user-defined sets of individuals and then establishing a reliable genotyping data matrix for further analyses. Namely, in addition to the various scaled-up analyses allowed by the application (genomic annotation of SNP, diversity analysis, haplotype reconstruction and network, linkage disequilibrium), SNiPlay3 proposes new modules for GWAS (genome-wide association studies), population stratification, distance tree analysis and visualization of SNP density. Additionally, we developed a suite of Galaxy wrappers for each step of the SNiPlay3 process, so that the complete pipeline can also be deployed on a Galaxy instance using the Galaxy ToolShed procedure and then be computed as a Galaxy workflow. SNiPlay is accessible at http://sniplay.southgreen.fr.}, \n+URL = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.abstract}, \n+eprint = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.full.pdf+html}, \n+journal = {Nucleic Acids Research} \n+}\n+\n+ \t}</citation>\n+\n+ </citations>\n+ \n+</tool>\n'

diff -r 3e19d0dfcf3e -r 420b57c3c185 VCFToolFilter/VCFToolsFilter.pl
--- a/VCFToolFilter/VCFToolsFilter.pl Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

[

@@ -1,214 +0,0 @@
-
-#!/usr/bin/perl
-
-use strict;
-use Switch;
-use Getopt::Long;
-use Bio::SeqIO;
-
-my $usage = qq~Usage:$0 <args> [<opts>]
-
-where <args> are:
-
-    -i, --input          <VCF input>
-    -o, --out            <Output basename>
-
-      <opts> are:
-
-    -s, --samples        <Samples to be analyzed. Comma separated list>
-    -c, --chromosomes    <Chromosomes to be analyzed. Comma separated list>
-    -e, --export         <Output format (VCF/freq/plink. Default: VCF>
-    -f, --frequency      <Minimum MAF. Default: 0.001>
-    -m, --max_freq       <Maximum MAF. Default: 0.5>
-    -a, --allow_missing  <Allowed missing data proportion per site. Must be comprised between 0 and 1. Default: 0>
-    -n, --nb_alleles     <Accepted number of alleles (min,max). Default: 2,4>
-    -t, --type           <Type of polymorphisms to keep (ALL/SNP/INDEL). Default: ALL>
-    -b, --bounds         <Lower bound and upper bound for a range of sites to be processed (start,end). Default: 1, 100000000>
-~;
-$usage .= "\n";
-
-my ($input,$out);
-
-
-#my $indel_size_max = 500;
-#my $indel_size_min = 1;
-my $frequency_max = 0.5;
-my $frequency_min = 0.001;
-my $pos_max = 100000000000;
-my $pos_min = 0;
-my $filter_snp_type = "all";
-
-my $missing_data = 0;
-my $export = "VCF";
-my $type = "ALL";
-my $nb_alleles;
-my $bounds;
-my $samples;
-my $chromosomes;
-
-GetOptions(
- "input=s"        => \$input,
- "out=s"          => \$out,
- "samples=s"      => \$samples,
- "chromosomes=s"  => \$chromosomes,
- "frequency=s"    => \$frequency_min,
- "max_freq=s"     => \$frequency_max,
- "allow_missing=s"=> \$missing_data,
- "export=s"       => \$export,
- "type=s"         => \$type,
- "nb_alleles=s"   => \$nb_alleles,
- "bounds=s"       => \$bounds,
-);
-
-
-die $usage
-  if ( !$input || !$out);
-
-if ($samples && $samples =~/^([\w\,]+)\s*$/){
-        $samples = $1;
-}
-elsif ($samples){
-        die "Error: Samples must be a comma separated list of string\n";
-}
-if ($chromosomes && $chromosomes =~/^([\w\,]+)\s*$/){
-        $chromosomes = $1;
-}
-elsif($chromosomes){
-        die "Error: Chromosomes must be a comma separated list of string\n";
-}
-if ($bounds && $bounds =~/^([\d\,]+)\s*$/){
-        $bounds = $1;
-}
-elsif($bounds){
-        die "Error: Bounds must be a comma separated list of integers\n";
-}
-
-if ($frequency_min && $frequency_min =~/^([\d\.]+)\s*$/){
-        $frequency_min = $1;
-}
-elsif ($frequency_min){
-        die "Error: frequency must be an integer\n";
-}
-if ($frequency_max && $frequency_max =~/^([\d\.]+)\s*$/){
-        $frequency_max = $1;
-}
-elsif($frequency_max){
-        die "Error: frequency must be an integer\n";
-}
-if ($missing_data && $missing_data =~/^([\d\.]+)\s*$/){
-        $missing_data = $1;
-}
-elsif ($missing_data){
-        die "Error: Missing data must be an integer\n";
-}
-if ($nb_alleles && $nb_alleles =~/^([\d\.\,]+)\s*$/){
-        $nb_alleles = $1;
-}
-elsif($nb_alleles){
-        die "Error: Nb alleles must be two integers\n";
-}
-if ($export && $export =~/^([\w]+)\s*$/){
-        $export = $1;
-}
-elsif($export){
-        die "Error: Export must be a string\n";
-}
-if ($type && $type =~/^([\w]+)\s*$/){
-        $type = $1;
-}
-elsif($type){
-        die "Error: Type must be a string\n";
-}
-
-
-my @dnasamples;
-if ($samples)
-{
- @dnasamples = split(",",$samples);
-}
-my @nalleles;
-if ($nb_alleles)
-{
- @nalleles = split(",",$nb_alleles);
-}
-my @boundaries;
-if ($bounds)
-{
- @boundaries = split(",",$bounds);
-}
-my @chromosomes_list;
-if ($chromosomes)
-{
- @chromosomes_list = split(",",$chromosomes);
-}
-
-
-my $experiment = "chromosomes";
-my $table = "";
-my %genes;
-my @snp_ids;
-my @snp_ids_and_positions;
-my @snp_ids_and_positions_all;
-my $gene;
-my $snp_num = 0;
-my %ref_sequences;
-my %snps_of_gene;
-
-
-
-
-my $indiv_cmd = "";
-if (@dnasamples)
-{
- $indiv_cmd = "--indv " . join(" --indv ",@dnasamples);
-}
-
-my $chrom_cmd = "";
-if (@chromosomes_list)
-{
- $chrom_cmd = "--chr " . join(" --chr ",@chromosomes_list);
-}
-
-my $export_cmd = "--recode";
-if ($export eq "freq")
-{
- $export_cmd = "--freq";
-}
-if ($export eq "plink")
-{
- $export_cmd = "--plink";
-}
-
-
-
-my $nb_alleles_cmd = "--min-alleles 1 --max-alleles 4";
-if (@nalleles)
-{
- $nb_alleles_cmd = "--min-alleles $nalleles[0] --max-alleles $nalleles[1]";
-}
-my $bounds_cmd = "--from-bp 1 --to-bp 100000000";
-if (@boundaries)
-{
-        $bounds_cmd = "--from-bp $boundaries[0] --to-bp $boundaries[1]";
-}
-
-
-my $type_cmd = "";
-if ($type eq "INDEL")
-{
- $type_cmd = "--keep-only-indels";
-}
-if ($type eq "SNP")
-{
- $type_cmd = "--remove-indels";
-}
-
-
-system("vcftools --vcf $input --out $out --keep-INFO-all --remove-filtered-all $type_cmd $export_cmd $chrom_cmd $indiv_cmd $nb_alleles_cmd --maf $frequency_min --max-maf $frequency_max --max-missing $missing_data >>vcftools.log 2>&1");
-
-
-
-
-
-
-

diff -r 3e19d0dfcf3e -r 420b57c3c185 VCFToolFilter/test-data/result.log
--- a/VCFToolFilter/test-data/result.log Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

@@ -1,21 +0,0 @@
-
-VCFtools - v0.1.12b
-(C) Adam Auton and Anthony Marcketta 2009
-
-Parameters as interpreted:
- --vcf /w/galaxy/galaxy4gwen/galaxy-dist/database/files/000/dataset_21.dat
- --chr chr1
- --recode-INFO-all
- --maf 0.001
- --max-alleles 4
- --max-maf 0.5
- --min-alleles 2
- --max-missing 1
- --out filtered
- --recode
- --remove-filtered-all
-
-After filtering, kept 1 out of 1 Individuals
-Outputting VCF file...
-After filtering, kept 3616 out of a possible 4955 Sites
-Run Time = 0.00 seconds

diff -r 3e19d0dfcf3e -r 420b57c3c185 VCFToolFilter/test-data/result.vcf
--- a/VCFToolFilter/test-data/result.vcf Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

[

b'@@ -1,3661 +0,0 @@\n-##fileformat=VCFv4.1\n-##FILTER=<ID=LowQual,Description="Low quality">\n-##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">\n-##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth (reads with MQ=255 or with bad mates are filtered)">\n-##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">\n-##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">\n-##FORMAT=<ID=PL,Number=G,Type=Integer,Description="Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification">\n-##GATKCommandLine=<ID=UnifiedGenotyper,Version=2.7-4-g6f46d11,Date="Fri Nov 01 16:17:42 CET 2013",Epoch=1383319062999,CommandLineOptions="analysis_type=UnifiedGenotyper input_file=[/scratch/hueber-35211/CATB1.RG.sorted.indelrealigned.bam] read_buffer_size=null phone_home=AWS gatk_key=null tag=NA read_filter=[BadCigar] intervals=null excludeIntervals=null interval_set_rule=UNION interval_merging=ALL interval_padding=0 reference_sequence=/data/projects/coffee_snp/donnees_genomiques/pseudomolecules.fasta nonDeterministicRandomSeed=false disableDithering=false maxRuntime=-1 maxRuntimeUnits=MINUTES downsampling_type=BY_SAMPLE downsample_to_fraction=null downsample_to_coverage=250 baq=OFF baqGapOpenPenalty=40.0 fix_misencoded_quality_scores=false allow_potentially_misencoded_quality_scores=false useOriginalQualities=false defaultBaseQualities=-1 performanceLog=null BQSR=null quantize_quals=0 disable_indel_quals=false emit_original_quals=false preserve_qscores_less_than=6 globalQScorePrior=-1.0 allow_bqsr_on_reduced_bams_despite_repeated_warnings=false validation_strictness=SILENT remove_program_records=false keep_program_records=false sample_rename_mapping_file=null unsafe=null disable_auto_index_creation_and_locking_when_reading_rods=false num_threads=4 num_cpu_threads_per_data_thread=1 num_io_threads=0 monitorThreadEfficiency=false num_bam_file_handles=null read_group_black_list=null pedigree=[] pedigreeString=[] pedigreeValidationType=STRICT allow_intervals_with_unindexed_bam=false generateShadowBCF=false logging_level=INFO log_to_file=null help=false version=false genotype_likelihoods_model=SNP pcr_error_rate=1.0E-4 computeSLOD=false annotateNDA=false pair_hmm_implementation=LOGLESS_CACHING min_base_quality_score=17 max_deletion_fraction=0.05 allSitePLs=false min_indel_count_for_genotyping=5 min_indel_fraction_per_sample=0.25 indelGapContinuationPenalty=10 indelGapOpenPenalty=45 indelHaplotypeSize=80 indelDebug=false ignoreSNPAlleles=false allReadsSP=false ignoreLaneInfo=false reference_sample_calls=(RodBinding name= source=UNBOUND) reference_sample_name=null sample_ploidy=2 min_quality_score=1 max_quality_score=40 site_quality_prior=20 min_power_threshold_for_calling=0.95 min_reference_depth=100 exclude_filtered_reference_sites=false output_mode=EMIT_VARIANTS_ONLY heterozygosity=0.001 indel_heterozygosity=1.25E-4 genotyping_mode=DISCOVERY standard_min_confidence_threshold_for_calling=30.0 standard_min_confidence_threshold_for_emitting=10.0 alleles=(RodBinding name= source=UNBOUND) max_alternate_alleles=6 input_prior=[] contamination_fraction_to_filter=0.0 contamination_fraction_per_sample_file=null p_nonref_model=EXACT_INDEPENDENT exactcallslog=null dbsnp=(RodBinding name= source=UNBOUND) comp=[] out=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub no_cmdline_in_header=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub bcf=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub onlyEmitSamples=[] debug_file=null metrics_file=null annotation=[] excludeAnnotation=[] filter_reads_with_N_cigar=false filter_mismatching_base_and_quals=false filter_bases_not_stored=false">\n-##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed">\n-##INFO=<ID=AF,Number=A,Type'..b'0012415001|),UTR_5_PRIME(MODIFIER||||Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:30,25:55:99:802,0,993\n-chr1\t188173\t.\tG\tA\t697.77\t.\tAC=1;AF=0.500;AN=2;BaseQRankSum=-0.617;DP=42;Dels=0.00;FS=2.786;HaplotypeScore=1.9991;MLEAC=1;MLEAF=0.500;MQ=59.09;MQ0=0;MQRankSum=-0.013;QD=16.61;ReadPosRankSum=1.599;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),UTR_5_PRIME(MODIFIER||||Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:20,22:42:99:726,0,669\n-chr1\t188266\t.\tA\tG\t878.77\t.\tAC=1;AF=0.500;AN=2;BaseQRankSum=0.261;DP=56;Dels=0.00;FS=2.268;HaplotypeScore=3.8663;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;MQRankSum=-1.827;QD=15.69;ReadPosRankSum=0.412;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),UTR_5_PRIME(MODIFIER||||Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:28,27:56:99:907,0,965\n-chr1\t188270\t.\tA\tG\t850.77\t.\tAC=1;AF=0.500;AN=2;BaseQRankSum=1.747;DP=54;Dels=0.00;FS=3.828;HaplotypeScore=4.8662;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;MQRankSum=0.692;QD=15.75;ReadPosRankSum=0.709;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),UTR_5_PRIME(MODIFIER||||Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:27,27:54:99:879,0,898\n-chr1\t188311\t.\tT\tG\t901.77\t.\tAC=1;AF=0.500;AN=2;BaseQRankSum=-0.508;DP=53;Dels=0.00;FS=2.345;HaplotypeScore=0.7340;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;MQRankSum=-0.454;QD=17.01;ReadPosRankSum=0.223;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),UTR_5_PRIME(MODIFIER||||Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:25,28:53:99:930,0,831\n-chr1\t188364\t.\tG\tC\t578.77\t.\tAC=1;AF=0.500;AN=2;BaseQRankSum=0.285;DP=40;Dels=0.00;FS=0.000;HaplotypeScore=0.0000;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;MQRankSum=0.585;QD=14.47;ReadPosRankSum=-0.612;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),UTR_5_PRIME(MODIFIER||||Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:22,18:40:99:607,0,770\n-chr1\t188393\t.\tT\tC\t515.77\t.\tAC=1;AF=0.500;AN=2;BaseQRankSum=-1.106;DP=42;Dels=0.00;FS=0.000;HaplotypeScore=2.5781;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;MQRankSum=-0.191;QD=12.28;ReadPosRankSum=-1.385;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),UTR_5_PRIME(MODIFIER||||Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:24,18:42:99:544,0,828\n-chr1\t188395\t.\tC\tG\t543.77\t.\tAC=1;AF=0.500;AN=2;BaseQRankSum=-1.484;DP=41;Dels=0.00;FS=0.000;HaplotypeScore=2.5781;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;MQRankSum=0.775;QD=13.26;ReadPosRankSum=-1.773;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),UTR_5_PRIME(MODIFIER||||Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:23,18:41:99:572,0,791\n-chr1\t188416\t.\tT\tC\t397.77\t.\tAC=1;AF=0.500;AN=2;BaseQRankSum=-0.717;DP=39;Dels=0.00;FS=1.302;HaplotypeScore=0.0000;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;MQRankSum=-0.893;QD=10.20;ReadPosRankSum=0.571;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),UTR_5_PRIME(MODIFIER||||Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:25,14:39:99:426,0,821\n-chr1\t188438\t.\tC\tA\t930.77\t.\tAC=1;AF=0.500;AN=2;BaseQRankSum=2.123;DP=50;Dels=0.00;FS=5.900;HaplotypeScore=0.0000;MLEAC=1;MLEAF=0.500;MQ=59.41;MQ0=0;MQRankSum=0.020;QD=18.62;ReadPosRankSum=-0.472;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),UTR_5_PRIME(MODIFIER||||Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:21,29:50:99:959,0,659\n-chr1\t188621\t.\tG\tA\t704.77\t.\tAC=1;AF=0.500;AN=2;BaseQRankSum=0.090;DP=49;Dels=0.00;FS=5.986;HaplotypeScore=0.9996;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;MQRankSum=0.090;QD=14.38;ReadPosRankSum=-0.774;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),SYNONYMOUS_CODING(LOW|SILENT|ttG/ttA|L4|Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:27,22:49:99:733,0,926\n'

diff -r 3e19d0dfcf3e -r 420b57c3c185 VCFToolFilter/test-data/sample.vcf
--- a/VCFToolFilter/test-data/sample.vcf Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

[

b'@@ -1,5000 +0,0 @@\n-##fileformat=VCFv4.1\n-##FILTER=<ID=LowQual,Description="Low quality">\n-##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">\n-##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth (reads with MQ=255 or with bad mates are filtered)">\n-##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">\n-##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">\n-##FORMAT=<ID=PL,Number=G,Type=Integer,Description="Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification">\n-##GATKCommandLine=<ID=UnifiedGenotyper,Version=2.7-4-g6f46d11,Date="Fri Nov 01 16:17:42 CET 2013",Epoch=1383319062999,CommandLineOptions="analysis_type=UnifiedGenotyper input_file=[/scratch/hueber-35211/CATB1.RG.sorted.indelrealigned.bam] read_buffer_size=null phone_home=AWS gatk_key=null tag=NA read_filter=[BadCigar] intervals=null excludeIntervals=null interval_set_rule=UNION interval_merging=ALL interval_padding=0 reference_sequence=/data/projects/coffee_snp/donnees_genomiques/pseudomolecules.fasta nonDeterministicRandomSeed=false disableDithering=false maxRuntime=-1 maxRuntimeUnits=MINUTES downsampling_type=BY_SAMPLE downsample_to_fraction=null downsample_to_coverage=250 baq=OFF baqGapOpenPenalty=40.0 fix_misencoded_quality_scores=false allow_potentially_misencoded_quality_scores=false useOriginalQualities=false defaultBaseQualities=-1 performanceLog=null BQSR=null quantize_quals=0 disable_indel_quals=false emit_original_quals=false preserve_qscores_less_than=6 globalQScorePrior=-1.0 allow_bqsr_on_reduced_bams_despite_repeated_warnings=false validation_strictness=SILENT remove_program_records=false keep_program_records=false sample_rename_mapping_file=null unsafe=null disable_auto_index_creation_and_locking_when_reading_rods=false num_threads=4 num_cpu_threads_per_data_thread=1 num_io_threads=0 monitorThreadEfficiency=false num_bam_file_handles=null read_group_black_list=null pedigree=[] pedigreeString=[] pedigreeValidationType=STRICT allow_intervals_with_unindexed_bam=false generateShadowBCF=false logging_level=INFO log_to_file=null help=false version=false genotype_likelihoods_model=SNP pcr_error_rate=1.0E-4 computeSLOD=false annotateNDA=false pair_hmm_implementation=LOGLESS_CACHING min_base_quality_score=17 max_deletion_fraction=0.05 allSitePLs=false min_indel_count_for_genotyping=5 min_indel_fraction_per_sample=0.25 indelGapContinuationPenalty=10 indelGapOpenPenalty=45 indelHaplotypeSize=80 indelDebug=false ignoreSNPAlleles=false allReadsSP=false ignoreLaneInfo=false reference_sample_calls=(RodBinding name= source=UNBOUND) reference_sample_name=null sample_ploidy=2 min_quality_score=1 max_quality_score=40 site_quality_prior=20 min_power_threshold_for_calling=0.95 min_reference_depth=100 exclude_filtered_reference_sites=false output_mode=EMIT_VARIANTS_ONLY heterozygosity=0.001 indel_heterozygosity=1.25E-4 genotyping_mode=DISCOVERY standard_min_confidence_threshold_for_calling=30.0 standard_min_confidence_threshold_for_emitting=10.0 alleles=(RodBinding name= source=UNBOUND) max_alternate_alleles=6 input_prior=[] contamination_fraction_to_filter=0.0 contamination_fraction_per_sample_file=null p_nonref_model=EXACT_INDEPENDENT exactcallslog=null dbsnp=(RodBinding name= source=UNBOUND) comp=[] out=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub no_cmdline_in_header=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub bcf=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub onlyEmitSamples=[] debug_file=null metrics_file=null annotation=[] excludeAnnotation=[] filter_reads_with_N_cigar=false filter_mismatching_base_and_quals=false filter_bases_not_stored=false">\n-##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed">\n-##INFO=<ID=AF,Number=A,Type'..b'm=1.599;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),UTR_5_PRIME(MODIFIER||||Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:20,22:42:99:726,0,669\n-chr1\t188266\t.\tA\tG\t878.77\t.\tAC=1;AF=0.500;AN=2;BaseQRankSum=0.261;DP=56;Dels=0.00;FS=2.268;HaplotypeScore=3.8663;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;MQRankSum=-1.827;QD=15.69;ReadPosRankSum=0.412;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),UTR_5_PRIME(MODIFIER||||Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:28,27:56:99:907,0,965\n-chr1\t188270\t.\tA\tG\t850.77\t.\tAC=1;AF=0.500;AN=2;BaseQRankSum=1.747;DP=54;Dels=0.00;FS=3.828;HaplotypeScore=4.8662;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;MQRankSum=0.692;QD=15.75;ReadPosRankSum=0.709;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),UTR_5_PRIME(MODIFIER||||Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:27,27:54:99:879,0,898\n-chr1\t188311\t.\tT\tG\t901.77\t.\tAC=1;AF=0.500;AN=2;BaseQRankSum=-0.508;DP=53;Dels=0.00;FS=2.345;HaplotypeScore=0.7340;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;MQRankSum=-0.454;QD=17.01;ReadPosRankSum=0.223;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),UTR_5_PRIME(MODIFIER||||Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:25,28:53:99:930,0,831\n-chr1\t188357\t.\tC\tT\t1327.77\t.\tAC=2;AF=1.00;AN=2;DP=36;Dels=0.00;FS=0.000;HaplotypeScore=0.0000;MLEAC=2;MLEAF=1.00;MQ=60.00;MQ0=0;QD=24.46;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),UTR_5_PRIME(MODIFIER||||Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t1/1:0,36:36:99:1356,105,0\n-chr1\t188364\t.\tG\tC\t578.77\t.\tAC=1;AF=0.500;AN=2;BaseQRankSum=0.285;DP=40;Dels=0.00;FS=0.000;HaplotypeScore=0.0000;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;MQRankSum=0.585;QD=14.47;ReadPosRankSum=-0.612;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),UTR_5_PRIME(MODIFIER||||Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:22,18:40:99:607,0,770\n-chr1\t188393\t.\tT\tC\t515.77\t.\tAC=1;AF=0.500;AN=2;BaseQRankSum=-1.106;DP=42;Dels=0.00;FS=0.000;HaplotypeScore=2.5781;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;MQRankSum=-0.191;QD=12.28;ReadPosRankSum=-1.385;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),UTR_5_PRIME(MODIFIER||||Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:24,18:42:99:544,0,828\n-chr1\t188395\t.\tC\tG\t543.77\t.\tAC=1;AF=0.500;AN=2;BaseQRankSum=-1.484;DP=41;Dels=0.00;FS=0.000;HaplotypeScore=2.5781;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;MQRankSum=0.775;QD=13.26;ReadPosRankSum=-1.773;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),UTR_5_PRIME(MODIFIER||||Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:23,18:41:99:572,0,791\n-chr1\t188416\t.\tT\tC\t397.77\t.\tAC=1;AF=0.500;AN=2;BaseQRankSum=-0.717;DP=39;Dels=0.00;FS=1.302;HaplotypeScore=0.0000;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;MQRankSum=-0.893;QD=10.20;ReadPosRankSum=0.571;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),UTR_5_PRIME(MODIFIER||||Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:25,14:39:99:426,0,821\n-chr1\t188438\t.\tC\tA\t930.77\t.\tAC=1;AF=0.500;AN=2;BaseQRankSum=2.123;DP=50;Dels=0.00;FS=5.900;HaplotypeScore=0.0000;MLEAC=1;MLEAF=0.500;MQ=59.41;MQ0=0;MQRankSum=0.020;QD=18.62;ReadPosRankSum=-0.472;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),UTR_5_PRIME(MODIFIER||||Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:21,29:50:99:959,0,659\n-chr1\t188621\t.\tG\tA\t704.77\t.\tAC=1;AF=0.500;AN=2;BaseQRankSum=0.090;DP=49;Dels=0.00;FS=5.986;HaplotypeScore=0.9996;MLEAC=1;MLEAF=0.500;MQ=60.00;MQ0=0;MQRankSum=0.090;QD=14.38;ReadPosRankSum=-0.774;EFF=DOWNSTREAM(MODIFIER||||Cc01g00190|mRNA||GSCOCT00012415001|),SYNONYMOUS_CODING(LOW|SILENT|ttG/ttA|L4|Cc01g00180|mRNA||GSCOCT00012416001|Exon_chr1_188034_188856)\tGT:AD:DP:GQ:PL\t0/1:27,22:49:99:733,0,926\n'

diff -r 3e19d0dfcf3e -r 420b57c3c185 VCFToolFilter/vcfToolsFilter.sh
--- a/VCFToolFilter/vcfToolsFilter.sh Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

[

@@ -1,46 +0,0 @@
-#!/bin/bash
-
-tool_path=$(dirname $0)
-
-filein=$1
-fileout_label=$2
-fileout=$3
-filelog=$4
-export=$5
-frequency=$6
-max_freq=$7
-allow_missing=$8
-nb_alleles_min=$9
-nb_alleles_max=${10}
-type=${11}
-bound_start=${12}
-bound_end=${13}
-
-
-if [ "${14}" != "None" ]
-then samples="--samples ${14}"
-fi
-
-if [ "${15}" != "None" ]
-then chromosomes="--chromosomes ${15}"
-fi
-
-if [ "$bound_start" -gt "$bound_end" ]
-then tmp=$bound_start ; bound_start=$bound_end ; bound_end=$tmp ; echo "Warning : Lower bound must be lower than greater bound!" >&2
-fi
-
-if [ "$nb_alleles_min" -gt "$nb_alleles_max" ]
-then tmp=$nb_alleles_min ; nb_alleles_min=$nb_alleles_max ; nb_alleles_max=$tmp ; echo "Warning : Minimum number of alleles must be lower than maximum number of allele!" >&2
-fi
-
-perl $tool_path/VCFToolsFilter.pl --input $filein --out $fileout_label --export $export --frequency $frequency --max_freq $max_freq --allow_missing $allow_missing --nb_alleles $nb_alleles_min','$nb_alleles_max --type $type --bounds $bound_start','$bound_end $samples $chromosomes
-
-if [ "$export" = "VCF" ]
-then cp  $fileout_label.recode.vcf $fileout ; rm $fileout_label.recode.vcf
-elif [ "$export" = "freq" ]
-then cp  $fileout_label.frq $fileout ; rm $fileout_label.frq
-else cp  $fileout_label.ped $fileout; cp $fileout_label.map ${16} ; rm $fileout_label.ped $fileout_label.map
-fi
-
-cp vcftools.log $filelog
-rm vcftools.log

diff -r 3e19d0dfcf3e -r 420b57c3c185 VCFToolFilter/vcfToolsFilter.xml
--- a/VCFToolFilter/vcfToolsFilter.xml Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

[

b'@@ -1,268 +0,0 @@\n-<tool id="sniplay_vcftoolsfilter" name="VCF tools filter" version="1.1.1">\n- \n- \n- <description> Filter VCF using VCFtools</description>\n- \n- \n- <requirements>\n- <requirement type="binary">perl</requirement>\n-\t<requirement type="package" version="0.1.12b">VCFtools</requirement>\n- </requirements>\n- \n- \n- <version_command>\n-\n- </version_command>\n- \n- \n- <command interpreter="perl">\n-\tvcfToolsFilter.sh $filein $fileout_label $fileout $filelog $export $frequency $max_freq $allow_missing $nb_alleles_min $nb_alleles_max $type_p $bound_start $bound_end\n-\t#if str( $samples ) == "":\n-\t\'None\'\n-\t#else\n-\t$samples\n-\t#end if\n-\t#if str( $chromosomes ) == "":\n-\t\'None\'\n-\t#else\n-\t$chromosomes\n-\t#end if\n-\t#if str( $export ) == "plink":\n-\t$fileout_map\n-\t#else\n-\t\'\'\n-\t#end if\n- </command>\n- \n- \n- <inputs>\n-\t<param name="filein" type="data" format="vcf" optional="false" label="VCF input" />\n-\t<param name="fileout_label" type="text" value="filtered" optional="false" label="Output file basename"/>\n-\t<param name="samples" type="text" optional="true" label="Samples" help="Samples to be analyzed. Comma separated list">\n-\t\t<validator type="regex" message="Please enter a comma separated list.">^\\w+(,\\w+)*$</validator>\n-\t</param>\n-\t<param name="chromosomes" type="text" optional="true" label="Chromosomes" help="Chromosomes to be analyzed. Comma separated list">\n-\t <validator type="regex" message="Please enter a comma separated list.">^\\w+(,\\w+)*$</validator>\n- </param>\n-\t<param name="export" type="select" label="Output format" >\n-\t <option value="VCF" selected="true">VCF</option>\n-\t <option value="freq">freq</option>\n- <option value="plink">plink</option>\n- </param>\n-\t<param name="frequency" type="float" value="0.001" label="Minimum MAF." help="Minimum frequency." />\n-\t<param name="max_freq" type="float" value="0.5" label="Maximum MAF." help="Maximum frequency." />\n-\t<param name="allow_missing" type="float" value="1" min="0" max="1" label="Missing data proportion" help="Allowed missing data proportion per site. Must be comprised between 0 and 1." />\n-\t<param name="nb_alleles_min" type="integer" value="2" label="Minimum number of alleles" help="Minimum accepted number of alleles." min="2" max="4" />\n-\t<param name="nb_alleles_max" type="integer" value="2" label="Maximum number of alleles" help="Maximum accepted number of alleles." min="2" max="4" />\n- <param name="type_p" type="select" label="Polymorphisms" help="Type of polymorphisms to keep." >\n- <option value="ALL" selected="true">All</option>\n- <option value="SNP">SNP</option>\n- <option value="INDEL">Indel</option>\n- </param>\n-\t<param name="bound_start" type="integer" value="1" label="Lower bound" help="Lower bound for a range of sites to be processed." />\n-\t<param name="bound_end" type="integer" value="100000000" label="Upper bound" help="Upper bound for a range of sites to be processed." />\n- </inputs>\n- \n- \n- <outputs>\n-\t<data name="fileout" format="vcf" label="${fileout_label}.#if str($export)==\'plink\' then \'ped\' else \'\' # #if str($export)==\'freq\' then \'frq\' else \'\' # #if str($export)==\'VCF\' then \'vcf\' else \'\' #" >\n-\t\t<change_format>\n- \t<when input="export" value="freq" format="tabular" />\n-\t\t\t<when input="export" value="plink" format="txt" />\n-\t\t</change_format>\t\n-\t</data>\n-\t<data name="fileout_map" format="txt" label="${fileout_label}.map">\n-\t\t<filter>(export == \'plink\')</filter>\n-\t</data>\n-\t<data name="filelog" format="txt" label='..b'alue="0.001" />\n- <param name="max_freq" value="0.5" />\n- <param name="allow_missing" value="0" />\n- <param name="nb_alleles_min" value="2" />\n-\t<param name="nb_alleles_max" value="4" />\n- <param name="type_p" value="ALL" />\n- <param name="bound_start" value="1" />\n- <param name="bound_end" value="100000000" />\n- <output name="fileout" file="result.vcf" />\n- <output name="filelog" file="result.log" />\n- </test>\n- </tests>\n- \n- \n- <help>\n-\n-.. class:: infomark\n-\n-**Authors** \n-\n----------------------------------------------------\n-\n-.. class:: infomark\n-\n-**Please cite** If you use this tool, please cite Dereeper et al. 2015 in prep.\n-\n----------------------------------------------------\n-\n-================\n-VCF tools filter\n-================\n-\n------------\n-Description\n------------\n-\n- Filter VCF file \n-\n------------------\n-Workflow position\n------------------\n-\n-**Upstream tools**\n-\n-=========== ========================== =======\n-Name output file(s) format \n-=========== ========================== =======\n-=========== ========================== =======\n-\n-\n-**Downstream tools**\n-\n-=========== ========================== =======\n-Name output file(s) format\n-=========== ========================== =======\n-=========== ========================== =======\n-\n-\n-----------\n-Input file\n-----------\n-\n-VCF file\n-\tVCF file with all SNPs\n-\n-----------\n-Parameters\n-----------\n-\n-Output file basename\n-\tPrefix for the output VCF file\n-\n-Samples\n- Samples to be analyzed. Comma separated list\n-\n-Chromosomes\n-\tChromosomes to be analyzed. Comma separated list\n-\n-Output format\n-\tVCF/freq/plink\n-\n-Minimum MAF\n-\tMinimum frequency\n-\n-Maximum MAF\n-\tMaximum frequency\n-\n-Missing data proportion\n-\tAllowed missing data proportion per site. Must be comprised between 0 and 1.\n-\n-Number of alleles\n-\tAccepted number of alleles min and max.\n-\n-Polymorphisms\n-\tType of polymorphisms to keep (ALL/SNP/INDEL).\n-Bounds\n-\tLower bound and upper bound for a range of sites to be processed.\n-\n-------------\n-Output files\n-------------\n-\n-VCF file\n-\tVCF file filtered \n-\n-Log file\n-\n----------------------------------------------------\n-\n----------------\n-Working example\n----------------\n-\n-Input files\n-===========\n-\n-VCF file\n----------\n-\n-::\n-\n-\t#fileformat=VCFv4.1\n-\t#FILTER=<ID=LowQual,Description="Low quality">\n-\t#FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">\n-\t[...]\n-\tCHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO\tFORMAT\tCATB1\n-\tchr1\t2209\t.\tG\tT\t213.84\t.\tAC=2;AF=1.00;AN=2;DP=7;Dels=0.00;FS=0.000;HaplotypeScore=0.0000;MLEAC=2;MLEAF=1.00;MQ=41.50;MQ0=0;QD=30.55;EFF=DOWNSTREAM(MODIFIER||||Cc01g00020|mRNA||GSCOCT00012438001|),UPSTREAM(MODIFIER||||Cc01g00010|mRNA||GSCOCT00012439001|)\tGT:AD:DP:GQ:PL\t1/1:0,7:7:18:242,18,0\n-\n-\n-Parameters\n-==========\n-\n-Output name -> filtered_chr1\n-\n-Chromosomes -> chr1\n-\n-Output format -> VCF\n-\n-Minimum MAF -> 0.001\n-\n-Maximum MAF -> 0.5\n-\n-Missing data proportion -> 1\n-\n-Number of alleles min -> 2\n-\n-Number of alleles max -> 4\n-\n-Polymorphisms -> All\n-\n-Lower bound -> 1\n-\n-Upper bound -> 100000000\n-\n-\n-Output files\n-============\n-\n-filtered_genelist_intron.vcf\n----------\n-\n-::\n-\n- #fileformat=VCFv4.1\n- #FILTER=<ID=LowQual,Description="Low quality">\n- #FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">\n- [...]\n- CHROM POS ID REF ALT QUAL FILTER INFO FORMAT CATB1\n-\tchr1\t5059\t.\tC\tG\t146.84\t.\tAC=2;AF=1.00;AN=2;DP=8;Dels=0.00;FS=0.000;HaplotypeScore=0.0000;MLEAC=2;MLEAF=1.00;MQ=24.14;MQ0=1;QD=18.35;EFF=INTRON(MODIFIER||||Cc01g00020|mRNA||GSCOCT00012438001|),UPSTREAM(MODIFIER||||Cc01g00010|mRNA||GSCOCT00012439001|)\tGT:AD:DP:GQ:PL\t1/1:0,8:8:18:175,18,0\n-\n-\n- </help>\n- \n-</tool>\n'

diff -r 3e19d0dfcf3e -r 420b57c3c185 VCFToolsStats/VCFToolsStats.pl
--- a/VCFToolsStats/VCFToolsStats.pl Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

[

@@ -1,71 +0,0 @@
-
-#!/usr/bin/perl
-
-use strict;
-use Switch;
-use Getopt::Long;
-use Bio::SeqIO;
-
-my $usage = qq~Usage:$0 <args> [<opts>]
-
-where <args> are:
-
-    -i, --input          <VCF input>
-    -o, --out            <output basename>
-~;
-$usage .= "\n";
-
-my ($input,$out);
-
-GetOptions(
- "input=s"        => \$input,
- "out=s"          => \$out
-);
-
-
-die $usage
-  if ( !$input);
-
-
-
-my $nb_gene = `grep -c mRNA $input`;
-$nb_gene =~s/\n//g;
-my $nb_intergenic = `grep -c INTERGENIC $input`;
-$nb_intergenic =~s/\n//g;
-
-my $nb_intron = `grep -c INTRON $input`;
-$nb_intron =~s/\n//g;
-my $nb_UTR = `grep -c UTR $input`;
-$nb_UTR =~s/\n//g;
-my $nb_exon = $nb_gene - $nb_intron - $nb_UTR;
-
-my $nb_ns = `grep -c NON_SYNONYMOUS_CODING $input`;
-$nb_ns =~s/\n//g;
-my $nb_s = $nb_exon - $nb_ns;
-
-
-
-
-#system("$VCFTOOLS_EXE --vcf $input --remove-filtered-all --out $out --hardy >>vcftools.log 2>&1");
-system("vcftools --vcf $input --remove-filtered-all --out $out --het >>vcftools.log 2>&1");
-system("vcftools --vcf $input --remove-filtered-all --out $out --TsTv-summary >>vcftools.log 2>&1");
-system("vcftools --vcf $input --remove-filtered-all --out $out --missing-indv >>vcftools.log 2>&1");
-
-open(my $G,">$out.annotation");
-print $G "Genic $nb_gene\n";
-print $G "Intergenic $nb_intergenic\n";
-print $G "========\n";
-print $G "Intron $nb_intron\n";
-print $G "Exon $nb_exon\n";
-print $G "UTR $nb_UTR\n";
-print $G "========\n";
-print $G "Non-syn $nb_ns\n";
-print $G "Synonym $nb_s\n";
-close($G);
-
-
-
-
-
-
-

diff -r 3e19d0dfcf3e -r 420b57c3c185 VCFToolsStats/test-data/result.TsTv.summary
--- a/VCFToolsStats/test-data/result.TsTv.summary Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

@@ -1,9 +0,0 @@
-MODEL COUNT
-AC 371
-AG 1467
-AT 562
-CG 330
-CT 1659
-GT 397
-Ts 3126
-Tv 1660

diff -r 3e19d0dfcf3e -r 420b57c3c185 VCFToolsStats/test-data/result.annotation
--- a/VCFToolsStats/test-data/result.annotation Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

@@ -1,9 +0,0 @@
-Genic 4489
-Intergenic 466
-========
-Intron 960
-Exon 3248
-UTR 281
-========
-Non-syn 226
-Synonym 3022

diff -r 3e19d0dfcf3e -r 420b57c3c185 VCFToolsStats/test-data/result.het
--- a/VCFToolsStats/test-data/result.het Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

@@ -1,2 +0,0 @@
-INDV O(HOM) E(HOM) N_SITES F
-CATB1 0 0.0 3616 0.00000

diff -r 3e19d0dfcf3e -r 420b57c3c185 VCFToolsStats/test-data/result.imiss
--- a/VCFToolsStats/test-data/result.imiss Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

@@ -1,2 +0,0 @@
-INDV N_DATA N_GENOTYPES_FILTERED N_MISS F_MISS
-CATB1 4813 0 0 0

diff -r 3e19d0dfcf3e -r 420b57c3c185 VCFToolsStats/test-data/result.log
--- a/VCFToolsStats/test-data/result.log Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

@@ -1,44 +0,0 @@
-
-VCFtools - v0.1.12b
-(C) Adam Auton and Anthony Marcketta 2009
-
-Parameters as interpreted:
- --vcf /w/galaxy/galaxy4gwen/galaxy-dist/database/files/000/dataset_21.dat
- --het
- --out vcf_stats
- --remove-filtered-all
-
-After filtering, kept 1 out of 1 Individuals
-Outputting Individual Heterozygosity
- Individual Heterozygosity: Only using biallelic SNPs.
-After filtering, kept 4813 out of a possible 4955 Sites
-Run Time = 0.00 seconds
-
-VCFtools - v0.1.12b
-(C) Adam Auton and Anthony Marcketta 2009
-
-Parameters as interpreted:
- --vcf /w/galaxy/galaxy4gwen/galaxy-dist/database/files/000/dataset_21.dat
- --out vcf_stats
- --TsTv-summary
- --remove-filtered-all
-
-After filtering, kept 1 out of 1 Individuals
-Outputting Ts/Tv summary
-Ts/Tv ratio: 1.883
-After filtering, kept 4813 out of a possible 4955 Sites
-Run Time = 0.00 seconds
-
-VCFtools - v0.1.12b
-(C) Adam Auton and Anthony Marcketta 2009
-
-Parameters as interpreted:
- --vcf /w/galaxy/galaxy4gwen/galaxy-dist/database/files/000/dataset_21.dat
- --missing-indv
- --out vcf_stats
- --remove-filtered-all
-
-After filtering, kept 1 out of 1 Individuals
-Outputting Individual Missingness
-After filtering, kept 4813 out of a possible 4955 Sites
-Run Time = 0.00 seconds

diff -r 3e19d0dfcf3e -r 420b57c3c185 VCFToolsStats/test-data/sample.vcf
--- a/VCFToolsStats/test-data/sample.vcf Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

[

diff -r 3e19d0dfcf3e -r 420b57c3c185 VCFToolsStats/vcfToolsStats.sh
--- a/VCFToolsStats/vcfToolsStats.sh Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

@@ -1,23 +0,0 @@
-#!/bin/bash
-
-tool_path=$(dirname $0)
-
-filein=$1
-fileout_label=$2
-fileout_annot=$3
-fileout_het=$4
-fileout_imiss=$5
-fileout_sum=$6
-filelog=$7
-
-
-
-perl $tool_path/VCFToolsStats.pl --input $filein --out $fileout_label
-
-cp  $fileout_label.annotation $fileout_annot ; rm $fileout_label.annotation
-cp  $fileout_label.het $fileout_het ; rm $fileout_label.het
-cp  $fileout_label.imiss $fileout_imiss ; rm $fileout_label.imiss
-cp  $fileout_label.TsTv.summary $fileout_sum ; rm $fileout_label.TsTv.summary
-
-cp vcftools.log $filelog
-rm vcftools.log

diff -r 3e19d0dfcf3e -r 420b57c3c185 VCFToolsStats/vcfToolsStats.xml
--- a/VCFToolsStats/vcfToolsStats.xml Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

[

@@ -1,214 +0,0 @@
-<tool id="sniplay_vcftoolsstats" name="VCF tools Stats" version="1.0.0">
-
-    
-    <description> Various statistics from VCF using VCFtools</description>
-
-    
-    <requirements>
-        <requirement type="binary">perl</requirement>
- <requirement type="package" version="0.1.13">VCFtools</requirement>
-    </requirements>
-
-    
-    <version_command>
-
-    </version_command>
-
-    
-    <command interpreter="perl">
- vcfToolsStats.sh $filein $fileout_label $fileout_annot $fileout_het $fileout_imiss $fileout_sum $filelog
-    </command>
-
-    
-    <inputs>
- <param name="filein" type="data" format="vcf" optional="false" label="VCF input" />
- <param name="fileout_label" type="text" value="vcf_stats" optional="false" label="Output file basename"/>
-    </inputs>
-
-    
-    <outputs>
- <data name="fileout_annot" format="txt" label="${fileout_label}.annotation" />
- <data name="fileout_het" format="txt" label="${fileout_label}.het" />
- <data name="fileout_imiss" format="txt" label="${fileout_label}.imiss" />
- <data name="fileout_sum" format="txt" label="${fileout_label}.TsTv.summary" />
- <data name="filelog" format="txt" label="${fileout_label}.log" />
-    </outputs>
-
-    
-    <stdio>
-        
-        <exit_code range="1:" level="fatal" />
-    </stdio>
-
-    
-    <tests>
-        
-        <test>
-         <param name="filein" value="sample.vcf" />
-         <output name="fileout_annot" file="result.annotation" />
-         <output name="fileout_het" file="result.het" />
-         <output name="fileout_imiss" file="result.imiss" />
-         <output name="fileout_sum" file="result.TsTv.summary" />
-         <output name="filelog" file="result.log" />
-        </test>
-    </tests>
-
-    
-    <help>
-
-.. class:: infomark
-
-**Authors**
-
----------------------------------------------------
-
-.. class:: infomark
-
-**Please cite** If you use this tool, please cite Dereeper et al. 2015 in prep.
-
----------------------------------------------------
-
-================
-VCF tools filter
-================
-
------------
-Description
------------
-
-  Compute statistics on VCF file
-
------------------
-Workflow position
------------------
-
-**Upstream tools**
-
-=========== ========================== =======
-Name            output file(s)         format
-=========== ========================== =======
-=========== ========================== =======
-
-
-**Downstream tools**
-
-=========== ========================== =======
-Name            output file(s)         format
-=========== ========================== =======
-=========== ========================== =======
-
-
-----------
-Input file
-----------
-
-VCF file
- VCF file with all SNPs
-
-----------
-Parameters
-----------
-
-Output file basename
- Prefix for the output VCF file
-
-------------
-Output files
-------------
-
-.annotation file
- Statistics on annotation/location along genome
-
-.het file
- Statistics on heterozygosity of the individuals
-
-.imiss
- Statistics on missing data of the inidividuals
-.TsTv.summary
- Statistics on mutation types and transition/transvertion number
-
-.log file
-
----------------------------------------------------
-
----------------
-Working example
----------------
-
-Input files
-===========
-
-VCF file
----------
-
-::
-
- #fileformat=VCFv4.1
- #FILTER=<ID=LowQual,Description="Low quality">
- #FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
- [...]
- CHROM POS ID REF ALT QUAL FILTER INFO FORMAT CATB1
- chr1 2209 . G T 213.84 . AC=2;AF=1.00;AN=2;DP=7;Dels=0.00;FS=0.000;HaplotypeScore=0.0000;MLEAC=2;MLEAF=1.00;MQ=41.50;MQ0=0;QD=30.55;EFF=DOWNSTREAM(MODIFIER||||Cc01g00020|mRNA||GSCOCT00012438001|),UPSTREAM(MODIFIER||||Cc01g00010|mRNA||GSCOCT00012439001|) GT:AD:DP:GQ:PL 1/1:0,7:7:18:242,18,0
-
-
-Parameters
-==========
-
-Output name -> vcf_stat
-
-
-Output files
-============
-
-.annotation file
-----------------
-
-::
-
- Genic 4489
- Intergenic 466
- ========
- Intron 960
- Exon 3248
- UTR 281
- ========
- Non-syn 226
- Synonym 3022
-
-.het file
----------
-
-::
-
- INDV O(HOM) E(HOM) N_SITES F
- CATB1 0 0.0 3616 0.00000
-
-.imiss file
------------
-
-::
-
- INDV N_DATA N_GENOTYPES_FILTERED N_MISS F_MISS
- CATB1 4813 0 0 0
-
-.TsTv.summary file
-------------------
-
-::
-
- MODEL COUNT
- AC 371
- AG 1467
- AT 562
- CG 330
- CT 1659
- GT 397
- Ts 3126
- Tv 1660
-
-
-    </help>
-
-</tool>

diff -r 3e19d0dfcf3e -r 420b57c3c185 admixture/Admixture.pl
--- a/admixture/Admixture.pl Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

[

@@ -1,159 +0,0 @@
-#!/usr/bin/perl
-
-use strict;
-use Switch;
-use Getopt::Long;
-use Bio::SeqIO;
-
-my $usage = qq~Usage:$0 <args> [<opts>]
-where <args> are:
-    -i, --input         <input HAPMAP>
-    -o, --output        <output>
-    -k, --kmin          <K min. int>
-    -m, --maxK          <K max. int>
-    -d, --directory     <temporary directory>
-    -p, --path          <path to executables>
-~;
-$usage .= "\n";
-
-my ($input,$output,$kmin,$kmax,$directory,$path);
-
-
-GetOptions(
- "input=s"      => \$input,
- "output=s"     => \$output,
- "kmin=s"       => \$kmin,
- "maxK=s"       => \$kmax,
- "directory=s"  => \$directory,
- "path=s"       => \$path
-);
-
-
-die $usage
-  if ( !$input || !$output || !$kmin || !$kmax || !$directory || !$path);
-
-if ($kmin =~/^(\d+)\s*$/){
-        $kmin = $1;
-}
-else{
-        die "Error: kmin must be an integer\n";
-}
-if ($kmax =~/^(\d+)\s*$/){
-        $kmax = $1;
-}
-else{
-        die "Error: kmax must be an integer\n";
-}
-
-
-######################
-# create map file
-######################
-open(my $M,">$directory/input.map");
-open(my $H,$input);
-<$H>;
-while(<$H>)
-{
- my @infos = split(/\t/,$_);
- print $M $infos[2] . "\t" . $infos[0] . "\t" . "0" . "\t" . $infos[3] . "\n";
-}
-close($H);
-close($M);
-
-######################
-# create ped file
-######################
-system("$path/transpose.awk $input >$directory/input.ped.2");
-
-open(my $P,">$directory/input.ped");
-open(my $P2,"$directory/input.ped.2");
-my $n = 0;
-my $ind_num = 0;
-my @individus;
-while(<$P2>)
-{
- $n++;
- if ($n > 11)
- {
- my $line = $_;
- $line =~s/N/0/g;
- if (/^([^\s]+)\s+(.*)$/)
- {
- $ind_num++;
- my $ind = $1;
- push(@individus,$ind);
- my $genoyping_line = $2;
- print $P "$ind $ind_num 0 0 1 2";
- my @genotypes = split(/\s/,$genoyping_line);
- foreach my $genotype(@genotypes)
- {
- $genotype =~s/N/0/g;
- my @alleles = split("",$genotype);
- print $P " " . join(" ",@alleles);
- }
-
- print $P "\n";
- }
- }
-}
-close($P2);
-close($P);
-
-unlink("$directory/input.ped.2");
-
-system("plink --file $directory/input --out $directory/out --make-bed --noweb >>$directory/plink.log 2>&1");
-
-
-###################################
-# launch admixture for different K
-###################################
-my %errors;
-for (my $k = $kmin; $k <= $kmax; $k++)
-{
- system("admixture --cv $directory/out.bed $k >>$directory/log.$k 2>&1");
- my $cv_error_line = `grep -h CV $directory/log.$k`;
- if ($cv_error_line =~/: (\d+\.*\d*)$/)
- {
- $errors{$1} = $k;
- }
- system("cat $directory/log.$k >>$directory/logs");
- system("echo '\n\n====================================\n\n' >>$directory/logs");
- system("cat out.$k.Q >>$directory/outputs.Q");
- system("echo '\n\n====================================\n\n' >>$directory/outputs.Q");
- system("cat out.$k.P >>$directory/outputs.P");
- system("echo '\n\n====================================\n\n' >>$directory/outputs.P");
-}
-
-my @sorted_errors = sort {$a<=>$b} keys(%errors);
-my $best_K = $errors{@sorted_errors[0]};
-
-
-#system("cp -rf out.$best_K.Q $directory/output");
-
-open(BEST1,"out.$best_K.Q");
-open(BEST2,">$directory/output");
-print BEST2 "<Covariate>\n";
-print BEST2 "<Trait>";
-for (my $j=1;$j<=$best_K;$j++)
-{
- print BEST2 " Q" . $j;
-}
-print BEST2 "\n";
-my $i = 0;
-while(<BEST1>)
-{
- my $line = $_;
- $line =~s/ /\t/g;
- my $ind = $individus[$i];
- print BEST2 "$ind ";
- print BEST2 $line;
- $i++;
-}
-close(BEST1);
-close(BEST2);
-
-system("cp -rf $directory/log.$best_K $directory/log");
-
-
-
-

diff -r 3e19d0dfcf3e -r 420b57c3c185 admixture/admixture.sh
--- a/admixture/admixture.sh Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

@@ -1,21 +0,0 @@
-#!/bin/bash
-input=$1
-outputs=$2
-logs=$3
-best_k_output=$4
-best_k_logfile=$5
-kmin=$6
-kmax=$7
-
-directory=`dirname $0`
-mkdir tmpdir$$
-cp -rf $input tmpdir$$/input
-
-/usr/bin/perl $directory/Admixture.pl -i $input -o $outputs -k $kmin -m $kmax -d tmpdir$$ -p $directory
-
-mv tmpdir$$/output $best_k_output
-mv tmpdir$$/log $best_k_logfile
-mv tmpdir$$/outputs.Q $outputs
-mv tmpdir$$/logs $logs
-
-

diff -r 3e19d0dfcf3e -r 420b57c3c185 admixture/admixture.xml
--- a/admixture/admixture.xml Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

@@ -1,55 +0,0 @@
-<tool id="admixture" name="Admixture" version="1.23">
- <description>a population structure from large SNP genotype datasets</description>
- <requirements>
- <requirement type="package" version="1.07">plink</requirement>
- <requirement type="package" version="1.23">admixture</requirement>
- </requirements>
- <command interpreter="bash">./admixture.sh $input $outputs $logs $best_k_output $best_k_logfile $kmin $kmax
- </command>
- <inputs>
- <param format="txt" name="input" type="data" label="Allelic file in Hapmap format" help="Allelic file in Hapmap format"/>
- <param type="text" name="kmin" label="K min" value="1"/>
- <param type="text" name="kmax" label="K max" value="5"/>
- </inputs>
- <outputs>
- <data format="txt" name="best_k_output" label="Best K Output"/>
- <data format="txt" name="best_k_logfile" label="Best K Logfile"/>
- <data format="txt" name="outputs" label="All Outputs"/>
- <data format="txt" name="logs" label="All Logs"/>
- </outputs>
- <help>
-
-
-.. class:: infomark
-
-**Program encapsulated in Galaxy by Southgreen**
-
-.. class:: infomark
-
-**Admixture version 1.23**
-
------
-
-==============
- Please cite:
-==============
-
-"Fast model-based estimation of ancestry in unrelated individuals.", **D.H. Alexander, J. Novembre, and K. Lange.**, Genome Research, 19:1655{1664, 2009.
-
------
-
-===========
- Overview:
-===========
-
-ADMIXTURE is a program for estimating ancestry in a model-based manner from large autosomal SNP genotype datasets, where the individuals are unrelated (for example, the individuals in a case-control association study).
-
------
-
-For further informations, please visite the Admixture_ website.
-
-
-.. _Admixture: http://www.genetics.ucla.edu/software/admixture/index.html
- </help>
-
-</tool>

diff -r 3e19d0dfcf3e -r 420b57c3c185 admixture/transpose.awk
--- a/admixture/transpose.awk Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

[

@@ -1,27 +0,0 @@
-#!/usr/bin/gawk -f
-
-BEGIN {
-    max_x =0;
-    max_y =0;
-}
-
-{
-    max_y++;
-    for( i=1; i<=NF; i++ )
-    {
-        if (i>max_x) max_x=i;
-        A[i,max_y] = $i;
-    }
-}
-
-END {
-    for ( x=1; x<=max_x; x++ )
-    {
-        for ( y=1; y<=max_y; y++ )
-        {
-            if ( (x,y) in A ) printf "%s",A[x,y];
-            if ( y!=max_y ) printf " ";
-        }
-        printf "\n";
-    }
-}

diff -r 3e19d0dfcf3e -r 420b57c3c185 check_gwas_inputs/CheckGWASInputs.pl
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/check_gwas_inputs/CheckGWASInputs.pl Fri Jul 10 04:39:30 2015 -0400

[

@@ -0,0 +1,184 @@
+#!/usr/bin/perl
+
+use strict;
+use Switch;
+use Getopt::Long;
+
+my $usage = qq~Usage:$0 <args> [<opts>]
+where <args> are:
+    -h, --hapmap       <Hapmap input file>
+    -t, --trait        <Trait input file>
+    -o, --out          <Output base name>
+~;
+$usage .= "\n";
+
+my ($hapmap,$trait,$out);
+
+
+GetOptions(
+        "trait=s"      => \$trait,
+        "out=s"        => \$out,
+        "hapmap=s"     => \$hapmap
+);
+
+
+die $usage
+  if ( !$trait || !$out || !$hapmap);
+
+my %inds;
+
+#######################################
+# get individuals in trait file
+#######################################
+my %traits;
+my $head_trait = `head -1 $trait`;
+open(my $T,$trait);
+<$T>;
+while(<$T>)
+{
+ my @infos = split(/\t/,$_);
+ my $ind = $infos[0];
+ $inds{$ind}++;
+ $traits{$ind} = $_;
+}
+close($T);
+my $nb_ind_trait = scalar keys(%traits);
+
+#######################################
+# get individuals in hapmap file
+#######################################
+my $line_ind = `head -1 $hapmap`;
+chomp($line_ind);
+my @infos = split(/\t/,$line_ind);
+for (my $i = 11; $i <= $#infos; $i++)
+{
+ my $ind = $infos[$i];
+ $inds{$ind}++;
+}
+my $nb_ind_hapmap = scalar @infos - 11;
+
+#################################################################
+# create trait output by keeping individuals found in both files
+#################################################################
+open(my $O,">$out.trait");
+print $O $head_trait;
+my $nb_common = 0;
+foreach my $ind(keys(%inds))
+{
+ my $nb_found = $inds{$ind};
+ if ($nb_found == 2)
+ {
+ $nb_common++;
+ print $O $traits{$ind};
+ }
+}
+close($O);
+
+
+#####################################################################
+# create hapmap output after keeping individuals found in both files
+# and removing monomorphic positions
+#####################################################################
+open(my $O2,">$out.hapmap");
+my $numline = 0;
+my %genotypes;
+my %columns_to_keep;
+my $nb_monomorphic = 0;
+my $not_biallelic = 0;
+my $diff_variation = 0;
+open(my $H,$hapmap);
+while(<$H>)
+{
+ $numline++;
+ my $line = $_;
+ $line =~s/\n//g;
+ $line =~s/\r//g;
+ my @infos = split(/\t/,$line);
+ if ($numline == 1)
+ {
+ my @titles;
+ for (my $i = 0; $i <= 10; $i++)
+ {
+ my $title = $infos[$i];
+ push(@titles,$title);
+ }
+ print $O2 join("\t",@titles);
+ for (my $i = 11; $i <= $#infos; $i++)
+ {
+ my $ind = $infos[$i];
+ my $nb_found = $inds{$ind};
+ if ($nb_found == 2)
+ {
+ print $O2 " $ind";
+ $columns_to_keep{$i} = 1;
+ }
+ }
+ print $O2 "\n";
+ }
+ else
+ {
+ my $to_be_printed = "";
+ my $variation = $infos[1];
+        for (my $i = 0; $i <= 10; $i++)
+ {
+ my $title = $infos[$i];
+ $to_be_printed .= "$title ";
+ }
+ my %letters;
+ for (my $i = 11; $i <= $#infos; $i++)
+ {
+ if ($columns_to_keep{$i})
+ {
+ my $genotype = $infos[$i];
+ if ($genotype ne 'NN')
+ {
+ my ($allele1,$allele2) = split(//,$genotype);
+ $letters{$allele1}=1;
+ $letters{$allele2}=1;
+ }
+ $to_be_printed .= "$genotype ";
+ }
+ }
+ chop($to_be_printed);
+
+ my $variation_obs = join("/",sort keys(%letters));
+
+ # print only if polymorphic
+ if (scalar keys(%letters) < 2)
+ {
+ $nb_monomorphic++;
+ }
+ elsif (scalar keys(%letters) > 2)
+ {
+ $not_biallelic++;
+ }
+ else
+ {
+ if ($variation ne $variation_obs)
+ {
+ $to_be_printed =~s/$variation/$variation_obs/;
+ $diff_variation++;
+ }
+
+ print $O2 $to_be_printed . "\n";
+ }
+ }
+}
+close($H);
+close($O2);
+
+print "==============================================\n";
+print "Individuals\n";
+print "==============================================\n";
+print "Individuals in hapmap file: $nb_ind_hapmap\n";
+print "Individuals in trait file: $nb_ind_trait\n";
+print "Individuals found in both files: $nb_common\n";
+print "==============================================\n";
+print "Markers\n";
+print "==============================================\n";
+print "Discarded markers:\n";
+print "Monomorphic: $nb_monomorphic\n";
+print "Not biallelic: $not_biallelic\n";
+print "Modified markers:\n";
+print "Difference in variation: $diff_variation\n";
+

diff -r 3e19d0dfcf3e -r 420b57c3c185 check_gwas_inputs/CheckGWASInputs.sh
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/check_gwas_inputs/CheckGWASInputs.sh Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,17 @@
+#!/bin/bash
+hapmap=$1
+trait=$2
+out_hapmap=$3
+out_trait=$4
+stats=$5
+
+directory=`dirname $0`
+mkdir tmpdir$$
+#cp -rf $input tmpdir$$/input
+
+perl $directory/CheckGWASInputs.pl -h $hapmap -t $trait -o tmpdir$$/out >>$stats 2>&1
+
+mv tmpdir$$/out.hapmap $out_hapmap
+mv tmpdir$$/out.trait $out_trait
+
+

diff -r 3e19d0dfcf3e -r 420b57c3c185 check_gwas_inputs/CheckGWASInputs.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/check_gwas_inputs/CheckGWASInputs.xml Fri Jul 10 04:39:30 2015 -0400

[

@@ -0,0 +1,184 @@
+<tool id="check_GWAS_inputs" name="Check GWAS Inputs" version="1.0">
+ <description>checks concordance between input files for GWAS analysis</description>
+ <command interpreter="bash">./CheckGWASInputs.sh $hapmap $trait $out_hapmap $out_trait $stats
+    </command>
+ <inputs>
+ <param format="text" name="hapmap" type="data" label="Allelic file in Hapmap format" help="Allelic file in Hapmap format"/>
+ <param format="text" name="trait" type="data" label="Trait file" help="Phenotypic file"/>
+ </inputs>
+ <outputs>
+ <data format="txt" name="out_hapmap" label="Hapmap output"/>
+ <data format="txt" name="out_trait" label="Trait output"/>
+ <data format="txt" name="stats" label="Logfile and statistics"/>
+ </outputs>
+    
+    <stdio>
+        
+        <exit_code range="1:" level="fatal" />
+    </stdio>
+
+    
+    <tests>
+        
+        
+
+    </tests>
+ <help>
+
+        <![CDATA[
+
+
+.. class:: infomark
+
+**Authors** South Green
+
+  | **Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1).
+
+.. class:: infomark
+
+**Galaxy integration** South Green.
+
+---------------------------------------------------
+
+
+===============
+CheckGWASInputs
+===============
+
+-----------
+Description
+-----------
+
+  | CheckGWASInputs checks concordance between input files for GWAS analysis.
+
+
+-----------------
+Workflow position
+-----------------
+
+**Upstream tool**
+
+=============== ====================== ===========
+Name            output file(s)         format
+=============== ====================== ===========
+VCF to Hapmap   Hapmap file        hapmap
+=============== ====================== ===========
+
+
+
+
+----------
+Input file
+----------
+
+Hapmap file
+ Allelic file in Hapmap format
+
+Trait file
+ Phenotypic file
+
+------------
+Output files
+------------
+
+Hapmap output
+
+Trait output
+
+Logfile and statistics
+
+---------------------------------------------------
+
+---------------
+Working example
+---------------
+
+Input files
+===========
+
+Hapmap file
+-----------
+
+::
+
+ rs# alleles chrom pos strand assembly# center protLSID assayLSID panel QCcode Ind1 Ind2
+ SNP1 A/T 1 3102 + assembly NA NA NA speciesname NA AA AA AA
+ SNP2 A/T 1 4648 + assembly NA NA NA speciesname NA AA AA AA
+
+Trait file
+----------
+
+::
+
+ <Trait> Test
+ Ind1 -2.9985936006411
+ Ind2 -2.68669426456267
+
+Output files
+============
+
+Hapmap output
+-------------
+
+::
+
+        rs#     alleles chrom   pos     strand  assembly#       center  protLSID        assayLSID       panel   QCcode  Ind1    Ind2    Ind3    Ind4
+        SNP1    A/T     1       3102    +       assembly        NA      NA      NA      speciesname     NA      AA      AA      AA      AA      AA
+        SNP2    A/T     1       4648    +       assembly        NA      NA      NA      speciesname     NA      AA      AA      AA      AA      TT
+
+
+Trait output
+------------
+
+::
+
+        <Trait> Test
+        Ind429  -26.2142525264157
+        Ind373  12.0306115988504
+        Ind81   1.98118654229534
+
+Logfile and statistics
+----------------------
+
+::
+
+
+        ==============================================
+        Individuals
+        ==============================================
+        Individuals in hapmap file: 500
+        Individuals in trait file: 500
+        Individuals found in both files: 500
+        ==============================================
+        Markers
+        ==============================================
+        Discarded markers:
+        Monomorphic: 0
+        Not biallelic: 0
+        Modified markers:
+        Difference in variation: 0
+
+        ]]>
+
+
+ </help>
+    <citations>
+        
+     <citation type="bibtex">@article{Dereeper03062015,
+author = {Dereeper, Alexis and Homa, Felix and Andres, Gwendoline and Sempere, Guilhem and Sarah, Gautier and Hueber, Yann and Dufayard, Jean-François and Ruiz, Manuel},
+title = {SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations},
+year = {2015},
+doi = {10.1093/nar/gkv351},
+abstract ={SNiPlay is a web-based tool for detection, management and analysis of genetic variants including both single nucleotide polymorphisms (SNPs) and InDels. Version 3 now extends functionalities in order to easily manage and exploit SNPs derived from next generation sequencing technologies, such as GBS (genotyping by sequencing), WGRS (whole gre-sequencing) and RNA-Seq technologies. Based on the standard VCF (variant call format) format, the application offers an intuitive interface for filtering and comparing polymorphisms using user-defined sets of individuals and then establishing a reliable genotyping data matrix for further analyses. Namely, in addition to the various scaled-up analyses allowed by the application (genomic annotation of SNP, diversity analysis, haplotype reconstruction and network, linkage disequilibrium), SNiPlay3 proposes new modules for GWAS (genome-wide association studies), population stratification, distance tree analysis and visualization of SNP density. Additionally, we developed a suite of Galaxy wrappers for each step of the SNiPlay3 process, so that the complete pipeline can also be deployed on a Galaxy instance using the Galaxy ToolShed procedure and then be computed as a Galaxy workflow. SNiPlay is accessible at http://sniplay.southgreen.fr.},
+URL = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.abstract},
+eprint = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.full.pdf+html},
+journal = {Nucleic Acids Research}
+}
+
+     </citation>
+
+    </citations>
+</tool>

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/CalculateDiversityIndexes.pl
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/CalculateDiversityIndexes.pl Fri Jul 10 04:39:30 2015 -0400

[

@@ -0,0 +1,81 @@
+#!/usr/bin/perl
+
+use strict;
+use Switch;
+use Getopt::Long;
+use Bio::SeqIO;
+
+
+my $usage = qq~Usage:$0 <args> [<opts>]
+where <args> are:
+    -i, --input         <FASTA input>
+    -o, --output        <output filename>
+    -d, --directory     <directory of egglib package>
+~;
+$usage .= "\n";
+
+my ($infile,$outfile,$dir_exe);
+
+
+GetOptions(
+ "input=s"    => \$infile,
+ "output=s"   => \$outfile,
+ "directory=s"=> \$dir_exe
+);
+
+
+die $usage
+  if ( !$infile || !$outfile || !$dir_exe);
+
+
+my $EGGSTATS_EXE = "$dir_exe/egglib-2.1.5/bin/eggstats";
+
+my %gene_alignments;
+my $in  = Bio::SeqIO->new(-file => $infile , '-format' => 'Fasta');
+while ( my $seq = $in->next_seq() )
+{
+ my $id = $seq -> id();
+ my $sequence = $seq -> seq();
+ my ($gene,$ind,$num_allele) = split("_",$id);
+ $gene_alignments{$gene}.= ">$id\n$sequence\n";
+}
+
+open(OUT,">$outfile");
+foreach my $gene(keys(%gene_alignments))
+{
+ open(F,">$gene.egglib_input.fa");
+ print F $gene_alignments{$gene};
+ close(F);
+
+ my $results_egglib = `$EGGSTATS_EXE $gene.egglib_input.fa`;
+
+ # parse Seqlib output
+ if ($results_egglib)
+ {
+ my %egglig_stats;
+ my @eggstats = split(/^/,$results_egglib);
+ foreach my $eggstat(@eggstats)
+ {
+ my ($desc,$value) = split(/: /,$eggstat);
+ chomp($value);
+ $egglig_stats{$desc} = $value;
+ }
+ print OUT "$gene;";
+ print OUT $egglig_stats{"Total number of sequences"} . ";";
+ print OUT $egglig_stats{"Total number of sites"} . ";";
+ print OUT $egglig_stats{"Number of analyzed sites"} . ";";
+ print OUT $egglig_stats{"S"} . ";";
+ print OUT $egglig_stats{"thetaW"} . ";";
+ print OUT $egglig_stats{"Pi"} . ";";
+ print OUT $egglig_stats{"D"} . ";";
+ print OUT $egglig_stats{"number of haplotypes"} . ";";
+ print OUT $egglig_stats{"haplotypes diversity"} . ";";
+ print OUT $egglig_stats{"Fay and Wu H"} . ";";
+ print OUT $egglig_stats{"Fst"} . ";";
+ print OUT $egglig_stats{"Snn"} . ";";
+ print OUT "\n";
+ unlink("$gene.egglib_input.fa");
+ }
+}
+close(OUT);
+

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/CalculateDiversityIndexes.sh
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/CalculateDiversityIndexes.sh Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,11 @@
+#!/bin/bash
+input=$1
+output=$2
+log=$3
+
+directory=`dirname $0`
+
+perl $directory/CalculateDiversityIndexes.pl -i $input -o $output -d $directory >>$log 2>&1
+
+
+

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/CalculateDiversityIndexes.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/CalculateDiversityIndexes.xml Fri Jul 10 04:39:30 2015 -0400

[

@@ -0,0 +1,175 @@
+<tool id="calculate_diversity" name="Diversity by gene" version="2.1.6">
+ <description>calculates various diversity indexes with EggLib.</description>
+ <command interpreter="bash">./CalculateDiversityIndexes.sh $input $output $log
+    </command>
+ <inputs>
+ <param format="fasta" name="input" type="data" label="Fasta alignment" help="..."/>
+ </inputs>
+ <outputs>
+ <data format="txt" name="output" label="Diversity"/>
+ <data format="txt" name="log" label="Logfile"/>
+ </outputs>
+    
+    <stdio>
+        
+        <exit_code range="1:" level="fatal" />
+    </stdio>
+
+    
+    <tests>
+        
+        
+
+    </tests>
+ <help>
+
+
+
+.. class:: infomark
+
+**Authors** EggLib_
+
+.. _EggLib: http://egglib.sourceforge.net/
+
+  | "EggLib: processing, analysis and simulation tools for population genetics and genomics.", **De Mita S. and M. Siol.**, BMC Genet. 2012. 13:27.
+
+.. class:: infomark
+
+**Galaxy integration** South Green.
+
+.. class:: infomark
+
+**Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1).
+
+---------------------------------------------------
+
+
+
+==================
+Diversity by genes
+==================
+
+-----------
+Description
+-----------
+
+  | Provides various diversity indexes using EggLib library.
+  | For further informations, please visite the EggLib website_.
+
+.. _website: http://egglib.sourceforge.net/
+
+
+-----------------
+Workflow position
+-----------------
+
+**Upstream tool**
+
+=============== ====================== ===========
+Name            output file(s)         format
+=============== ====================== ===========
+VCF to Hapmap   Fasta alignment        fasta
+=============== ====================== ===========
+
+
+
+----------
+Input file
+----------
+
+Fasta file
+ Fasta alignment
+
+
+
+------------
+Output files
+------------
+
+Diversity
+
+Log file
+
+
+------------
+Dependencies
+------------
+EggLib
+ version 2.1.5
+
+---------------------------------------------------
+
+---------------
+Working example
+---------------
+
+Input files
+===========
+
+Fasta file
+----------
+
+::
+
+ >LOCOs11g09160_AZUCENA_1
+ ATGTGGCGGGCGAGGCGGTGGCCGTGGCCGTGGCGGTCGCAGCGGCGCGCGGCGAGGATGCTCTCGTCGGGTGAGCCAGCGGCGGGGCGGCGGAGGGTGGCGGCGCTGTGGGGGAACGGGGA
+ CTACGGGCGGCTGGGGATGGGGGCGCTGGAGTCGCGGTGGAGCCCCACGGCGTGCCCCTTCTTCCTCACCGGCCGCCCCGGCGACGACGACGACGACCCGCCCGCCTCCCTCGCCTGCGGCG
+ GCGCCCACACCCTCTTCCTCACCGGTACTCCTGAATTGAAATCGCCTGCTTGTGTAATTACTCGAGCGAGAGAGAGATTGTGTTGAATCGAGATTAATGTGGGAGTATGTGATTTTTGGCCT
+ GCTGGTTTTGCTCAGAGAGCGGGCGCGTGTTCGCCGCGGGTCTCAACGACTTCGGGCAGCTCGGGATAGGCTCCTCCGTGACTCATTCCCTGGTACTGAGCTTCTTGTACATCATGCCTCCA
+ TGTGAAATTTTCATCTACATTGTGAGCCAGCCTACTTTTACACAGTAAGCGAAAGCTGGCTGGACATATCAGAGTTGCAATGGGGATTGACCAAATCAATTCTGACTCCTGTTACATGTTGC
+ >LOCOs11g09160_AZUCENA_2
+ ATGAGGCGGGCGAGGCGGTGGCCGTGGCCGTGGCGGTCGCAGCGGCGAGCGGCGAGGATGCTCTCGTCGGGTGAGCCAGCGGCGGGGCGGCGGAGGGTGGCGGCGCTGTGGGGGAACGGGGA
+ CTACGGGCGGCTGGGGATGGGGGCGCTGGAGTCGCGGTGGAGCCCCACGGCGTGCCCCTTCTTCCTCACCGGCCGCCCCGGCGACGACGACGACGACCCGCCCGCCTCCCTCGCCTGCGGCG
+ GCGCCCACACCCTCTTCCTCACCGGTACTCCTGAATTGAAATCGCCAGCTTGTGTAATTACTCGAGCGAGAGAGAGATTGTGTTGAATCGAGATTAATGTGGGAGTATGTGATTTTTGGCCT
+ GCTGGTTTTGCTCAGAGAGCGGGCGCGTGTTCGCCGCGGGTCTCAACGACTTCGGGCAGCTCGGGATAGGCTCCTCCGTGACTCATTCCCTGGTACTGAGCTTCTTGTACATCATGCCTCCA
+ TGTGAAATTTTCATCTACATTGTGAGCCAGCCTACTTTTACACAGTAAGCGAAAGCTGGCTGGACATATCAGAGTTGCAATGGGGATTGACCAAATCAATTCTGACTCCTGTTACATGTTGC
+ >LOCOs11g09160_BULUPANDAK_1
+ ATGTGGCGGGCGAGGCGGTGGCCGTGGCCGTGGCGGTCGCAGCGGCGCGCGGCGAGGATGCTCTCGTCGGGTGAGCCAGCGGCGGGGCGGCGGAGGGTGGCGGCGCTGTGGGGGAACGGGGA
+ CTACGGGCGGCTGGGGATGGGGGCGCTGGAGTCGCGGTGGAGCCCCACGGCGTGCCCCTTCTTCCTCACCGGCCGCCCCGGCGACGACGACGACGACCCGCCCGCCTCCCTCGCCTGCGGCG
+ GCGCCCACACCCTCTTCCTCACCGGTACTCCTGAATTGAAATCGCCTGCTTGTGTAATTACTCGAGCGAGAGAGAGATTGTGTTGAATCGAGATTAATGTGGGAGTATGTGATTTTTGGCCT
+ GCTGGTTTTGCTCAGAGAGCGGGCGCGTGTTCGCCGCGGGTCTCAACGACTTCGGGCAGCTCGGGATAGGCTCCTCCGTGACTCATTCCCTGGTACTGAGCTTCTTGTACATCATGCCTCCA
+ TGTGAAATTTTCATCTACATTGTGAGCCAGCCTACTTTTACACAGTAAGCGAAAGCTGGCTGGACATATCAGAGTTGCAATGGGGATTGACCAAATCAATTCTGACTCCTGTTACATGTTGC
+ >LOCOs11g09160_BULUPANDAK_2
+ ATGAGGCGGGCGAGGCGGTGGCCGTGGCCGTGGCGGTCGCAGCGGCGAGCGGCGAGGATGCTCTCGTCGGGTGAGCCAGCGGCGGGGCGGCGGAGGGTGGCGGCGCTGTGGGGGAACGGGGA
+ CTACGGGCGGCTGGGGATGGGGGCGCTGGAGTCGCGGTGGAGCCCCACGGCGTGCCCCTTCTTCCTCACCGGCCGCCCCGGCGACGACGACGACGACCCGCCCGCCTCCCTCGCCTGCGGCG
+ GCGCCCACACCCTCTTCCTCACCGGTACTCCTGAATTGAAATCGCCAGCTTGTGTAATTACTCGAGCGAGAGAGAGATTGTGTTGAATCGAGATTAATGTGGGAGTATGTGATTTTTGGCCT
+ GCTGGTTTTGCTCAGAGAGCGGGCGCGTGTTCGCCGCGGGTCTCAACGACTTCGGGCAGCTCGGGATAGGCTCCTCCGTGACTCATTCCCTGGTACTGAGCTTCTTGTACATCATGCCTCCA
+ TGTGAAATTTTCATCTACATTGTGAGCCAGCCTACTTTTACACAGTAAGCGAAAGCTGGCTGGACATATCAGAGTTGCAATGGGGATTGACCAAATCAATTCTGACTCCTGTTACATGTTGC
+ >LOCOs07g23169_AZUCENA_1
+ ACTAGTGAAGTGTTGCCCGTTGGGTTTGGTGGAGTTTGAAGAGCTCTGTCGCCGTCTTCACTCCTCGCAGTCAGACGGGAGTGGACTACTGGAGGGAGAGAGAGGGTGAGCGAGGTGTGGGA
+ GCTGGTTTTGCTCAGAGAGCGGGCGCGTGTTCGCCGCGGGTCTCAACGACTTCGGGCAGCTCGGGATAGGCTCCTCCGTGACTCATTCCCTGGTACTGAGCTTCTTGTACATCATGCCTCCA
+ TGTGAAATTTTCATCTACATTGTGAGCCAGCCTACTTTTACACAGTAAGCGAAAGCTGGCTGGACATATCAGAGTTGCAATGGGGATTGACCAAATCAATTCTGACTCCTGTTACATGTTGC
+
+Output files
+============
+
+Diversity
+---------
+
+::
+
+ LOCOs07g23169;8;10494;10494;2;7.35039e-05;8.16793e-05;0.414213;2;0.428571;0.857143;0;1;
+ LOCOs11g09160;8;6577;6577;2;0.00011728;0.000130324;0.414213;2;0.428571;0.857143;0;1;
+
+
+ </help>
+    <citations>
+        
+     <citation type="bibtex">@article{Dereeper03062015,
+author = {Dereeper, Alexis and Homa, Felix and Andres, Gwendoline and Sempere, Guilhem and Sarah, Gautier and Hueber, Yann and Dufayard, Jean-François and Ruiz, Manuel},
+title = {SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations},
+year = {2015},
+doi = {10.1093/nar/gkv351},
+abstract ={SNiPlay is a web-based tool for detection, management and analysis of genetic variants including both single nucleotide polymorphisms (SNPs) and InDels. Version 3 now extends functionalities in order to easily manage and exploit SNPs derived from next generation sequencing technologies, such as GBS (genotyping by sequencing), WGRS (whole gre-sequencing) and RNA-Seq technologies. Based on the standard VCF (variant call format) format, the application offers an intuitive interface for filtering and comparing polymorphisms using user-defined sets of individuals and then establishing a reliable genotyping data matrix for further analyses. Namely, in addition to the various scaled-up analyses allowed by the application (genomic annotation of SNP, diversity analysis, haplotype reconstruction and network, linkage disequilibrium), SNiPlay3 proposes new modules for GWAS (genome-wide association studies), population stratification, distance tree analysis and visualization of SNP density. Additionally, we developed a suite of Galaxy wrappers for each step of the SNiPlay3 process, so that the complete pipeline can also be deployed on a Galaxy instance using the Galaxy ToolShed procedure and then be computed as a Galaxy workflow. SNiPlay is accessible at http://sniplay.southgreen.fr.},
+URL = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.abstract},
+eprint = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.full.pdf+html},
+journal = {Nucleic Acids Research}
+}
+
+     </citation>
+
+    </citations>
+</tool>

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/bin/eggstats

Binary file egglib/egglib-2.1.5/bin/eggstats has changed

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/Align.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/Align.hpp Fri Jul 10 04:39:30 2015 -0400

[

b'@@ -0,0 +1,378 @@\n+/*\r\n+ Copyright 2008-2009 St\xc3\xa9phane De Mita, Mathieu Siol\r\n+\r\n+ This file is part of the EggLib library.\r\n+\r\n+ EggLib is free software: you can redistribute it and/or modify\r\n+ it under the terms of the GNU General Public License as published by\r\n+ the Free Software Foundation, either version 3 of the License, or\r\n+ (at your option) any later version.\r\n+\r\n+ EggLib is distributed in the hope that it will be useful,\r\n+ but WITHOUT ANY WARRANTY; without even the implied warranty of\r\n+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\r\n+ GNU General Public License for more details.\r\n+\r\n+ You should have received a copy of the GNU General Public License\r\n+ along with EggLib. If not, see <http://www.gnu.org/licenses/>.\r\n+*/\r\n+\r\n+\r\n+#ifndef EGGLIB_ALIGN_HPP\r\n+#define EGGLIB_ALIGN_HPP\r\n+\r\n+#include "Container.hpp"\r\n+#include "CharMatrix.hpp"\r\n+#include <vector>\r\n+\r\n+/** \\mainpage Summary\r\n+ * \r\n+ * This is the automatically-generated reference manual of the C++\r\n+ * egglib-cpp library. The library is presented as several modules, but\r\n+ * note that they are only used to structure the documentation.\r\n+ * \r\n+ * There is a single namespace (egglib) in which all classes are\r\n+ * defined. See an example of programming with egglib-cpp in the\r\n+ * EggLib package main documentation. Use "Modules" or "Classes" above\r\n+ * to navigate in the library reference manual.\r\n+ * \r\n+ */\r\n+\r\n+\r\n+/** \\defgroup core core\r\n+ *\r\n+ * \\brief Central core of the C++ library of Egglib\r\n+ *\r\n+ * Data storage classes, parsers/formatters and tools, plus exception\r\n+ * types.\r\n+ * \r\n+ */\r\n+\r\n+namespace egglib {\r\n+\r\n+\r\n+ /** \\brief Handles a sequence alignment\r\n+ *\r\n+ * \\ingroup core\r\n+ * \r\n+ * Creation from a file or string stream should be performed using\r\n+ * the class Fasta. Align objects can be created by deep copy from\r\n+ * both Align and Container type. In the latter case, the length are\r\n+ * artificially equalized by "?" characters. Align objects can be\r\n+ * created from a DataMatrix object (and all the way arround) using\r\n+ * the specific class DMAConverter.\r\n+ *\r\n+ * Sequences are represented by two strings (name and sequence) and\r\n+ * an integer (group) that can be accessed or modified by index.The\r\n+ * order of sequences is guaranteed to be conserved, as if Align was\r\n+ * a list of triplets (name, sequence, group).\r\n+ *\r\n+ * The data matrix is implemented as continuous array (char**) and\r\n+ * allows efficient access and modification of data. For very large\r\n+ * data matrices you might claim immediately the required memory\r\n+ * using the constructor Align(unsigned int, char**).\r\n+ * \r\n+ */\r\n+ class Align : public Container, public CharMatrix {\r\n+ public:\r\n+ \r\n+ /** \\brief Creates an empty alignment\r\n+ * \r\n+ */\r\n+ Align();\r\n+\r\n+\r\n+ /** \\brief Creates an alignment from a data matrix.\r\n+ * \r\n+ * Allows you to create an object from data stored in a char*\r\n+ * array. The array\'s dimensions must be passed to the\r\n+ * constructor, and as a result there is not need to\r\n+ * terminate each sequence by a NULL character.\r\n+ * \r\n+ * \\param number_of_sequences the number of sequences (the\r\n+ * length of the first dimension of the array).\r\n+ * \r\n+ * \\param alignment_length the length of sequences (the\r\n+ * length of all lines of the array).\r\n+ * \r\n+ * \\param cstring_array the pointer to the data matrix.\r\n+ * \r\n+ */\r\n+ Align(unsigned int number_of_sequences, unsigned int alignment_length, char const * const * const cstring_array);\r\n+\r\n+\r\n+ /** \\brief Creates an alignment with given dimensions\r\n+ * \r\n+ * Allows you to allocate directly a data matrix of a given\r\n+ '..b'm position the position in the alignment (column).\r\n+ * \\param ch the new character value.\r\n+ */\r\n+ virtual void set(unsigned int sequence, unsigned position, char ch);\r\n+\r\n+\r\n+ /** \\brief Reverse a given column in binary data\r\n+ *\r\n+ * The specified column must contain only "0" ans "1" characters.\r\n+ * "0" is replaced by "1" and all the way around\r\n+ * \r\n+ */\r\n+ void binSwitch(unsigned int pos);\r\n+\r\n+\r\n+ /** \\brief Extracts specified positions (columns) of the alignment\r\n+ *\r\n+ * All the specified sites are extracted in the specified\r\n+ * order. This function is suitable for bootstrap (resample\r\n+ * allowing redrawing the same site) and permutations.\r\n+ * \r\n+ * This function doesn\'t perform out-of-bound checking.\r\n+ * \r\n+ * \\param list_of_sites a vector containing alignment\r\n+ * positions.\r\n+ * \r\n+ * \\return A copy of the object containing the specified\r\n+ * set of positions.\r\n+ * \r\n+ */\r\n+ Align vslice(std::vector<unsigned int> list_of_sites);\r\n+\r\n+\r\n+ /** \\brief Extracts a range of positions (columns)\r\n+ * \r\n+ * \\param a the first position.\r\n+ * \r\n+ * \\param b the index immediately passed the last sequence to\r\n+ * extract.\r\n+ * \r\n+ * \\return A copy of the object containing the specified\r\n+ * range of sequences.\r\n+ * \r\n+ * Positions a to b-1 are extracted, provided that the\r\n+ * indices fit in the current length of sequences. To extract\r\n+ * all sequences, use align.vslice(0, align.ls()).\r\n+ * \r\n+ * Note: invalid ranges will be silently supported. If\r\n+ * a>=ls or b<=a, an empty object is returned. If b>ns,\r\n+ * ls will be substituted to a.\r\n+ */\r\n+ Align vslice(unsigned int a, unsigned int b);\r\n+\r\n+\r\n+ /** \\brief Deletes all the content of the object\r\n+ * \r\n+ */\r\n+ virtual void clear();\r\n+\r\n+\r\n+ /** \\brief Same as ns()\r\n+ * \r\n+ */\r\n+ inline unsigned int numberOfSequences() const {\r\n+ return _ns;\r\n+ }\r\n+\r\n+\r\n+ /** \\brief Same as ls()\r\n+ * \r\n+ */\r\n+ inline unsigned int numberOfSites() const {\r\n+ return _ls;\r\n+ }\r\n+\r\n+\r\n+ /** \\brief Gets a group label (insecure)\r\n+ * \r\n+ */\r\n+ inline unsigned int populationLabel(unsigned int sequenceIndex) const {\r\n+ return groups[sequenceIndex];\r\n+ }\r\n+ \r\n+ \r\n+ /** \\brief Just return the passed value\r\n+ *\r\n+ */\r\n+ inline double sitePosition(unsigned int position) const {\r\n+ return (double) position;\r\n+ }\r\n+\r\n+\r\n+ protected:\r\n+ \r\n+ /// This function is not available for alignments\r\n+ virtual void appendSequence(unsigned int pos, const char* sequence) {}\r\n+\r\n+ // Initializer (creates a valid empty alignment)\r\n+ virtual void init();\r\n+ \r\n+ // Makes a deep copy of the specified data matrix - if cstring_array is NULL, then ignores it and pads with ?\'s\r\n+ virtual void setFromSource(unsigned int number_of_sequences, unsigned int alignment_length, const char* const * const cstring_array);\r\n+\r\n+ // Copies from a Container\r\n+ virtual void copyObject(const Container&);\r\n+ \r\n+ // Copies from an Align\r\n+ virtual void copyObject(const Align&);\r\n+ \r\n+ // Alignment length\r\n+ unsigned int _ls;\r\n+ };\r\n+}\r\n+\r\n+#endif\r\n'

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/Arg.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/Arg.hpp Fri Jul 10 04:39:30 2015 -0400

[

b'@@ -0,0 +1,300 @@\n+/*\r\n+ Copyright 2009-2010 St\xe9phane De Mita, Mathieu Siol\r\n+\r\n+ This file is part of the EggLib library.\r\n+\r\n+ EggLib is free software: you can redistribute it and/or modify\r\n+ it under the terms of the GNU General Public License as published by\r\n+ the Free Software Foundation, either version 3 of the License, or\r\n+ (at your option) any later version.\r\n+\r\n+ EggLib is distributed in the hope that it will be useful,\r\n+ but WITHOUT ANY WARRANTY; without even the implied warranty of\r\n+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\r\n+ GNU General Public License for more details.\r\n+\r\n+ You should have received a copy of the GNU General Public License\r\n+ along with EggLib. If not, see <http://www.gnu.org/licenses/>.\r\n+*/\r\n+\r\n+\r\n+#ifndef EGGLIB_ARG_HPP\r\n+#define EGGLIB_ARG_HPP\r\n+\r\n+\r\n+#include "Current.hpp"\r\n+#include "Edge.hpp"\r\n+#include <string>\r\n+\r\n+\r\n+/** \\defgroup coalesce coalesce\r\n+ *\r\n+ * \\brief Coalescent simulator\r\n+ *\r\n+ * The set of classes implements a three-scale coalescent simulator with\r\n+ * recombination, and a flexible mutation model. The main classes are\r\n+ * Controller (the starting point for generating genealogies), ParamSet\r\n+ * (that centralizes parameter specification), the Change hierarchy\r\n+ * (that implements demographic change specifications), Arg (ancestral\r\n+ * recombination graph; the result of generation a genealogy) and\r\n+ * Mutator (that generates genotype data from an ARG).\r\n+ * \r\n+ */\r\n+\r\n+\r\n+namespace egglib {\r\n+ \r\n+ class Random;\r\n+\r\n+ /** \\brief Ancestral recombination graph\r\n+ *\r\n+ * \\ingroup coalesce\r\n+ * \r\n+ * This class stores the ARG (genealogical information). It is\r\n+ * progressively built by appropriate (especially regarding to the\r\n+ * timing) calls to coal() and recomb() methods. Then it can be\r\n+ * used by a mutator class to generates data, or it can also\r\n+ * generate newick trees (one tree by non-recombining segment).\r\n+ *\r\n+ */\r\n+ class Arg {\r\n+\r\n+ public:\r\n+ \r\n+ /** \\brief Default constructor\r\n+ *\r\n+ * Creates a null, useless, object.\r\n+ *\r\n+ */\r\n+ Arg();\r\n+\r\n+ \r\n+ /** \\brief Object initialization\r\n+ * \r\n+ * \\param current address of the Current instance used by\r\n+ * the simulator.\r\n+ * \r\n+ * \\param numberOfSegments number of recombining segments.\r\n+ * \r\n+ */\r\n+ void set(Current* current, unsigned int numberOfSegments);\r\n+\r\n+ \r\n+ /** \\brief Object reset method\r\n+ * \r\n+ * This method doesn\'t reset all parameters (the number of\r\n+ * segments and associated tables are retained, as well as\r\n+ * the Edge object pool).\r\n+ * \r\n+ * \\param current address of the Current instance used by\r\n+ * the simulator.\r\n+ * \r\n+ */\r\n+ void reset(Current* current);\r\n+\r\n+\r\n+ /** \\brief Standard constructor\r\n+ * \r\n+ * \\param current address of the Current instance used by\r\n+ * the simulator.\r\n+ * \r\n+ * \\param numberOfSegments number of recombining segments\r\n+ *\r\n+ */\r\n+ Arg(Current* current, unsigned int numberOfSegments);\r\n+\r\n+ \r\n+ /** \\brief Destructor\r\n+ * \r\n+ * Clears all Edge instances referenced in the object.\r\n+ * \r\n+ */\r\n+ virtual ~Arg();\r\n+ \r\n+\r\n+ /** \\brief Gets the current value of the time counter\r\n+ * \r\n+ */ \r\n+ double time() const;\r\n+ \r\n+\r\n+ /** \\brief Increments the time counter\r\n+ * \r\n+ */\r\n+ void addTime(double increment);\r\n+ \r\n+\r\n+ /** \\brief Performs a coalescence ev'..b'\n+ * \r\n+ * The uMRCA is the ultimate Most Recent Common Ancestor,\r\n+ * that is the point where the last segment finds its most\r\n+ * recent common ancestor. This member will have a meaningful\r\n+ * value only if the coalescent process is completed.\r\n+ * \r\n+ */\r\n+ inline double ageUltimateMRCA() const {\r\n+ return _time;\r\n+ }\r\n+ \r\n+\r\n+ /** \\brief Age of the MRCA for a given segment\r\n+ * \r\n+ * The MRCA is the Most Recent Common Ancestor, that is the\r\n+ * point where the coalescent process is over (all lineages\r\n+ * have coalesced). This member will have a meaningful\r\n+ * value only if the coalescent process is completed.\r\n+ * \r\n+ * Note that the value is cached; it is computed only one\r\n+ * upon first call and no again, even if the Arg is modified<\r\n+ * \r\n+ */\r\n+ inline double ageMRCA(unsigned int segmentIndex) {\r\n+ return _MRCA[segmentIndex]->bottom;\r\n+ }\r\n+\r\n+ /** \\brief MRCA for each segment\r\n+ * \r\n+ * The MRCA is the Most Recent Common Ancestor, that is the\r\n+ * point where the coalescent process is over (all lineages\r\n+ * have coalesced). This member will have a meaningful\r\n+ * value only if the coalescent process is completed.\r\n+ * \r\n+ * Note that the value is cached; it is computed only one\r\n+ * upon first call and no again, even if the Arg is modified\r\n+ * \r\n+ */\r\n+ inline const Edge* MRCA(unsigned int segmentIndex) {\r\n+ return _MRCA[segmentIndex];\r\n+ }\r\n+\r\n+ /// Ultimate MRCA\r\n+ \r\n+ inline const Edge* uMRCA() {\r\n+ return edges[numberOfEdges-1];\r\n+ }\r\n+ \r\n+ \r\n+ /// the number of recombining segments\r\n+ unsigned int numberOfSegments;\r\n+\r\n+ /** \\brief Formats the newick-formatted tree for a segment\r\n+ * \r\n+ */\r\n+ std::string newick(unsigned int segment);\r\n+ \r\n+\r\n+ /// Number of initial lineages\r\n+ unsigned int numberOfSamples;\r\n+\r\n+\r\n+ /** \\brief Total tree length (summed over all segments)\r\n+ * \r\n+ */\r\n+ double totalLength;\r\n+\r\n+ /** \\brief Segment-specific tree length\r\n+ * \r\n+ */\r\n+ double* segmentLengths;\r\n+\r\n+ /// Current number of Edges in the tree (including the MRCA node)\r\n+ unsigned int numberOfEdges;\r\n+\r\n+ /// Total number of recombination events that occurred\r\n+ unsigned int numberOfRecombinationEvents;\r\n+ \r\n+ /// Set the number of actual sites in all branches\r\n+ void set_actualNumberOfSites(unsigned int actualNumberOfSites);\r\n+ \r\n+ \r\n+ private:\r\n+ \r\n+ /// Copy constructor not available\r\n+ Arg(const Arg&) { }\r\n+ \r\n+ /// Assignment operator not available\r\n+ Arg& operator=(const Arg&) { return *this; }\r\n+\r\n+ void init_stable_parameters();\r\n+ void init_variable_parameters();\r\n+ void clear();\r\n+ void addEdge(Edge*);\r\n+ std::string rnewick(Edge* edge, unsigned int segment, double cache);\r\n+\r\n+ Current* current;\r\n+ double _time;\r\n+ Edge** edges;\r\n+ \r\n+ void findMRCA(unsigned int segmentIndex);\r\n+ void computeTotalLength();\r\n+ void computeSegmentLength(unsigned int segmentIndex);\r\n+\r\n+ unsigned int* numberOfEdgesPerSegment;\r\n+ Edge** _MRCA;\r\n+ \r\n+ EdgePool edgePool;\r\n+ };\r\n+\r\n+}\r\n+\r\n+#endif\r\n'

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/BaseDiversity.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/BaseDiversity.hpp Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,169 @@
+/*
+    Copyright 2009 St�phane De Mita, Mathieu Siol
+
+    This file is part of the EggLib library.
+
+    EggLib is free software: you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation, either version 3 of the License, or
+    (at your option) any later version.
+
+    EggLib is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with EggLib.  If not, see <http://www.gnu.org/licenses/>.
+*/
+
+#ifndef EGGLIB_BASEDIVERSITY_HPP
+#define EGGLIB_BASEDIVERSITY_HPP
+
+#include "CharMatrix.hpp"
+#include "SitePolymorphism.hpp"
+#include <string>
+
+/** \defgroup polymorphism polymorphism
+ *
+ * \brief Diversity analyses
+ *
+ * Two classes are contained in this module: NucleotideDiversity, that
+ * performs site-centered polymorphism analyses, and HaplotypeDiversity,
+ * that performs haplotype-centered analyses. The detection of
+ * polymorphic sites is common to both, through the base class
+ * BaseDiversity. However this phase must be repeated when stats from
+ * the two classes are needed. To reduce the computational burden, the
+ * function reserve() can be use, that directly allocates needed memory
+ * when the eventual number of polymorphic sites is known prior to
+ * analysis (even if not precisely). For both classes, a set of
+ * statistics are computed immediately upon load of a data set. For
+ * NucleotideDiversity, additional statistics are computed per group
+ * upon use of the corresponding accessors. This number of operations
+ * performed several times is strictly limited. This is particularly
+ * useful when different statistics are needed for a given alignment.
+ * However, this system allows not computing unnecessary statistics to
+ * a certain extend.
+ *
+ */
+
+namespace egglib {
+
+    /** \brief Base class of diversity classes
+    *
+    * Mutualizes the analysis of polymorphic sites through the method
+    * importSites() and related accessors.
+    *
+    * \ingroup polymorphism
+    *
+    */
+    class BaseDiversity {
+
+        public:
+
+           /** \brief Constructor
+            *
+            */
+            BaseDiversity();
+
+           /** \brief Destructor
+            *
+            */
+            virtual ~BaseDiversity();
+
+           /** \brief Reserve sufficient memory for a given number of
+            * polymorphic sites.
+            *
+            * This method makes importSite function faster when you
+            * already know how many polymorphic sites to expect, since
+            * the necessary memory will be allocated prior the screening
+            * of data. It is possible to use reserve() even if with a
+            * number of sites that is not matching what importSites()
+            * will find.
+            *
+            * \param numberOfSites a strictly positive integer.
+            *
+            */
+            virtual void reserve(unsigned int numberOfSites);
+
+            /// Gets a site
+            const SitePolymorphism* get_site(unsigned int index) const;
+
+            /// Gets a site position
+            unsigned int get_position(unsigned int index) const;
+
+           /** \brief Predefined mapping string for DNA data
+            *
+            */
+            static const std::string dnaMapping;
+
+
+           /** \brief Predefined mapping string for RNA data
+            *
+            */
+            static const std::string rnaMapping;
+
+
+           /** \brief Predefined mapping string for amino acid data
+            *
+            */
+            static const std::string aaMapping;
+
+
+            /// Clears and re-initializes object
+            virtual void reset();
+
+
+        protected:
+
+            virtual void init();
+            virtual void clear();
+
+            //
+            void importSites(CharMatrix& data, bool allowMultipleMutations,
+                double minimumExploitableData, unsigned int ignoreFrequency,
+                std::string characterMapping, bool useZeroAsAncestral,
+                bool ignoreOutgroup);
+
+            //
+            void analyzeSite(CharMatrix& data, unsigned int index, double maxMissingData, bool ignoreOutgroup); // analyzes a site, adds a Site to the Site container if the site is polymorphic
+            unsigned int getPopIndex(unsigned int label) const;  // returns v_npop if not found
+
+            SitePolymorphism** v_sites;  // holder of polymorphic site addresses
+            bool* v_orientables;         // stores whether the sites are orientable or not
+            unsigned int* v_sitePositions;   // stores position of sites
+
+            unsigned int  v_reserved;
+            unsigned int  v_ns;       // maximum number of sequences analyzed (max of sites' ns)
+            unsigned int  v_S;        // number of polymorphic sites
+            unsigned int  v_So;       // number of orientable sites
+            unsigned int  v_eta;      // number of mutation (whatever multiple)
+            double        v_nseff;    // average number of analyzed sequence
+            unsigned int  v_lseff;    // number of analyzed sites
+            double        v_nseffo;   // average number of analyzed sequences for analyzes with outgroup
+            unsigned int  v_lseffo;   // number of analyzed sites for analyzes with outgroup
+            unsigned int  v_npop;     // number of populations
+            unsigned int *v_popLabel; // label of each pop
+
+            // options
+            bool          p_allowMultipleMutations;
+            double        p_minimumExploitableData;
+            std::string   p_characterMapping;
+            unsigned int  p_pos_sep_mapping;
+            bool          p_useZeroAsAncestral;
+            unsigned int  p_ignoreFrequency;
+
+
+
+        private:
+
+            BaseDiversity(const BaseDiversity& source) { }
+
+            BaseDiversity& operator=(const BaseDiversity& source) {
+                return *this;
+            }
+
+    };
+}
+
+#endif

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/ChangeTypes.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/ChangeTypes.hpp Fri Jul 10 04:39:30 2015 -0400

b'@@ -0,0 +1,428 @@\n+/*\r\n+ Copyright 2009-2010 St\xe9phane De Mita, Mathieu Siol\r\n+\r\n+ This file is part of the EggLib library.\r\n+\r\n+ EggLib is free software: you can redistribute it and/or modify\r\n+ it under the terms of the GNU General Public License as published by\r\n+ the Free Software Foundation, either version 3 of the License, or\r\n+ (at your option) any later version.\r\n+\r\n+ EggLib is distributed in the hope that it will be useful,\r\n+ but WITHOUT ANY WARRANTY; without even the implied warranty of\r\n+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\r\n+ GNU General Public License for more details.\r\n+\r\n+ You should have received a copy of the GNU General Public License\r\n+ along with EggLib. If not, see <http://www.gnu.org/licenses/>.\r\n+*/\r\n+\r\n+#ifndef EGGLIB_CHANGETYPES_HPP\r\n+#define EGGLIB_CHANGETYPES_HPP\r\n+\r\n+#include "ParamSet.hpp"\r\n+#include "Controller.hpp"\r\n+\r\n+namespace egglib {\r\n+\r\n+/**********************************************************************/\r\n+\r\n+ /** \\brief Pure virtual base class for parameter changes\r\n+ *\r\n+ * \\ingroup coalesce\r\n+ *\r\n+ */\r\n+ class Change {\r\n+ public:\r\n+ \r\n+ /** \\brief Default constructor\r\n+ *\r\n+ * The default date is 0.\r\n+ *\r\n+ */\r\n+ Change();\r\n+ \r\n+ /** \\brief Standard constructor\r\n+ *\r\n+ * \\param date the event date.\r\n+ *\r\n+ */\r\n+ Change(double date);\r\n+\r\n+ /// Gets the event date value\r\n+ double date() const;\r\n+ \r\n+ /// Sets the event date value\r\n+ void date(double value);\r\n+ \r\n+ /** \\brief Applies the event\r\n+ *\r\n+ * \\param paramSet the ParamSet instance to which the Change\r\n+ * instance is attached.\r\n+ * \\param controller the Controller instance of the\r\n+ * simulation.\r\n+ *\r\n+ */\r\n+ virtual void apply(ParamSet* paramSet, Controller* controller) const = 0;\r\n+ \r\n+ protected:\r\n+ double _date;\r\n+ \r\n+ };\r\n+\r\n+/**********************************************************************/\r\n+\r\n+ /** \\brief Pure virtual base class for single parameter changes\r\n+ *\r\n+ * \\ingroup coalesce\r\n+ *\r\n+ */\r\n+ class SingleParamChange : public Change {\r\n+ public:\r\n+ \r\n+ /** \\brief Default constructor\r\n+ *\r\n+ * The default date is 0., the default parameter value is 0.\r\n+ *\r\n+ */\r\n+ SingleParamChange();\r\n+ \r\n+ /** \\brief Standard constructor\r\n+ *\r\n+ * \\param date the event date.\r\n+ * \\param value the parameter value.\r\n+ *\r\n+ */\r\n+ SingleParamChange(double date, double value);\r\n+\r\n+ /// Gets the parameter value\r\n+ double value() const;\r\n+ \r\n+ /// Sets the parameter value\r\n+ void value(double value);\r\n+\r\n+ protected:\r\n+ double _value;\r\n+\r\n+ };\r\n+\r\n+/**********************************************************************/\r\n+\r\n+ /** \\brief Single parameter changes applied to a single population\r\n+ *\r\n+ * \\ingroup coalesce\r\n+ *\r\n+ */\r\n+ class PopulationParamChange : public SingleParamChange {\r\n+ public:\r\n+\r\n+ /** \\brief Default constructor\r\n+ *\r\n+ * The default date is 0., the default parameter value is 0.,\r\n+ * the default population is 0\r\n+ *\r\n+ */\r\n+ PopulationParamChange();\r\n+ \r\n+ /** \\brief Standard constructor\r\n+ *\r\n+ * \\param date the event date.\r\n+ * \\param population the population index.\r\n+ * \\param value the parameter value.\r\n+ *\r\n+ */\r\n+ PopulationParamCha'..b' */\r\n+ PopulationSplit();\r\n+\r\n+ /** \\brief Standard constructor\r\n+ *\r\n+ * A the time given by date, the specified population is\r\n+ * split in two. An additional population (whose index is\r\n+ * incremented from the current total number of population)\r\n+ * is created and lineages are randomly picked and moved to\r\n+ * the new population. The parameter proba gives the\r\n+ * probability that a lineage from the population number pop\r\n+ * moves instantly to the new population. If proba is 0,\r\n+ * the program emulates the creation of an empty population\r\n+ * (thinking forward in time, this is a population\r\n+ * extinction). In general, forward in time, this is a\r\n+ * population fusion.\r\n+ * \r\n+ * \\param date the date of the event.\r\n+ * \\param pop population index.\r\n+ * \\param proba the probability that lineages move to the\r\n+ * new population.\r\n+ *\r\n+ */\r\n+ PopulationSplit(double date, unsigned int pop, double proba);\r\n+ \r\n+ void apply(ParamSet* paramSet, Controller* controller) const;\r\n+ \r\n+ /// Gets the population index\r\n+ unsigned int population() const;\r\n+ \r\n+ /// Sets the population index\r\n+ void population(unsigned int);\r\n+ \r\n+ /// Gets the probability of instant migration\r\n+ double probability() const;\r\n+\r\n+ /// Sets the probability of instant migration\r\n+ void probability(double);\r\n+ \r\n+ protected:\r\n+ unsigned int _population;\r\n+ double _probability;\r\n+ };\r\n+\r\n+/**********************************************************************/\r\n+\r\n+ /** \\brief Change of the migration rate of all population pairs\r\n+ *\r\n+ * The parameter is the new rate (applied to all population pairs)\r\n+ *\r\n+ * \\ingroup coalesce\r\n+ *\r\n+ */\r\n+ class AllMigrationRateChange : public SingleParamChange {\r\n+ public:\r\n+ AllMigrationRateChange(double date, double value) : SingleParamChange(date, value) {}\r\n+ void apply(ParamSet* paramSet, Controller* controller) const;\r\n+ };\r\n+\r\n+/**********************************************************************/\r\n+ \r\n+ /** \\brief Change of a single migration rate\r\n+ *\r\n+ * \\ingroup coalesce\r\n+ *\r\n+ */\r\n+ class SingleMigrationRateChange : public SingleParamChange {\r\n+ public:\r\n+ /** \\brief Default constructor\r\n+ *\r\n+ * The default date is 0., the default parameter value is 0.,\r\n+ * the default source population is 0, the default\r\n+ * destination population 1.\r\n+ *\r\n+ */\r\n+ SingleMigrationRateChange();\r\n+\r\n+ /** \\brief Standard constructor\r\n+ *\r\n+ * \\param date the date of the event.\r\n+ * \\param source index of the source population.\r\n+ * \\param dest index of the destination population.\r\n+ * \\param migr new value of the pairwise migration rate.\r\n+ *\r\n+ */\r\n+ SingleMigrationRateChange(double date, unsigned int source, unsigned int dest, double migr);\r\n+ \r\n+ /// Gets the source population index\r\n+ unsigned source() const;\r\n+ \r\n+ /// Sets the source population index\r\n+ void source(unsigned int);\r\n+\r\n+ /// Gets the dest population index\r\n+ unsigned dest() const;\r\n+ \r\n+ /// Sets the dest population index\r\n+ void dest(unsigned int);\r\n+\r\n+ void apply(ParamSet* paramSet, Controller* controller) const;\r\n+ \r\n+ protected:\r\n+ unsigned int _source;\r\n+ unsigned int _dest;\r\n+ };\r\n+}\r\n+\r\n+#endif\r\n'

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/CharMatrix.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/CharMatrix.hpp Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,70 @@
+/*
+    Copyright 2009 St�phane De Mita, Mathieu Siol
+
+    This file is part of the EggLib library.
+
+    EggLib is free software: you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation, either version 3 of the License, or
+    (at your option) any later version.
+
+    EggLib is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with EggLib.  If not, see <http://www.gnu.org/licenses/>.
+*/
+
+#ifndef EGGLIB_CHARMATRIX_HPP
+#define EGGLIB_CHARMATRIX_HPP
+
+
+namespace egglib {
+
+    /** \brief Interface for classes usable as a square matrix of characters
+    *
+    * \ingroup core
+    *
+    */
+    class CharMatrix {
+
+    public:
+
+        /** \brief Gets number of rows or sequences
+         *
+         */
+        virtual unsigned int numberOfSequences() const = 0;
+
+
+        /** \brief Gets number of columns or sites
+         *
+         */
+        virtual unsigned int numberOfSites() const = 0;
+
+
+        /** \brief Gets the character at a given position
+         *
+         * The accessor should be "fast" and does not guarantee to
+         * perform out-of-bounds checks
+         *
+         */
+        virtual char character(unsigned int sequence, unsigned int site) const = 0;
+
+
+       /** \brief Gets population index
+        *
+        */
+        virtual unsigned int populationLabel(unsigned int row) const = 0;
+
+
+       /** \brief Get site position
+        *
+        */
+        virtual double sitePosition(unsigned int column) const = 0;
+
+    };
+}
+
+#endif

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/Consensus.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/Consensus.hpp Fri Jul 10 04:39:30 2015 -0400

b'@@ -0,0 +1,421 @@\n+/*\r\n+ Copyright 2008-2009 St\xe9phane De Mita, Mathieu Siol\r\n+\r\n+ This file is part of the EggLib library.\r\n+\r\n+ EggLib is free software: you can redistribute it and/or modify\r\n+ it under the terms of the GNU General Public License as published by\r\n+ the Free Software Foundation, either version 3 of the License, or\r\n+ (at your option) any later version.\r\n+\r\n+ EggLib is distributed in the hope that it will be useful,\r\n+ but WITHOUT ANY WARRANTY; without even the implied warranty of\r\n+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\r\n+ GNU General Public License for more details.\r\n+\r\n+ You should have received a copy of the GNU General Public License\r\n+ along with EggLib. If not, see <http://www.gnu.org/licenses/>.\r\n+*/\r\n+\r\n+#ifndef EGGLIB_CONSENSUS_HPP\r\n+#define EGGLIB_CONSENSUS_HPP\r\n+\r\n+#include "Align.hpp"\r\n+#include <sstream>\r\n+#include <string>\r\n+#include <vector>\r\n+\r\n+namespace egglib {\r\n+\r\n+ /** \\brief Generates consensus sequences\r\n+ *\r\n+ * \\ingroup polymorphism\r\n+ * \r\n+ *\r\n+ * A consensus is generated when two sequences have the same name, \r\n+ * ignoring everything after the first separator character (by\r\n+ * default, "_"). Hence, the names "foo", "foo_goo" and "foo_third"\r\n+ * will be treated as identical and the root will be "foo". The root\r\n+ * will be used to name the resulting sequence. Note that the\r\n+ * class works only for DNA sequences.\r\n+ *\r\n+ * Symbol convention:\r\n+ * - A: adenosine\r\n+ * - C: cytosine\r\n+ * - G: guanine\r\n+ * - T: thymine\r\n+ * - M: A or C\r\n+ * - R: A or G\r\n+ * - W: A or T (weak)\r\n+ * - S: C or G (strong)\r\n+ * - Y: C or T\r\n+ * - K: G or T\r\n+ * - B: C or G or T(not A)\r\n+ * - D: A or G or T (not C)\r\n+ * - H: A or C or T (not G)\r\n+ * - V: A or C or G (not T)\r\n+ * - N: A or C or G or T\r\n+ * - ?: nonsequenced position\r\n+ * \r\n+ * Other symbols will be treated as ? (lowercase are supported).\r\n+ * \r\n+ * Rigorous (alias liberal or strong) mode:\r\n+ * - If two characters are the same, it is retained whatever it is\r\n+ * (A + A = A)\r\n+ * - Otherwise:\r\n+ * - If one is the missing character (?) the other is retained\r\n+ * whatever it is (A + ? = A).\r\n+ * - If characters are consistent, that is one contains\r\n+ * more information, that one is retained (A + M = A).\r\n+ * - If characters are not consistent, the closest \r\n+ * generic symbol is retained (A + C = M).\r\n+ * .\r\n+ * Note that the feedback of inconsistent characters in the\r\n+ * outcome is not garanteed.\r\n+ * In fact, (A + A + G) will result in R (as expected) but (A +\r\n+ * G + A) will result in A, masking the problem.\r\n+ * However, the position will indeed be counted as inconsistent.\r\n+ * \r\n+ * Not rigorous (conservative/weak) mode:\r\n+ * - If two characters are the same, it is retained whatever it\r\n+ * is (A + A = A).\r\n+ * - Otherwise:\r\n+ * - If one is ? the other is retained whatever it is (A + ?\r\n+ * = A).\r\n+ * - Otherwise an inconsistent character (by default, Z) is\r\n+ * retained (A + C = Z).\r\n+ * \r\n+ * Iterative process of consensus:\r\n+ * - Each sequence is taken in turn.\r\n+ * - Each pair involving the focus sequence is processed and a\r\n+ * consensus is generated.\r\n+ * - When all pair have been processsed, the consensus already\r\n+ * generated are themselves iteratively processed until only one\r\n+ * remains.\r\n+ * - Note that at each time the last two are taken first.\r\n+ * \r\n+ * A transparent interface gives access to the data for all steps of\r\n+ * the consensus process, as vectors that covers all pairs (including\r\n+ * intermediate steps of the iterative procedure described above) as\r\n+ * well as singleton sequences. For the latter'..b'\r\n+ // Code for disgrement\r\n+ char DISAGREEMENT;\r\n+ \r\n+ public:\r\n+ // This class manages relationships different symbols\r\n+ class CharacterContainer {\r\n+ public:\r\n+ // Default value: @\r\n+ CharacterContainer();\r\n+ \r\n+ // Initiates to a given symbol\r\n+ CharacterContainer(const char&);\r\n+ \r\n+ // Assignment operator\r\n+ CharacterContainer& operator=(const char&);\r\n+ \r\n+ // Sets the symbol\r\n+ void setValue(char);\r\n+ \r\n+ // Set the descendants\r\n+ void setSons(std::vector<CharacterContainer>);\r\n+ \r\n+ // Tests whether the symbol is the same\r\n+ bool is(CharacterContainer);\r\n+ \r\n+ // Tests if the query is contained amongst the sons\r\n+ bool has(CharacterContainer);\r\n+ \r\n+ // Tests if the query is contained amongst the sons\r\n+ bool has(char);\r\n+ \r\n+ /* Tests whether the left character has the left one\r\n+ * Should be called on the N object only.\r\n+ */\r\n+ char lhas(CharacterContainer,CharacterContainer);\r\n+ \r\n+ /* Creates the object with the proper sons\r\n+ * Should be called on the N object only.\r\n+ */\r\n+ CharacterContainer init(char);\r\n+ \r\n+ // The symbol\r\n+ char value;\r\n+ \r\n+ // The descendants\r\n+ std::vector<CharacterContainer> sons;\r\n+ };\r\n+\r\n+ private:\r\n+ // Symbol ?\r\n+ CharacterContainer ccQ;\r\n+ \r\n+ // Symbol A\r\n+ CharacterContainer ccA;\r\n+ \r\n+ // Symbol C\r\n+ CharacterContainer ccC;\r\n+ \r\n+ // Symbol G\r\n+ CharacterContainer ccG;\r\n+ \r\n+ // Symbol T\r\n+ CharacterContainer ccT;\r\n+ \r\n+ // Symbol U\r\n+ CharacterContainer ccU;\r\n+ \r\n+ // Symbol M\r\n+ CharacterContainer ccM;\r\n+ \r\n+ // Symbol R\r\n+ CharacterContainer ccR;\r\n+ \r\n+ // Symbol W\r\n+ CharacterContainer ccW;\r\n+ \r\n+ // Symbol S\r\n+ CharacterContainer ccS;\r\n+ \r\n+ // Symbol Y\r\n+ CharacterContainer ccY;\r\n+ \r\n+ // Symbol K\r\n+ CharacterContainer ccK;\r\n+ \r\n+ // Symbol B\r\n+ CharacterContainer ccB;\r\n+ \r\n+ // Symbol D\r\n+ CharacterContainer ccD;\r\n+ \r\n+ // Symbol H\r\n+ CharacterContainer ccH;\r\n+ \r\n+ // Symbol V\r\n+ CharacterContainer ccV;\r\n+ \r\n+ // Symbol N\r\n+ CharacterContainer ccN;\r\n+ \r\n+ // Symbol -\r\n+ CharacterContainer ccGAP;\r\n+ };\r\n+ };\r\n+}\r\n+\r\n+#endif\r\n+\r\n'

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/Container.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/Container.hpp Fri Jul 10 04:39:30 2015 -0400

b"@@ -0,0 +1,326 @@\n+/*\r\n+ Copyright 2008-2009 St\xe9phane De Mita, Mathieu Siol\r\n+ \r\n+ This file is part of the EggLib library.\r\n+\r\n+ EggLib is free software: you can redistribute it and/or modify\r\n+ it under the terms of the GNU General Public License as published by\r\n+ the Free Software Foundation, either version 3 of the License, or\r\n+ (at your option) any later version.\r\n+\r\n+ EggLib is distributed in the hope that it will be useful,\r\n+ but WITHOUT ANY WARRANTY; without even the implied warranty of\r\n+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\r\n+ GNU General Public License for more details.\r\n+\r\n+ You should have received a copy of the GNU General Public License\r\n+ along with EggLib. If not, see <http://www.gnu.org/licenses/>.\r\n+*/\r\n+\r\n+\r\n+#ifndef EGGLIB_CONTAINER_HPP\r\n+#define EGGLIB_CONTAINER_HPP\r\n+\r\n+\r\n+namespace egglib {\r\n+\r\n+ /** \\brief Handles a set of sequence alignment (aligned or not)\r\n+ *\r\n+ * \\ingroup core\r\n+ * \r\n+ * Creation from a file or string stream should be performed using\r\n+ * the class Fasta.\r\n+ *\r\n+ * Sequences are represented by two strings (name and sequence) and\r\n+ * an integer (group) that can be accessed or modified by index.The\r\n+ * order of sequences is guaranteed to be conserved, as if Container\r\n+ * was a list of triplets (name, sequence, group).\r\n+ *\r\n+ * The data matrix is implemented as continuous arrays (char**) and\r\n+ * allows efficient access and modification of data. For very large\r\n+ * data matrices you might claim immediately the required memory\r\n+ * using the constructor Container(unsigned int, char**).\r\n+ *\r\n+ */\r\n+ class Container {\r\n+ \r\n+ public:\r\n+ \r\n+ /** \\brief Creates an empty object\r\n+ * \r\n+ */\r\n+ Container();\r\n+ \r\n+ \r\n+ /** \\brief Copy constructor\r\n+ * \r\n+ */\r\n+ Container(const Container& source);\r\n+ \r\n+ \r\n+ /** \\brief Assignment operator\r\n+ * \r\n+ */\r\n+ Container& operator= (const Container& source);\r\n+\r\n+\r\n+ /** \\brief Creates an object from a data matrix\r\n+ * \r\n+ * Allows you to create an object from data stored in a char*\r\n+ * array. The array's size must be passed to the constructor.\r\n+ * Since sequences can have different lengths, you need to\r\n+ * terminate each sequence by a NULL character. This constructor\r\n+ * is dedicated to very performance-critical tasks. For usual\r\n+ * tasks, using the default constructor and subsequently adding\r\n+ * sequences with addSeq should be enough.\r\n+ * \r\n+ * \\param number_of_sequences the number of sequences (the length\r\n+ * of the first dimension of the array).\r\n+ * \r\n+ * \\param cstring_array the pointer to the data matrix.\r\n+ * \r\n+ */\r\n+ Container(unsigned int number_of_sequences, char const* const* const cstring_array);\r\n+\r\n+\r\n+ /** \\brief Destructor\r\n+ * \r\n+ */\r\n+ virtual ~Container();\r\n+\r\n+ \r\n+ /** \\brief Clears all content of the object\r\n+ * \r\n+ */\r\n+ virtual void clear();\r\n+\r\n+\r\n+ /** \\brief Adds a sequence to the object\r\n+ *\r\n+ * \\param name the name of the sequence, as a c-string.\r\n+ * \\param sequence the sequence string, as a c-string.\r\n+ * \\param group the group index of the sequence.\r\n+ *\r\n+ * \\return The new number of sequences.\r\n+ * \r\n+ */\r\n+ virtual unsigned int append(const char* name, const char* sequence, unsigned int group=0);\r\n+ \r\n+ \r\n+ /** \\brief Removes a sequence from the object\r\n+ *\r\n+ * \\param pos the index of the seque"..b"r of sequences\r\n+ * \r\n+ */\r\n+ unsigned int ns() const;\r\n+ \r\n+ \r\n+ /** \\brief Gets the length of a given sequence\r\n+ * \r\n+ * \\param pos the index of the sequence.\r\n+ * \r\n+ * \\return The length of that particular sequence.\r\n+ * \r\n+ */\r\n+ virtual unsigned int ls(unsigned int pos) const ;\r\n+ \r\n+ \r\n+ /** \\brief Gets the name of the a given sequence\r\n+ * \r\n+ * \\param pos the index of the sequence.\r\n+ * \r\n+ * \\return The name of that particular sequence.\r\n+ * \r\n+ */\r\n+ virtual const char* name(unsigned int pos) const;\r\n+\r\n+ \r\n+ /** \\brief Gets the name of a given sequence\r\n+ * \r\n+ * \\param pos the index of the sequence.\r\n+ * \r\n+ * \\return The sequence string for that particular sequence.\r\n+ * \r\n+ */\r\n+ virtual const char* sequence(unsigned int pos) const;\r\n+\r\n+\r\n+\r\n+ /** \\brief Gets the group index of a given sequence\r\n+ * \r\n+ * \\param pos the index of the sequence.\r\n+ * \r\n+ * \\return The group index of that particular sequence.\r\n+ * \r\n+ */\r\n+ virtual unsigned int group(unsigned int pos) const;\r\n+ \r\n+ \r\n+ /** \\brief Checks if all lengths are equal\r\n+ * \r\n+ * Returns true if the length of all sequences are equal or\r\n+ * if there is less thant two sequences.\r\n+ * \r\n+ */\r\n+ bool isEqual() const;\r\n+\r\n+\r\n+ /** \\brief Equalizes sequence lengths\r\n+ *\r\n+ * Extends sequences as need to ensure that all sequences\r\n+ * have the same length.\r\n+ *\r\n+ * \\param ch the character to use for padding.\r\n+ * \r\n+ * \\return The final length obtained, which is the length of\r\n+ * the longest sequence before the operation.\r\n+ * \r\n+ */\r\n+ unsigned int equalize(char ch='?');\r\n+\r\n+ \r\n+ /** \\brief Finds a sequence by its name\r\n+ * \r\n+ * Gets the position of the first sequence with the specified\r\n+ * name.\r\n+ * \r\n+ * \\param string a sequence name.\r\n+ * \r\n+ * \\param strict if true, seeks an exact match. If false,\r\n+ * compares only until the end of the requested name (for\r\n+ * example: ATCFF will match ATCFF_01 if strict is false).\r\n+ * \r\n+ * \\return The lowest index where the name matches, -1 if no\r\n+ * sequence has such name.\r\n+ * \r\n+ */\r\n+ int find(const char* string, bool strict=true) const;\r\n+\r\n+\r\n+ protected:\r\n+ // The number of sequences\r\n+ unsigned int _ns;\r\n+ \r\n+ // The array of name lengths\r\n+ unsigned int* lnames;\r\n+ \r\n+ // The array of names\r\n+ char** names;\r\n+ \r\n+ // The array of sequences (as c-strings)\r\n+ char** sequences;\r\n+ \r\n+ // The array of groups\r\n+ unsigned int* groups;\r\n+ \r\n+ // Imports an array of c-strings\r\n+ virtual void setFromSource(unsigned int number_of_sequences, const char* const* const cstring_array);\r\n+ \r\n+ // Constructor helper\r\n+ virtual void copyObject(const Container&);\r\n+ \r\n+ // Constructor partial helper\r\n+ virtual void getNamesAndGroups(const Container&);\r\n+ \r\n+ private:\r\n+ \r\n+ // The array of sequence lengths\r\n+ unsigned int* lsequences;\r\n+ \r\n+ // Setup a valid empty object\r\n+ virtual void init();\r\n+ };\r\n+}\r\n+ \r\n+#endif\r\n"

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/Controller.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/Controller.hpp Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,156 @@
+/*
+    Copyright 2009-2010 St�phane De Mita, Mathieu Siol
+
+    This file is part of the EggLib library.
+
+    EggLib is free software: you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation, either version 3 of the License, or
+    (at your option) any later version.
+
+    EggLib is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with EggLib.  If not, see <http://www.gnu.org/licenses/>.
+*/
+
+#ifndef EGGLIB_CONTROLLER_HPP
+#define EGGLIB_CONTROLLER_HPP
+
+#include "Current.hpp"
+#include "Arg.hpp"
+#include "ParamSet.hpp"
+
+namespace egglib {
+
+    class Random;
+
+   /** \brief Controls a coalescent simulation
+    *
+    * \ingroup coalesce
+    *
+    * This class generates the gene genealogy, based on the parameters
+    * stocked in a ParamSet object.
+    *
+    */
+    class Controller {
+
+        public:
+
+           /** \brief Default constructor
+            *
+            * Uses a default ParamSet object that will not allow
+            * performing simulations.
+            *
+            */
+            Controller();
+
+           /** \brief Destructor
+            *
+            */
+            ~Controller();
+
+           /** \brief Standard constructor
+            *
+            * \param paramSet a ParamSet object containing run
+            * parameters (it is taken as a reference and stored as this
+            * so it must not be modified during simulations).
+            *
+            * \param random the address of the random number generator.
+            *
+            */
+            Controller(const ParamSet* paramSet, Random* random);
+
+          /** \brief Reset for a new simulation
+           *
+           * Object is reinitiliazed for a new simulation.
+           *
+           */
+           void reset();
+
+           /** \brief Increments the coalescent model
+            *
+            * \return The number of lineages.
+            *
+            */
+            unsigned int step();
+
+           /** \brief Gets the Ancestral Recombination Graph
+            *
+            * \return The address of the ARG contained in the object.
+            *
+            */
+            Arg* getArg();
+
+           /** \brief Applies a bottleneck to a given population
+            *
+            * The bottleneck is applied following Galtier, Depaulis and
+            * Barton (Genetics, 2000): the general time counter is
+            * stopped, and coalescence events are performed during a
+            * time (of normal coalescent process) given by the parameter
+            * strength. All coalescent events are instantaneous.
+            *
+            * \param populationIndex index of the population concerned
+            * by the event.
+            *
+            * \param strength strength of the bottleneck given by a
+            * number of time units (2N generations times the size of
+            * the population).
+            *
+            */
+            void bottleneck(unsigned int populationIndex, double strength);
+
+           /** \brief Migrate a complete population
+            *
+            * Takes all the lineages currently present in the population
+            * source to the population dest.
+            *
+            */
+            void moveAllLineages(unsigned int source, unsigned int dest);
+
+           /** \brief Migrate a complete population
+            *
+            * Takes all the lineages currently present in the population
+            * source to the population dest.
+            *
+            * \param source source population.
+            * \param dest destination population.
+            * \param probability the probability that a lineage of
+            * source migrates to dest.
+            *
+            */
+            void moveSomeLineages(unsigned int source, unsigned int dest, double probability);
+
+            /// Adds an empty population
+            void addPopulation();
+
+        private:
+
+            /// The copy constructor is disabled
+            Controller(const Controller& source) {}
+
+            /// The assignment operator is disabled
+            Controller& operator=(const Controller& source) {return *this;}
+
+            void diploids();
+            double getMigrationTime(double& migrationParameterDestination);
+            void getCoalescenceTime(double& destTime, unsigned int& destPopIndex);
+            double getCoalescenceTimeForPopulation(unsigned int populationIndex);
+            double getRecombinationTime() const;
+            void migrate(double migrationParameter);
+
+            const ParamSet* initialParamSet;
+            ParamSet paramSet;
+            Current current;
+            Arg arg;
+
+            Random* random;
+
+    };
+
+}
+
+#endif

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/Convert.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/Convert.hpp Fri Jul 10 04:39:30 2015 -0400

b'@@ -0,0 +1,234 @@\n+/*\r\n+ Copyright 2009 St\xc3\xa9phane De Mita, Mathieu Siol\r\n+\r\n+ This file is part of the EggLib library.\r\n+\r\n+ EggLib is free software: you can redistribute it and/or modify\r\n+ it under the terms of the GNU General Public License as published by\r\n+ the Free Software Foundation, either version 3 of the License, or\r\n+ (at your option) any later version.\r\n+\r\n+ EggLib is distributed in the hope that it will be useful,\r\n+ but WITHOUT ANY WARRANTY; without even the implied warranty of\r\n+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\r\n+ GNU General Public License for more details.\r\n+\r\n+ You should have received a copy of the GNU General Public License\r\n+ along with EggLib. If not, see <http://www.gnu.org/licenses/>.\r\n+*/\r\n+\r\n+\r\n+#ifndef EGGLIB_CONVERT_HPP\r\n+#define EGGLIB_CONVERT_HPP\r\n+\r\n+\r\n+#include "DataMatrix.hpp"\r\n+#include "Align.hpp"\r\n+#include "EggException.hpp"\r\n+#include "Random.hpp"\r\n+#include <string>\r\n+\r\n+#include "config.h"\r\n+\r\n+#ifdef HAVE_LIBBPP_SEQ\r\n+#include <Bpp/Seq/Alphabet.all>\r\n+#include <Bpp/Seq/Sequence.h>\r\n+#include <Bpp/Seq/Container.all>\r\n+#endif\r\n+\r\n+\r\n+\r\n+namespace egglib {\r\n+\r\n+\r\n+ /** \\brief Performs conversion between sequence holder types\r\n+ *\r\n+ * \\ingroup core\r\n+ * \r\n+ * Static methods of this class allows conversion between sequence\r\n+ * holder types implying parametrizable modifications.\r\n+ * \r\n+ */\r\n+ class Convert {\r\n+\r\n+ public:\r\n+ \r\n+ /** \\brief DataMatrix to Align conversion\r\n+ * \r\n+ * By defaut, this method generates an Align instance\r\n+ * containing only the polymorphic sites. The integers of\r\n+ * the DataMatrix will be converted as follow: 0 to A, 1 to\r\n+ * C, 2 to G and 3 to T. This behaviour can be largely\r\n+ * modified using options.\r\n+ * \r\n+ * \\param dataMatrix DataMatrix instance.\r\n+ * \r\n+ * \\param length length of the desired alignment. Non-varying\r\n+ * stretches of data will be introduced to reach the\r\n+ * specified length. By default the positions of segregating\r\n+ * sites will be determined from the positions given by the\r\n+ * DataMatrix object. Those positions are expressed in a\r\n+ * continuous range, and will be discretized. Mutations\r\n+ * falling on the same site will be moved of one position\r\n+ * left or right (always preserving the order of mutation\r\n+ * sites). If positions are all zero (the default of the\r\n+ * DataMatrix class) and if length is larger than the number\r\n+ * of segregating sites, then all segregating sites will\r\n+ * cluster on the left-hand side of the alignment.\r\n+ * \r\n+ * \\param random the address to a Random object allowing to \r\n+ * draw random numbers (for randomizing positions and/or\r\n+ * non-varying states). If an address is provided but no\r\n+ * random numbers are required, it is ignored. If no address\r\n+ * if provided and random numbers are required, a Random\r\n+ * instance is built internally.\r\n+ * \r\n+ * \\param randomizePositions if true, the positions specified\r\n+ * in the DataMatrix objects are ignored and the positions of\r\n+ * mutations are drawn randomly along the interval (only if\r\n+ * the specified length is larger than the number of\r\n+ * segregating sites). If randomizePositions and false and\r\n+ * positions are not\r\n+ * \r\n+ * \\param enforceLength specify whether a\r\n+ * EggRuntimeError should be thrown when the number of\r\n+ * polymorphic sites is larger than the specified length. If\r\n+ * false (the default) and in cases where the specified\r\n+ * length is too short to harbor all polymorphic '..b'rt).\r\n+ * \r\n+ * \\param nonVaryingState character to use for conserved\r\n+ * stretches of data. It doesn\'t have to be included in the\r\n+ * mapping. If randomizeNonVaryingState is true, this\r\n+ * argument is ignored.\r\n+ * \r\n+ * \\return The resulting Align object.\r\n+ * \r\n+ */\r\n+ static Align align(\r\n+ DataMatrix& dataMatrix,\r\n+ unsigned int length=0,\r\n+ Random* random=NULL,\r\n+ bool randomizePositions=false,\r\n+ bool randomizeNonVaryingStates=false,\r\n+ bool randomizeAlleles=false,\r\n+ bool enforceLength=false,\r\n+ std::string mapping="ACGT",\r\n+ char unknown=\'?\',\r\n+ char nonVaryingState=\'A\'\r\n+ );\r\n+\r\n+\r\n+#ifdef HAVE_LIBBPP_SEQ\r\n+\r\n+ /** \\brief Converts an alignment to the equivalent Bio++ type\r\n+ *\r\n+ * During conversion, name information is lost (arbitrary\r\n+ * names are generated in order toprevent duplicate names).\r\n+ * The object is attached to an alphabet matching the passed\r\n+ * integer. The names are bare rank integers (starting at the\r\n+ * value giving by *offset*).\r\n+ *\r\n+ * \\param align the source alignment object.\r\n+ * \r\n+ * \\param alphabetID an integer indicating which alphabet to\r\n+ * use:\r\n+ * - 1 for DNA\r\n+ * - 2 for RNA\r\n+ * - 3 for proteins\r\n+ * - 4 for standard codon\r\n+ * - 5 for vertebrate mitochondrial codon\r\n+ * - 6 for invertebrate mitochondrial codon\r\n+ * - 7 for echinoderm mitochondrial codon\r\n+ * .\r\n+ * Other values will result in an exception.\r\n+ * \r\n+ * \\param outgroupFlag an integer indicating whether to\r\n+ * include outgroup sequences:\r\n+ * - 0 use all sequences\r\n+ * - 1 use only sequences without 999 label (ingroup)\r\n+ * - 2 use only sequences with 999 label (outgroup)\r\n+ * .\r\n+ * Other values will result in an exception.\r\n+ * \r\n+ * \\param offset enter an integer to shift the names of the\r\n+ * resulting alignment (useful to merge alignment and ensure\r\n+ * that names are not duplicated).\r\n+ * \r\n+ * \\return A Bio++ alignment.\r\n+ * \r\n+ */\r\n+ static bpp::AlignedSequenceContainer egglib2bpp(Align& align, unsigned int alphabetID, unsigned int outgroupFlag, unsigned int offset=0);\r\n+\r\n+#endif\r\n+\r\n+\r\n+\r\n+ protected:\r\n+\r\n+ /** \\brief This class cannot be instantiated\r\n+ * \r\n+ */\r\n+ Convert() { }\r\n+\r\n+\r\n+ /** \\brief This class cannot be instantiated\r\n+ * \r\n+ */\r\n+ Convert(const Convert& source) { }\r\n+\r\n+\r\n+ /** \\brief This class cannot be instantiated\r\n+ * \r\n+ */\r\n+ Convert& operator=(const Convert& source) { return *this; }\r\n+\r\n+\r\n+ /** \\brief This class cannot be instantiated\r\n+ * \r\n+ */\r\n+ virtual ~Convert() { }\r\n+\r\n+#ifdef HAVE_LIBBPP_SEQ\r\n+ static bpp::DNA dnaAlphabet;\r\n+ static bpp::RNA rnaAlphabet;\r\n+ static bpp::ProteicAlphabet proteicAlphabet;\r\n+ static bpp::StandardCodonAlphabet standardCodonAlphabet;\r\n+ static bpp::VertebrateMitochondrialCodonAlphabet vertebrateMitochondrialCodonAlphabet;\r\n+ static bpp::InvertebrateMitochondrialCodonAlphabet invertebrateMitochondrialCodonAlphabet;\r\n+ static bpp::EchinodermMitochondrialCodonAlphabet echinodermMitochondrialCodonAlphabet;\r\n+#endif\r\n+\r\n+ };\r\n+}\r\n+\r\n+#endif\r\n'

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/Current.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/Current.hpp Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,128 @@
+/*
+    Copyright 2009-2010 St�phane De Mita, Mathieu Siol
+
+    This file is part of the EggLib library.
+
+    EggLib is free software: you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation, either version 3 of the License, or
+    (at your option) any later version.
+
+    EggLib is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with EggLib.  If not, see <http://www.gnu.org/licenses/>.
+*/
+
+#ifndef EGGLIB_CURRENT_HPP
+#define EGGLIB_CURRENT_HPP
+
+
+namespace egglib {
+
+    class Population;
+    class ParamSet;
+
+   /** \brief Represents the current set of populations
+    *
+    * \ingroup coalesce
+    *
+    */
+    class Current {
+
+        public:
+
+           /** \brief Default constructor
+            *
+            */
+            Current();
+
+           /** \brief Standard constructor
+            *
+            * \param paramSet allows to initiate the correct structure
+            * of populations.
+            *
+            */
+            Current(ParamSet* paramSet);
+
+           /** \brief Rebuilds the object
+            *
+            * \param paramSet allows to initiate the correct structure
+            * of populations.
+            *
+            */
+            void reset(ParamSet* paramSet);
+
+           /** \brief Destructor
+            *
+            */
+            virtual ~Current();
+
+           /** \brief Copy constructor
+            *
+            */
+            Current(const Current&);
+
+           /** \brief Assignment operator
+            *
+            */
+            Current& operator=(const Current&);
+
+           /** \brief Gets the current number of populations
+            *
+            */
+            unsigned int numberOfPopulations() const;
+
+
+           /** \brief Adds an empty population to the system
+            *
+            */
+            void addPopulation();
+
+
+           /** \brief Gets the number of lineages contained by a given
+            * population
+            *
+            */
+            unsigned int populationNumberOfLineages(unsigned int populationIndex) const;
+
+
+           /** \brief Provides access to a given population
+            *
+            * The returned pointer can be used to modify the object.
+            *
+            */
+            Population* population(unsigned int populationIndex);
+
+
+           /** \brief Total number of lineages
+            *
+            */
+            unsigned int totalNumberOfLineages() const;
+
+
+           /** \brief Efficient number of lineages
+            *
+            * This sums the number of covered segments of each lineage.
+            *
+            */
+            unsigned int efficientNumberOfLineages() const;
+
+
+        private:
+
+            void setPopulationArray();
+            void copy(const Current&);
+            void clear();
+
+            unsigned int _numberOfPopulations;
+            unsigned int _numberOfSegments;
+            Population** populations;
+    };
+
+}
+
+#endif

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/DataMatrix.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/DataMatrix.hpp Fri Jul 10 04:39:30 2015 -0400

[

@@ -0,0 +1,219 @@
+/*
+    Copyright 2009-2010 St�phane De Mita, Mathieu Siol
+
+    This file is part of the EggLib library.
+
+    EggLib is free software: you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation, either version 3 of the License, or
+    (at your option) any later version.
+
+    EggLib is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with EggLib.  If not, see <http://www.gnu.org/licenses/>.
+*/
+
+#ifndef EGGLIB_DATAMATRIX_HPP
+#define EGGLIB_DATAMATRIX_HPP
+
+
+#include "CharMatrix.hpp"
+
+
+namespace egglib {
+
+    /** \brief Data table
+    *
+    * \ingroup core
+    *
+    * Holds a data matrix representing genotype data from simulations.
+    * Data are stored as integers, to each site is associated a
+    * position, and to each sequence is associated a group index (any
+    * integer labelling, for example, a subpopulation). Supports the
+    * CharMatrix interface with the condition that allele genotype
+    * datum is >=0 and <=9.
+    *
+    */
+    class DataMatrix : public CharMatrix {
+
+    public:
+
+        /** \brief Default constructor
+         *
+         * The data table default dimensions are {0,0}
+         *
+         */
+        DataMatrix();
+
+
+        /** \brief Standard constructor
+         *
+         * The data table dimensions must be given.
+         * Each cell default default is 0, and each site position is 0..
+         *
+         * \param numberOfSequences number of lines of the data table.
+         * \param numberOfSites number of columns of the data table.
+         *
+         */
+        DataMatrix(unsigned int numberOfSequences, unsigned int numberOfSites);
+
+
+        /** \brief Copy constructor
+         *
+         */
+        DataMatrix(const DataMatrix&);
+
+
+        /** \brief Copy constructor
+         *
+         */
+        DataMatrix(const CharMatrix&);
+
+
+        /** \brief Assignment operator
+         *
+         */
+        virtual DataMatrix& operator=(const DataMatrix&);
+
+
+        /** \brief Assignment operator
+         *
+         */
+        virtual DataMatrix& operator=(const CharMatrix&);
+
+
+        /** \brief Destructor
+         *
+         */
+        virtual ~DataMatrix();
+
+
+        /** \brief Gets number of sites
+         *
+         */
+        unsigned int numberOfSites() const;
+
+
+        /** \brief Gets number of sequences
+         *
+         */
+        unsigned int numberOfSequences() const;
+
+
+        /** \brief Sets a value of the data table
+         *
+         */
+        void set(unsigned int sequence, unsigned int site, int value);
+
+
+        /** \brief Gets a value from the data table
+         *
+         */
+        int get(unsigned int sequence, unsigned int site) const;
+
+
+        /** \brief Faster and unsecure version of get
+         *
+         */
+        inline int fget(unsigned int sequence, unsigned int site) const {
+            return dataMatrix[sequence][site];
+        }
+
+
+        /** \brief Sets the position of a site
+         *
+         */
+        void sitePosition(unsigned int site, double value);
+
+
+        /** \brief Gets the position of a site
+         *
+         */
+        double sitePosition(unsigned int site) const;
+
+
+        /** \brief Sets the group label of a sequence
+         *
+         */
+        void populationLabel(unsigned int sequence, unsigned int value);
+
+
+        /** \brief Gets the group label of a sequence
+         *
+         */
+        unsigned int populationLabel(unsigned int sequence) const;
+
+
+        /** \brief Removes all information from the object
+         *
+         */
+        void clear();
+
+
+        /** \brief Resizes the data matrix
+         *
+         * \param newNumberOfSequences number of sequences (rows)
+         * \param newNumberOfSites number of sites (columns)
+         *
+         * If new values are larger, data already set is left unchanged.
+         * New data are set to zero.
+         *
+         */
+        void resize(unsigned int newNumberOfSequences, unsigned int newNumberOfSites);
+
+
+       /** \brief Shifts allele value
+        *
+        * \param minimum the minimum allele value.
+        *
+        * Shifts all alleles at all sites to ensure that alleles alleles
+        * are equal to or larger than minimum. The shifting is specific
+        * to each site.
+        *
+        */
+        void shift(int minimum);
+
+        /** \brief Gets the character at a given position
+         *
+         * An exception is generated if the allele value at this
+         * position is not >=0 and <=9. Not out-of-bound check is
+         * performed.
+         *
+         */
+        char character(unsigned int sequence, unsigned int site) const;
+
+
+
+    private:
+
+        // Initializes to default values (for empty object)
+        void init();
+
+        // Copies from a source object
+        virtual void copy(const CharMatrix&);
+
+        // Copies from a source object
+        virtual void copy(const DataMatrix&);
+
+        // Number of lines of the data matrix
+        unsigned int _numberOfSequences;
+
+        // Number of columns of the data matrix
+        unsigned int _numberOfSites;
+
+        // Data matrix
+        int **dataMatrix;
+
+        // Vector of site positions
+        double *positions;
+
+        // Vector of group indices
+        unsigned int *groups;
+    };
+}
+
+#endif

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/Edge.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/Edge.hpp Fri Jul 10 04:39:30 2015 -0400

[

b'@@ -0,0 +1,331 @@\n+/*\r\n+ Copyright 2009-2010 St\xe9phane De Mita, Mathieu Siol\r\n+\r\n+ This file is part of the EggLib library.\r\n+\r\n+ EggLib is free software: you can redistribute it and/or modify\r\n+ it under the terms of the GNU General Public License as published by\r\n+ the Free Software Foundation, either version 3 of the License, or\r\n+ (at your option) any later version.\r\n+\r\n+ EggLib is distributed in the hope that it will be useful,\r\n+ but WITHOUT ANY WARRANTY; without even the implied warranty of\r\n+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\r\n+ GNU General Public License for more details.\r\n+\r\n+ You should have received a copy of the GNU General Public License\r\n+ along with EggLib. If not, see <http://www.gnu.org/licenses/>.\r\n+*/\r\n+\r\n+#ifndef EGGLIB_EDGE_HPP\r\n+#define EGGLIB_EDGE_HPP\r\n+\r\n+#include <vector>\r\n+#include <climits>\r\n+#include "EggException.hpp"\r\n+\r\n+namespace egglib {\r\n+\r\n+ class Random;\r\n+\r\n+ /** \\brief Edge of the ancestral recombination graph\r\n+ *\r\n+ * \\ingroup coalesce\r\n+ *\r\n+ * Each Edge instance provides access to its 0, 1 or 2 descendants\r\n+ * (the former holds for a terminal node, the middle for the parent\r\n+ * of a recombined node and the latter for the parent of a coalesced\r\n+ * node (most classical node in the coalescent).The Edge also\r\n+ * provides to the edge length. Note that the Edge instance must be\r\n+ * understood as an ARG node and the branch above it (latter in the\r\n+ * coalescence process). Edge instances also keep track of the list\r\n+ * of descendants descending from this node (which may differ along\r\n+ * recombining segment). Edge instances *must* be created through one\r\n+ * of the "default" and "coalescence" constructors or through the \r\n+ * recombination method. Edge instances should never be copied but\r\n+ * manipulated by references.\r\n+ * \r\n+ */\r\n+ class Edge {\r\n+ \r\n+ public:\r\n+ \r\n+ /// Destructor\r\n+ virtual ~Edge();\r\n+ \r\n+ /** \\brief Constructor\r\n+ * \r\n+ * \\param numberOfSegments the number of recombining segments\r\n+ * (one for a non-recombining region).\r\n+ * \r\n+ * Use the Pool, instead. Objects are delivered with a\r\n+ * complete coverage.\r\n+ * \r\n+ */ \r\n+ Edge(unsigned int numberOfSegments);\r\n+\r\n+\r\n+ /// Restore object to `factory` state\r\n+ void reset();\r\n+\r\n+\r\n+ /** \\brief Builds for internal node\r\n+ * \r\n+ * \\param date the date of creation of the edge.\r\n+ * \\param son1 first edge descending from this edge.\r\n+ * \\param son2 second edge descending from this edge.\r\n+ * \\param edgesPerSegments counts the current number of\r\n+ * (non-coalesced lineages for each lineages); must have the\r\n+ * appropriate size and will be updated.\r\n+ * \\param MRCA the list where to place the address of segment\r\n+ * MRCA, if it occurs.\r\n+ * \\param totalLength the total length of the tree.\r\n+ * \\param segmentLengths the table of tree lengths per\r\n+ * segment.\r\n+ *\r\n+ * Assumes the current object has the correct number of\r\n+ * segments.\r\n+ * \r\n+ */\r\n+ void coalescence(double date, Edge* son1, Edge* son2,\r\n+ unsigned int* edgesPerSegments, Edge** MRCA,\r\n+ double& totalLength, double* segmentLengths);\r\n+\r\n+\r\n+ /** \\brief Generates a recombination event\r\n+ * \r\n+ * \\param date the date of the event.\r\n+ * \\param dest1 destination for the first resulting edge.\r\n+ * \\param dest2 destination for the second resulting edge.\r\n+ * \\param random pointer to the Random instance used by the \r\n+ * simulator.\r\n+ '..b"numberOfSegments) {\r\n+ if (segbools[i]==true) {\r\n+ totalLength += segments[i]*length;\r\n+ for (j=0; j<segments[i]; j++) {\r\n+ segmentLengths[i+j] += length;\r\n+ }\r\n+ }\r\n+ i+=segments[i];\r\n+ }\r\n+ }\r\n+\r\n+\r\n+ };\r\n+\r\n+\r\n+\r\n+\r\n+\r\n+\r\n+\r\n+\r\n+\r\n+\r\n+\r\n+\r\n+ /** \\brief Pool of Edge objects\r\n+ *\r\n+ * \\ingroup coalesce\r\n+ *\r\n+ * Holds a pool of Edge objects that can be recycled to spare the\r\n+ * building burden. A construction time, a number of Edge objects\r\n+ * equals to the predicted number of needed instances should be\r\n+ * requested. The Edge's will be prebuilt immediately and delivered\r\n+ * upon request. After use, the Edge's should be released. It is only\r\n+ * possible to release the last issued Edge instance or all of them\r\n+ * at once.\r\n+ * \r\n+ */\r\n+ class EdgePool {\r\n+\r\n+ public:\r\n+ \r\n+ /// Default constructor (nothing allocated)\r\n+ EdgePool();\r\n+\r\n+\r\n+ /// Destructor\r\n+ virtual ~EdgePool();\r\n+\r\n+\r\n+ /** \\brief Configure pool\r\n+ * \r\n+ * Pre-allocates a given number of Edge objects. The objects\r\n+ * will be immediately available.\r\n+ * \r\n+ * Data previously allocated (by a previous call of this\r\n+ * function or by the deliver() method) will be lost so it\r\n+ * can be required to use clear() before.\r\n+ * \r\n+ * \\param numberOfSegments the number of segments of the\r\n+ * simulation; all Edge instances will use this value.\r\n+ * \r\n+ * \\param numberOfPreAllocated the number of Edge that should\r\n+ * be kept ready for immediate use.\r\n+ * \r\n+ */\r\n+ void set(unsigned int numberOfSegments, unsigned numberOfPreAllocated);\r\n+ \r\n+ \r\n+ /** \\brief Frees internally stored memory\r\n+ * \r\n+ * This invalidate all points that have been delivered\r\n+ * previously. However, any previously set number of segments\r\n+ * (0, by default) is retained.\r\n+ * \r\n+ */\r\n+ void clear();\r\n+\r\n+ \r\n+ /** \\brief Deliver an Edge\r\n+ * \r\n+ * The object must not be freed by the client! This object is\r\n+ * allocated on the heap if the cache is not large enough,\r\n+ * only reset if it was previously released, or just delivered\r\n+ * if it is one of the initially allocated instances.\r\n+ * \r\n+ */\r\n+ Edge* deliver();\r\n+ \r\n+ \r\n+ /** \\brief Release an Edge\r\n+ * \r\n+ * Release the last delivered Edge. The instance is only\r\n+ * cached for a potential future use; it is not freed nor\r\n+ * reset immediately. If no Edge's are in use, nothing is\r\n+ * done.\r\n+ * \r\n+ */\r\n+ void releaseLast();\r\n+\r\n+ \r\n+ /** \\brief Release all Edge's\r\n+ * \r\n+ * Release all delivered Edges. The instances are only\r\n+ * cached for a potential future use; they are not freed nor\r\n+ * reset immediately. If no Edge's are in use, nothing is\r\n+ * done.\r\n+ * \r\n+ */\r\n+ void releaseAll();\r\n+\r\n+ private:\r\n+ \r\n+ /// Not available\r\n+ EdgePool(const EdgePool& ep) {}\r\n+ \r\n+ /// Not available\r\n+ EdgePool& operator=(const EdgePool& ep) { return *this; }\r\n+\r\n+ unsigned int numberOfSegments;\r\n+ unsigned int used;\r\n+ unsigned int released;\r\n+ unsigned int ready;\r\n+ Edge** cache;\r\n+ \r\n+ };\r\n+\r\n+}\r\n+\r\n+#endif\r\n"

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/EggException.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/EggException.hpp Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,173 @@
+/*
+    Copyright 2009 St�phane De Mita, Mathieu Siol
+
+    This file is part of the EggLib library.
+
+    EggLib is free software: you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation, either version 3 of the License, or
+    (at your option) any later version.
+
+    EggLib is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with EggLib.  If not, see <http://www.gnu.org/licenses/>.
+*/
+
+#ifndef EGGLIB_EGGEXCEPTION_HPP
+#define EGGLIB_EGGEXCEPTION_HPP
+
+#include <string>
+#include <exception>
+
+namespace egglib {
+
+    /** \brief Base exception type for errors occurring in this library
+     *
+     * \ingroup core
+     *
+     */
+    class EggException : public std::exception {
+        public:
+            /// Constructor with empty error message
+            EggException();
+            /// Creates the exception
+            EggException(const char* message);
+            /// Destructor
+            ~EggException() throw() {}
+            /// Gets error message
+            virtual const char* what() const throw();
+
+      protected:
+            std::string message;
+
+    };
+
+
+    /** \brief Exception type for memory errors
+     *
+     * \ingroup core
+     *
+     */
+    class EggMemoryError : public EggException {
+        public:
+            /// Creates the exception
+            EggMemoryError();
+            /// Destructor
+            ~EggMemoryError() throw() {}
+    };
+
+
+    /** \brief Exception type for argument value errors
+     *
+     * \ingroup core
+     *
+     */
+    class EggArgumentValueError : public EggException {
+        public:
+            /// Creates the exception
+            EggArgumentValueError(const char* m );
+            /// Destructor
+            ~EggArgumentValueError() throw() {}
+    };
+
+
+    /** \brief Exception type for runtime errors
+     *
+     * Runtime error definition is rather large. Includes bugs as well
+     * as logical errors.
+     *
+     * \ingroup core
+     *
+     */
+    class EggRuntimeError : public EggException {
+        public:
+            /// Creates the exception
+            EggRuntimeError(const char* m );
+            /// Destructor
+            ~EggRuntimeError() throw() {}
+    };
+
+
+    /** \brief Exception type for file/string formatting errors
+     *
+     * \ingroup core
+     *
+     */
+    class EggFormatError : public EggException {
+        public:
+            /// Creates the exception
+            EggFormatError(const char* fileName, const char* expectedFormat, const char* m);
+            /// Destructor
+            ~EggFormatError() throw() {}
+            /// Gets the file name
+            std::string fileName() const;
+            /// Gets the expected format
+            std::string expectedFormat() const;
+            /// Formats a longer string
+            virtual const char* what_more() const;
+
+        protected:
+            std::string fname;
+            std::string eformat;
+    };
+
+
+    /** \brief Exception type for errors while opening a file
+     *
+     * \ingroup core
+     *
+     */
+    class EggOpenFileError : public EggException {
+        public:
+            /// Creates the exception
+            EggOpenFileError(const char* fileName );
+            /// Destructor
+            ~EggOpenFileError() throw() {}
+    };
+
+
+    /** \brief Exception type for unaligned sequences
+     *
+     * \ingroup core
+     *
+     */
+    class EggUnalignedError : public EggException {
+        public:
+           /** \brief Creates the exception
+            *
+            */
+            EggUnalignedError();
+
+           /** \brief Destructor
+            *
+            */
+            ~EggUnalignedError() throw() {}
+    };
+
+   /** \brief Exception type for invalid character
+    *
+    * \ingroup core
+    *
+    */
+    class EggInvalidCharacterError : public EggException {
+        public:
+           /** \brief Creates the exception
+            *
+            */
+            EggInvalidCharacterError(char c, unsigned int seqIndex, unsigned int posIndex);
+
+           /** \brief Destructor
+            *
+            */
+            ~EggInvalidCharacterError() throw() {}
+    };
+
+}
+
+
+
+#endif

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/FStatistics.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/FStatistics.hpp Fri Jul 10 04:39:30 2015 -0400

b'@@ -0,0 +1,288 @@\n+/*\r\n+ Copyright 2009 St\xe9phane De Mita, Mathieu Siol\r\n+\r\n+ This file is part of the EggLib library.\r\n+\r\n+ EggLib is free software: you can redistribute it and/or modify\r\n+ it under the terms of the GNU General Public License as published by\r\n+ the Free Software Foundation, either version 3 of the License, or\r\n+ (at your option) any later version.\r\n+\r\n+ EggLib is distributed in the hope that it will be useful,\r\n+ but WITHOUT ANY WARRANTY; without even the implied warranty of\r\n+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\r\n+ GNU General Public License for more details.\r\n+\r\n+ You should have received a copy of the GNU General Public License\r\n+ along with EggLib. If not, see <http://www.gnu.org/licenses/>.\r\n+*/\r\n+\r\n+#ifndef EGGLIB_FSTATISTICS_HPP\r\n+#define EGGLIB_FSTATISTICS_HPP\r\n+\r\n+\r\n+\r\n+namespace egglib {\r\n+\r\n+\r\n+ /** \\brief Computes Fis, Fst and Fit from diploid data\r\n+ *\r\n+ * The class requires loading data. Data are loaded by individual\r\n+ * (two genotypes per individual). The analyses are cached: they are\r\n+ * performed upon the first call to statistics accessors. The cache\r\n+ * is emptied whenever a datum is loaded.\r\n+ * \r\n+ * The computations are performed after Weir and Cockerham. The\r\n+ * statistics F, theta and f are generalized for multiple alleles.\r\n+ * To allow computation of multi-locus statistics, variance\r\n+ * components are also available. The three components of the\r\n+ * variance are Vpopulation (between-population), Vindividual\r\n+ * (within-population, between-individual) and Vallele (within-\r\n+ * individual). The formulas to compute the F-statistics are as\r\n+ * follows:\r\n+ * - 1-F = Vallele/(Vpopulation+Vindividual+Vallele)\r\n+ * - theta = Vpopulation/(Vpopulation+Vindividual+Vallele)\r\n+ * - 1-f = Vallele/(Vindividual+Vallele).\r\n+ * \r\n+ * \\ingroup polymorphism\r\n+ *\r\n+ */\r\n+ class FStatistics {\r\n+ \r\n+ public:\r\n+ \r\n+ /** \\brief Constructor\r\n+ * \r\n+ */ \r\n+ FStatistics();\r\n+\r\n+ \r\n+ /** \\brief Destructor\r\n+ * \r\n+ */ \r\n+ virtual ~FStatistics();\r\n+\r\n+ \r\n+ /** \\brief Reserve sufficient memory for a given number of\r\n+ * individuals.\r\n+ * \r\n+ * This method makes the load function faster by allocating\r\n+ * all required memory at once.\r\n+ * \r\n+ * \\param numberOfIndividuals a strictly positive integer.\r\n+ * \r\n+ */\r\n+ void reserve(unsigned int numberOfIndividuals);\r\n+\r\n+\r\n+ /** \\brief Loads the data for one individual\r\n+ * \r\n+ * \\param genotype1 an integer giving the first allele.\r\n+ * \\param genotype2 an integer giving the second allele.\r\n+ * \\param populationLabel an integer indication belonging to\r\n+ * a population.\r\n+ * \r\n+ * Genotypes and population labels are not required to be\r\n+ * consecutive (both are labels, not indices). They are\r\n+ * internally mapped to indices (the mapping can be obtained\r\n+ * by accessors populationLabel and allele).\r\n+ * \r\n+ * All genotypes are considered to be valid (no missing data).\r\n+ * If statistics were computed previous to call to this\r\n+ * function, all data will be erase.\r\n+ * \r\n+ */\r\n+ void loadIndividual(unsigned int genotype1,\r\n+ unsigned int genotype2, unsigned int populationLabel);\r\n+\r\n+\r\n+ /** \\brief Label of a population\r\n+ * \r\n+ * The index corresponds to the local mapping of populations\r\n+ * regardless of the ranking of population labels. (No out\r\n+ * of bound checking.)\r\n+ * \r\n+ */\r\n+ unsigne'..b'leIndex);\r\n+\r\n+\r\n+ /** \\brief Absolute genotype frequency\r\n+ * \r\n+ * Note that allele AB is considered different to BA (this\r\n+ * means that values can be accessed both sides of the\r\n+ * diagonal.\r\n+ * \r\n+ */\r\n+ unsigned int genotypeFrequencyTotal(unsigned int alleleIndex1, unsigned int alleleIndex2);\r\n+\r\n+\r\n+ /** \\brief Absolute genotype frequency in a population\r\n+ * \r\n+ * Note that allele AB is considered different to BA (this\r\n+ * means that values can be accessed both sides of the\r\n+ * diagonal.\r\n+ * \r\n+ */\r\n+ unsigned int genotypeFrequencyPerPopulation(unsigned int populationIndex, unsigned int alleleIndex1, unsigned int alleleIndex2);\r\n+\r\n+ \r\n+ /** \\brief Sample size of a population\r\n+ * \r\n+ */\r\n+ unsigned int populationFrequency(unsigned int populationIndex);\r\n+\r\n+\r\n+ /** \\brief Weir-Cockerham F-statistic\r\n+ * \r\n+ * Note: equivalent to Fit.\r\n+ * \r\n+ */\r\n+ double F();\r\n+\r\n+\r\n+ /** \\brief Weir-Cockerham theta-statistic\r\n+ * \r\n+ * Note: equivalent to Fst.\r\n+ * \r\n+ */\r\n+ double theta();\r\n+\r\n+\r\n+ /** \\brief Weir-Cockerham f-statistic\r\n+ * \r\n+ * Note: equivalent to Fis.\r\n+ * \r\n+ */\r\n+ double f();\r\n+ \r\n+\r\n+ /** \\brief Between-population component of variance\r\n+ * \r\n+ */\r\n+ double Vpopulation();\r\n+\r\n+\r\n+ /** \\brief Within-population, between-individual component of variance\r\n+ * \r\n+ */\r\n+ double Vindividual();\r\n+ \r\n+ \r\n+ /** \\brief Within-individual component of variance\r\n+ * \r\n+ */\r\n+ double Vallele();\r\n+\r\n+\r\n+ protected:\r\n+ \r\n+ bool d_flag;\r\n+ void d_init();\r\n+ void d_clear();\r\n+ unsigned int d_reserved;\r\n+ unsigned int d_numberOfGenotypes;\r\n+ unsigned int *d_genotypes;\r\n+ unsigned int *d_populationLabels;\r\n+\r\n+ bool s_flag;\r\n+ void s_init();\r\n+ void s_clear();\r\n+ void s_compute();\r\n+ void processPopulations();\r\n+ void processAlleles();\r\n+ unsigned int getPopulationIndex(unsigned int) const;\r\n+ unsigned int getAlleleIndex(unsigned int) const;\r\n+ unsigned int s_numberOfAlleles;\r\n+ unsigned int *s_alleleValueMapping;\r\n+ unsigned int s_numberOfPopulations;\r\n+ unsigned int *s_populationLabelMapping;\r\n+ unsigned int *s_populationFrequencies;\r\n+ unsigned int *s_alleleFrequenciesTotal;\r\n+ unsigned int **s_alleleFrequenciesPerPopulation;\r\n+ unsigned int **s_genotypeFrequenciesTotal;\r\n+ unsigned int ***s_genotypeFrequenciesPerPopulation;\r\n+\r\n+ bool w_flag;\r\n+ void w_init();\r\n+ void w_clear();\r\n+ void w_compute();\r\n+ double w_F;\r\n+ double w_T;\r\n+ double w_f;\r\n+ double *w_a;\r\n+ double *w_b;\r\n+ double *w_c;\r\n+ double w_nbar;\r\n+ double w_nc;\r\n+ double *w_pbar;\r\n+ double *w_ssquare;\r\n+ double *w_hbar;\r\n+ double w_sum_a;\r\n+ double w_sum_b;\r\n+ double w_sum_c;\r\n+ double w_sum_abc;\r\n+ double w_sum_bc;\r\n+\r\n+ \r\n+ private:\r\n+ \r\n+ FStatistics(const FStatistics& source) { }\r\n+ \r\n+ FStatistics& operator=(const FStatistics& source) {\r\n+ return *this;\r\n+ }\r\n+\r\n+ };\r\n+}\r\n+\r\n+#endif\r\n'

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/Fasta.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/Fasta.hpp Fri Jul 10 04:39:30 2015 -0400

b'@@ -0,0 +1,278 @@\n+/*\r\n+ Copyright 2008-2009 St\xe9phane De Mita, Mathieu Siol\r\n+\r\n+ This file is part of the EggLib library.\r\n+\r\n+ EggLib is free software: you can redistribute it and/or modify\r\n+ it under the terms of the GNU General Public License as published by\r\n+ the Free Software Foundation, either version 3 of the License, or\r\n+ (at your option) any later version.\r\n+\r\n+ EggLib is distributed in the hope that it will be useful,\r\n+ but WITHOUT ANY WARRANTY; without even the implied warranty of\r\n+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\r\n+ GNU General Public License for more details.\r\n+\r\n+ You should have received a copy of the GNU General Public License\r\n+ along with EggLib. If not, see <http://www.gnu.org/licenses/>.\r\n+*/\r\n+\r\n+#ifndef EGGLIB_FASTA_HPP\r\n+#define EGGLIB_FASTA_HPP\r\n+\r\n+#include <istream>\r\n+#include <iostream>\r\n+#include <string>\r\n+#include "Container.hpp"\r\n+\r\n+namespace egglib {\r\n+\r\n+ /** \\brief Fasta parser/formatted\r\n+ *\r\n+ * \\ingroup core\r\n+ *\r\n+ * Reads a multifasta sequence file from a string, a stream or a file\r\n+ * and returns a Container. See the description of the format below.\r\n+ * Formats a fasta string from a sequence container object and places\r\n+ * it in a string, a stream of a file. All methods are static and the\r\n+ * class cannot be instantiated. The methods parsef and formatf will\r\n+ * open the file for you while the others will read/write directly\r\n+ * in a string.\r\n+ * \r\n+ * Specifications of the fasta format:\r\n+ * \r\n+ * - The number of sequences is not limited.\r\n+ * \r\n+ * - Each sequence is preceded by a header limited to a single\r\n+ * line and starting by a ">" character.\r\n+ * \r\n+ * - The header length is not limited and all characters are\r\n+ * allowed but white spaces and special characters are\r\n+ * discouraged.\r\n+ * \r\n+ * - Group indices are specified by \\@0, \\@1, \\@2... strings\r\n+ * appearing at the end of the header string (just before the\r\n+ * carriage return). Note that group labels are ignored by\r\n+ * default.\r\n+ * \r\n+ * - Group indices are ignored unless specifically specified in a\r\n+ * parser\'s options.\r\n+ * \r\n+ * - The sequence itself continues on following lines until the\r\n+ * next ">" character or the end of the file.\r\n+ * \r\n+ * - White spaces, tab and carriage returns are allowed at any\r\n+ * position There is no limitation in length and different\r\n+ * sequences can have different lengths.\r\n+ * \r\n+ * - Although the standard is lower case characters, Fasta\r\n+ * assumes upper case characters and only supports lower case\r\n+ * characters (and converts them to upper case characters).\r\n+ * Information coded by change in case is lost.\r\n+ *\r\n+ */\r\n+ class Fasta {\r\n+\r\n+ public:\r\n+\r\n+ /** \\brief Imports a fasta file\r\n+ *\r\n+ * Imports the content of the file as is. Calls the method\r\n+ * pase(std::istream*, bool) by creating its own istream.\r\n+ *\r\n+ * \\param fname the name of a fasta file.\r\n+ * \r\n+ * \\param importGroupLabels if set to true, scan automatically\r\n+ * for groups. The format is @ followed by an integer, placed\r\n+ * at the end of the header string(sequences without labels\r\n+ * will be treated as \\@0).\r\n+ * \r\n+ * \\return A Container object containing the sequences.\r\n+ * \r\n+ */\r\n+ static Container parsef(const char* fname, bool importGroupLabels=false);\r\n+\r\n+\r\n+ /** \\brief Imports a fasta file\r\n+ *\r\n+ * Imports the content of the file as is. Calls the method\r\n+ * pase(std::istream*, bool) by creating its own istream. This\r\n+ * method expects a reference to a Container to which the\r\n+ * sequences will be appended.\r\n+ *\r\n+'..b'ner object containing the sequences.\r\n+ * \r\n+ */\r\n+ static Container parse(std::istream& stream, bool importGroupLabels=false);\r\n+\r\n+\r\n+ /** \\brief Imports a fasta file from an open stream\r\n+ *\r\n+ * Imports the content of the file as is. This\r\n+ * method expects a reference to a Container to which the\r\n+ * sequences will be appended.\r\n+ *\r\n+ * \\param stream an open stream (file or string) containing the\r\n+ * data.\r\n+ * \r\n+ * \\param container a Container instance, empty or not.\r\n+ * \r\n+ * \\param importGroupLabels if set to true, scan automatically\r\n+ * for groups. The format is @ followed by an integer, placed\r\n+ * at the end of the header string(sequences without labels\r\n+ * will be treated as \\@0).\r\n+ * \r\n+ * \\return Nothing: the new sequences are appended to the\r\n+ * Container passed as argument.\r\n+ * \r\n+ */\r\n+ static void parse(std::istream& stream, Container& container, bool importGroupLabels=false);\r\n+ \r\n+ \r\n+ /** \\brief Export sequences as fasta\r\n+ *\r\n+ * \\param fname the name of the file where to place the result.\r\n+ * \r\n+ * \\param container Container object to export.\r\n+ * \r\n+ * \\param exportGroupLabels if set to true, exports group\r\n+ * indices as a \\@x at the end of the sequence name, where x is\r\n+ * the group index. Otherwise, this information is discarded.\r\n+ * \r\n+ * \\param lineLength the number of characters to place on a\r\n+ * single line. If zero, no newlines are inserted within\r\n+ * sequences.\r\n+ * \r\n+ */\r\n+ static void formatf(const char* fname, const Container& container, bool exportGroupLabels=false, unsigned int lineLength=50);\r\n+\r\n+\r\n+ /** \\brief Export sequences as fasta\r\n+ *\r\n+ * \\param file an open stream.\r\n+ * \r\n+ * \\param container Container object to export.\r\n+ * \r\n+ * \\param exportGroupLabels if set to true, exports group\r\n+ * indices as a \\@x at the end of the sequence name, where x is\r\n+ * the group index. Otherwise, this information is discarded.\r\n+ * \r\n+ * \\param lineLength the number of characters to place on a\r\n+ * single line. If zero, no newlines are inserted within\r\n+ * sequences.\r\n+ * \r\n+ */\r\n+ static void format(std::ostream& file, const Container& container, bool exportGroupLabels=false, unsigned int lineLength=50);\r\n+\r\n+\r\n+ /** \\brief Export sequences as fasta\r\n+ * \r\n+ * This medod creates internally an ostringstream, calls the\r\n+ * method format(ostream, container, bool) and returns the\r\n+ * resulting string.\r\n+ *\r\n+ * \\param container Container object to export.\r\n+ * \r\n+ * \\param exportGroupLabels if set to true, exports group\r\n+ * indices as a \\@x at the end of the sequence name, where x is\r\n+ * the group index. Otherwise, this information is discarded.\r\n+ * \r\n+ * \\param lineLength the number of characters to place on a\r\n+ * single line. If zero, no newlines are inserted within\r\n+ * sequences.\r\n+ * \r\n+ * \\return The formatted string.\r\n+ * \r\n+ */\r\n+ static std::string format(const Container& container, bool exportGroupLabels=false, unsigned int lineLength=50);\r\n+\r\n+ \r\n+ \r\n+ protected:\r\n+ \r\n+ /// This class cannot be instantiated\r\n+ Fasta() { }\r\n+ \r\n+ /// This class cannot be instantiated\r\n+ Fasta(const Fasta& source) { }\r\n+ \r\n+ /// This class cannot be or copied\r\n+ Fasta& operator=(const Fasta& source) { return *this; }\r\n+ \r\n+ /// This class cannot be instantiated\r\n+ virtual ~Fasta() { }\r\n+\r\n+ \r\n+ };\r\n+}\r\n+\r\n+#endif\r\n'

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/HFStatistics.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/HFStatistics.hpp Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,227 @@
+/*
+    Copyright 2010 St�phane De Mita, Mathieu Siol
+
+    This file is part of the EggLib library.
+
+    EggLib is free software: you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation, either version 3 of the License, or
+    (at your option) any later version.
+
+    EggLib is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with EggLib.  If not, see <http://www.gnu.org/licenses/>.
+*/
+
+#ifndef EGGLIB_HFSTATISTICS_HPP
+#define EGGLIB_HFSTATISTICS_HPP
+
+
+
+namespace egglib {
+
+
+    /** \brief Computes Fst and Fit from haploid data
+    *
+    * The class requires loading data. Data are loaded by haploid
+    * (one genotype per individual). The analyses are cached: they are
+    * performed upon the first call to statistics accessors. The cache
+    * is emptied whenever a datum is loaded.
+    *
+    * The computations are performed after Weir and Cockerham. The
+    * statistic theta is generalized for multiple alleles. To allow
+    * computation of multi-locus statistics, variance components are
+    * also available. The two components of the variance are T1 and T2
+    * and theta is T1/T2 (from Weir 1996 "Genetic Data Analysis II",
+    * Sinauer associates, Sunderland MA).
+    *
+    * \ingroup polymorphism
+    *
+    */
+    class HFStatistics {
+
+        public:
+
+           /** \brief Constructor
+            *
+            */
+            HFStatistics();
+
+
+           /** \brief Destructor
+            *
+            */
+            virtual ~HFStatistics();
+
+
+           /** \brief Reserve sufficient memory for a given number of
+            * individuals.
+            *
+            * This method makes the load function faster by allocating
+            * all required memory at once.
+            *
+            * \param numberOfIndividuals a strictly positive integer.
+            *
+            */
+            void reserve(unsigned int numberOfIndividuals);
+
+
+           /** \brief Loads the data for one individual
+            *
+            * \param genotype an integer giving the allele.
+            * \param populationLabel an integer indication belonging to
+            * a population.
+            *
+            * Genotypes and population labels are not required to be
+            * consecutive (both are labels, not indices). They are
+            * internally mapped to indices (the mapping can be obtained
+            * by accessors populationLabel and allele).
+            *
+            * All genotypes are considered to be valid (no missing data).
+            * If statistics were computed previous to call to this
+            * function, all data will be erased.
+            *
+            */
+            void loadIndividual(unsigned int genotype, unsigned int populationLabel);
+
+
+           /** \brief Label of a population
+            *
+            * The index corresponds to the local mapping of populations
+            * regardless of the ranking of population labels. (No out
+            * of bound checking.)
+            *
+            */
+            unsigned int populationLabel(unsigned int populationIndex);
+
+
+           /** \brief Value of an allele
+            *
+            * The index corresponds to the local mapping of alleles
+            * regardless of the ranking of allele values. (No out of
+            * bound checking.)
+            *
+            */
+            unsigned int alleleValue(unsigned int alleleIndex);
+
+
+            /// Allele of a given individual (no checking)
+            unsigned int allele(unsigned int individualIndex) const;
+
+            /// Population label of a given individual (no checking)
+            unsigned int individualLabel(unsigned int individualIndex) const;
+
+
+           /** \brief Number of alleles
+            *
+            */
+            unsigned int numberOfAlleles();
+
+
+           /** \brief Number of populations
+            *
+            */
+            unsigned int numberOfPopulations();
+
+
+           /** \brief Number of loaded genotypes
+            *
+            */
+            unsigned int numberOfGenotypes() const;
+
+
+           /** \brief Absolute total allele frequency
+            *
+            */
+            unsigned int alleleFrequencyTotal(unsigned int alleleIndex);
+
+
+           /** \brief Absolute allele frequency in a population
+            *
+            */
+            unsigned int alleleFrequencyPerPopulation(unsigned int populationIndex, unsigned int alleleIndex);
+
+
+           /** \brief Sample size of a population
+            *
+            */
+            unsigned int populationFrequency(unsigned int populationIndex);
+
+
+           /** \brief Weir-Cockerham theta-statistic
+            *
+            * Note: equivalent to Fst.
+            *
+            */
+            double theta();
+
+
+           /** \brief Between-population component of variance
+            *
+            */
+            double T1();
+
+
+           /** \brief Total variance
+            *
+            */
+            double T2();
+
+
+        protected:
+
+            bool d_flag;
+            void d_init();
+            void d_clear();
+            unsigned int  d_reserved;
+            unsigned int  d_numberOfGenotypes;
+            unsigned int *d_genotypes;
+            unsigned int *d_populationLabels;
+
+            bool s_flag;
+            void s_init();
+            void s_clear();
+            void s_compute();
+            void processPopulations();
+            void processAlleles();
+            unsigned int getPopulationIndex(unsigned int) const;
+            unsigned int getAlleleIndex(unsigned int) const;
+            unsigned int    s_numberOfAlleles;
+            unsigned int   *s_alleleValueMapping;
+            unsigned int    s_numberOfPopulations;
+            unsigned int   *s_populationLabelMapping;
+            unsigned int   *s_populationFrequencies;
+            unsigned int   *s_alleleFrequenciesTotal;
+            unsigned int  **s_alleleFrequenciesPerPopulation;
+
+            bool w_flag;
+            void w_init();
+            void w_clear();
+            void w_compute();
+            double  w_T;
+            double *w_T1;
+            double *w_T2;
+            double  w_nbar;
+            double  w_nc;
+            double *w_pbar;
+            double *w_ssquare;
+            double  w_sum_T1;
+            double  w_sum_T2;
+
+
+        private:
+
+            HFStatistics(const HFStatistics& source) { }
+
+            HFStatistics& operator=(const HFStatistics& source) {
+                return *this;
+            }
+
+    };
+}
+
+#endif

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/HaplotypeDiversity.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/HaplotypeDiversity.hpp Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,176 @@
+/*
+    Copyright 2008-2009 Stéphane De Mita, Mathieu Siol
+
+    This file is part of the EggLib library.
+
+    EggLib is free software: you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation, either version 3 of the License, or
+    (at your option) any later version.
+
+    EggLib is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with EggLib.  If not, see <http://www.gnu.org/licenses/>.
+*/
+
+
+#ifndef EGGLIB_HAPLOTYPEDIVERSITY_HPP
+#define EGGLIB_HAPLOTYPEDIVERSITY_HPP
+
+#include "BaseDiversity.hpp"
+
+namespace egglib {
+
+
+   /** \brief Computes diversity based on haplotype analysis
+    *
+    * \ingroup polymorphism
+    *
+    * This class relies on detection of polymorphic sites, as does
+    * NucleotideDiversity, with the exception that sites with missing
+    * data cannot be processed (minimumExploitableData is enforced to
+    * 1.).
+    *
+    * Like NucleotideDiversity, the same object can be used to analyze
+    * different data sets. Only the call to load() is required before
+    * accessing the data.
+    *
+    * Hst, Gst and Kst are between population differenciation indices.
+    * They are respectively defined in equations 2, 5-6 and 9 of Hudson
+    * et al. 1992a (Molecular Biology and Evolution 9:138-151). Also,
+    * Fst is defined in equation 3 of Hudson et al. 1992b (Genetics
+    * 132:583-589). Finally, Snn is from Hudson 2000 Genetics. It is
+    * computed as the average of Xi for all sequences. Where Xi is the
+    * ratio of nearest neighbours from the same group to the number of
+    * nearest neighbours. Nearest neigbours are all the sequences with
+    * the lowest number of differences to the focal sequence. NOTE:
+    * Gst/Hst are quite similar, but Fst and Kst are more different. Snn
+    * is a different statistic. Gst and Hst are two ways to estimate the
+    * between-population fraction of haplotypic diversity.
+    *
+    */
+    class HaplotypeDiversity : public BaseDiversity {
+
+        public:
+
+           /** \brief Constructor
+            *
+            */
+            HaplotypeDiversity();
+
+           /** \brief Destructor
+            *
+            */
+            virtual ~HaplotypeDiversity();
+
+           /** \brief Identifies polymorphic sites and computes basis
+            * statistics
+            *
+            * \param data an alignment object (subclass of CharMatrix).
+            * The presence of outgroup or of different populations will
+            * be detected based on the populationLabel members of the
+            * passed object. The populationLabel 999 will be interpreted
+            * as outgroups. If several outgroups are passed, sites were
+            * the outgroups are not consistent will be treated as "non-
+            * orientable".
+            *
+            * \param allowMultipleMutations if true, sites with more
+            * than two alleles will not be ignored. The sum of the
+            * frequencies of all alleles not matching the outgroup will
+            * treated as the derived allele frequency (for orientable
+            * sites).
+            *
+            * \param ignoreFrequency removes sites that are polymorph
+            * because of an allele at absolute frequency smaller than or
+            * equal to this value. If ignoreFrequency=1, no sites are
+            * removed, if ignoreFrequency=1, singleton sites are
+            * ignored. Such sites are completely removed from the
+            * analysis (not counted in lseff). Note that if more than
+            * one mutation is allowed, the site is removed only if all
+            * the alleles but one are smaller than or equal to this
+            * value. For example, an alignment column AAAAAAGAAT is
+            * ignored with an ignoreFrequency of 1, but AAAAAAGGAT is
+            * conserved (including the third allele T which is a
+            * singleton).
+            *
+            * \param characterMapping a string giving the list of
+            * characters that should be considered as valid data. If a
+            * space is present in the string, the characters left of the
+            * space will be treated as valid data and the characters
+            * right of the space will be treated as missing data, that
+            * is tolerated but ignored. All characters not in the string
+            * will cause an EggInvalidCharacterError to be raised.
+            *
+            */
+            void load(CharMatrix& data,
+                bool allowMultipleMutations=false,
+                unsigned int ignoreFrequency=0,
+                std::string characterMapping=dnaMapping
+            );
+
+            /// Number of distinct haplotypes
+            unsigned int K() const;
+
+            /// Haplotype diversity (unbiased)
+            double He() const;
+
+            /** \brief Returns the allele number of a given sequence
+             *
+             * The passed index must be given ignoring any outgroup
+             * sequence.
+             *
+             */
+            unsigned int haplotypeIndex(unsigned int) const;
+
+            /// Population differenciation, based on nucleotides (Hudson 1992a)
+            double Kst() const;
+
+            /// Population differenciation, based on nucleotides (Hudson 1992b)
+            double Fst() const;
+
+            /// Population differenciation, based on haplotypes (Nei version)
+            double Gst() const;
+
+            /// Population differenciation, based on haplotypes (Hudson et al. version)
+            double Hst() const;
+
+            /// Hudson's Snn (nearest neighbor statistics)
+            double Snn() const;
+
+
+        protected:
+
+            void init();
+            void clear();
+
+            inline unsigned int diff(CharMatrix& data, unsigned int ind1, unsigned int ind2) const;
+
+            bool m_loaded;
+            unsigned int m_K;
+            double m_He;
+            double m_Kst;
+            double m_Fst;
+            double m_Gst;
+            double m_Hst;
+            double m_Snn;
+            unsigned int *m_haplotypeIndex;
+
+
+        private:
+
+            HaplotypeDiversity(const HaplotypeDiversity& source) {
+
+            }
+
+            HaplotypeDiversity& operator=(const HaplotypeDiversity& source) {
+                return *this;
+            }
+
+    };
+}
+
+#endif

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/LinkageDisequilibrium.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/LinkageDisequilibrium.hpp Fri Jul 10 04:39:30 2015 -0400

b'@@ -0,0 +1,233 @@\n+/*\r\n+ Copyright 2009 St\xe9phane De Mita, Mathieu Siol\r\n+\r\n+ This file is part of the EggLib library.\r\n+\r\n+ EggLib is free software: you can redistribute it and/or modify\r\n+ it under the terms of the GNU General Public License as published by\r\n+ the Free Software Foundation, either version 3 of the License, or\r\n+ (at your option) any later version.\r\n+\r\n+ EggLib is distributed in the hope that it will be useful,\r\n+ but WITHOUT ANY WARRANTY; without even the implied warranty of\r\n+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\r\n+ GNU General Public License for more details.\r\n+\r\n+ You should have received a copy of the GNU General Public License\r\n+ along with EggLib. If not, see <http://www.gnu.org/licenses/>.\r\n+*/\r\n+\r\n+#ifndef EGGLIB_LINKAGEDISEQUILIBRUM_HPP\r\n+#define EGGLIB_LINKAGEDISEQUILIBRUM_HPP\r\n+\n+\r\n+#include "BaseDiversity.hpp"\r\n+#include "EggException.hpp"\r\n+\r\n+\r\n+namespace egglib {\r\n+\r\n+ /** \\brief Analyzes linkage disequilibrium per pair of polymorphic sites\r\n+ *\r\n+ * \\ingroup polymorphism\r\n+ * \r\n+ * The class considers an alignment and detects polymorphic sites\r\n+ * using the BaseDiversity functionality (shared with other classes\r\n+ * of the module). Only sites with exactly two alleles are\r\n+ * considered. Statistics of pairwise linkage disequilibrium can\r\n+ * be accessed by pair index (note that out-of-range errors are not\r\n+ * checked). Population labels are ignored (but outgroups are\r\n+ * excluded from the analysis).\r\n+ *\r\n+ */\r\n+ class LinkageDisequilibrium : public BaseDiversity {\r\n+\r\n+ public:\n+\n+ /// Default constructor\r\n+ LinkageDisequilibrium();\n+\n+ /// Destructor\r\n+ virtual ~LinkageDisequilibrium();\r\n+\r\n+ /** \\brief Analyzes polymorphic sites of an alignment\r\n+ * \r\n+ * \\param data an alignment object (subclass of CharMatrix).\r\n+ * The presence of outgroup or of different populations will\r\n+ * be detected based on the populationLabel members of the\r\n+ * passed object. The populationLabel 999 will be interpreted\r\n+ * as outgroups. If several outgroups are passed, sites were\r\n+ * the outgroups are not consistent will be treated as "non-\r\n+ * orientable".\r\n+ * \r\n+ * \\param minimumExploitableData site where the non-missing\r\n+ * data (as defined by characterMapping) are at a frequency\r\n+ * larger than this value will be removed from the analysis.\r\n+ * Use 1. to take only \'complete\' sites into account and 0.\r\n+ * to use all sites.\r\n+ * \r\n+ * \\param ignoreFrequency removes sites that are polymorphic\r\n+ * because of an allele at absolute frequency smaller than or\r\n+ * equal to this value. If ignoreFrequency=1, no sites are\r\n+ * removed, if ignoreFrequency=1, singleton sites are\r\n+ * ignored. Such sites are completely removed from the\r\n+ * analysis (not counted in lseff). Note that if more than\r\n+ * one mutation is allowed, the site is removed only if all\r\n+ * the alleles but one are smaller than or equal to this\r\n+ * value. For example, an alignment column AAAAAAGAAT is\r\n+ * ignored with an ignoreFrequency of 1, but AAAAAAGGAT is\r\n+ * conserved (including the third allele T which is a\r\n+ * singleton).\r\n+ * \r\n+ * \\param characterMapping a string giving the list of\r\n+ * characters that should be considered as valid data. If a\r\n+ * space is present in the string, the characters left of the\r\n+ * space will be treated as valid data and the characters\r\n+ * right of the space will be treated as missing data, that\r\n+ * is tolerated but ignored. All characters not in the string\r\n+ * will cause an EggInvalidCharacterError to be raised.\r\n+ */\r\n+ void load(CharMatrix& data,\r\n+ double minimumExploitableData=1.,\r\n+ '..b'ir_index);\r\n+\r\n+ /// position of the first site for a given pair\r\n+ unsigned int site1(unsigned int pair_index);\r\n+\r\n+ /// position of the second site for a given pair\r\n+ unsigned int site2(unsigned int pair_index);\r\n+\r\n+ /// correlation coefficient between r2 and distance\r\n+ double correl() const;\r\n+ \r\n+ /** \\brief Computes the minimal number of recombination events\r\n+ * \r\n+ * The computation is performed as described in Hudson, RR and\r\n+ * NL Kaplan. 1985. Statistical properties of the number of\r\n+ * recombination events in the history of a sample of DNA\r\n+ * sequences. Genetics 111: 147-164. The returned parameter is\r\n+ * the minimal number of recombination events, given by the\r\n+ * number of non-overlapping pairs of segregating sites violating\r\n+ * the rule of the four gamete. Only sites with two alleles are\r\n+ * considered. Note that homoplasy (multiple mutations) mimicks\r\n+ * recombination. The result of this function is not stored\r\n+ * in this instance, and re-computed at each call.\r\n+ * \r\n+ * \\param data the same CharMatrix instance as passed to the load\r\n+ * method. The instance must not have been modified.\r\n+ * \r\n+ */\r\n+ unsigned int Rmin(CharMatrix& data) const;\r\n+\r\n+\r\n+\r\n+ protected:\r\n+ \r\n+ // adds a pair of polymorphic sites\r\n+ // assume position2>position1,\r\n+ // sites are polymorphic with exactly 2 alleles\r\n+ void add(CharMatrix& data, unsigned int position1, unsigned int position2);\r\n+\r\n+ // Constructor help\r\n+ void init();\r\n+ \r\n+ // Destructor helper\r\n+ void clear();\r\n+ \r\n+ // Resizes arrays\r\n+ void reset();\r\n+ \r\n+ // Small helper\r\n+ inline double min(double a, double b) { return (a>b)?a:b;}\r\n+\r\n+ // Small helper\r\n+ inline double max(double a, double b) { return (a>b)?b:a;}\r\n+\r\n+ // Small helper\r\n+ inline void check(unsigned int pos) { if (pos>=_n) throw EggRuntimeError("tried to access an invalid index"); }\r\n+\r\n+ /* Performs correlation\r\n+ *\r\n+ * This function works independently from the rest of the class.\r\n+ *\r\n+ * \\param n length of data arrays.\r\n+ * \\param x first data vector.\r\n+ * \\param y second data vector.\r\n+ * \\param r variable to receive the correlation coefficient.\r\n+ * \\param a variable to receive the regression slope.\r\n+ */\r\n+ static void _correl(unsigned int n, const int* x, const double* y, double& r, double& a);\r\n+\r\n+ // Distance between pairs\r\n+ int* _d;\r\n+ \r\n+ // D (classical) measure of LD\r\n+ double *_D;\r\n+ \r\n+ // D\'\r\n+ double *_Dp;\r\n+ \r\n+ // r, correlation coefficient\r\n+ double *_r;\r\n+ \r\n+ // square r\r\n+ double *_r2;\r\n+ \r\n+ // Data array (not managed by the instance)\r\n+ unsigned int *_site1;\r\n+\r\n+ // Data array (not managed by the instance)\r\n+ unsigned int *_site2;\r\n+ \r\n+ // Number of pairs\r\n+ unsigned int _n;\r\n+\r\n+ private:\r\n+ \r\n+ /// Copy constructor not available\r\n+ LinkageDisequilibrium(const LinkageDisequilibrium&) { }\r\n+\r\n+ /// Assignment operator not available\r\n+ LinkageDisequilibrium& operator=(const LinkageDisequilibrium&) {\r\n+ return *this;\r\n+ }\r\n+\r\n+\r\n+ class Interval {\r\n+ public:\r\n+ Interval(unsigned int, unsigned int);\r\n+ unsigned int a() const;\r\n+ unsigned int b() const;\r\n+ bool good() const;\r\n+ void set_false();\r\n+ private:\r\n+ unsigned int _a;\r\n+ unsigned int _b;\r\n+ unsigned int _good;\r\n+ };\r\n+\r\n+\r\n+ };\r\n+}\r\n+\r\n+#endif\r\n'

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/MicrosatelliteDiversity.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/MicrosatelliteDiversity.hpp Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,120 @@
+/*
+    Copyright 2008-2010 St�phane De Mita, Mathieu Siol
+
+    This file is part of the EggLib library.
+
+    EggLib is free software: you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation, either version 3 of the License, or
+    (at your option) any later version.
+
+    EggLib is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with EggLib.  If not, see <http://www.gnu.org/licenses/>.
+*/
+
+#ifndef EGGLIB_MICROSATELLITEDIVERSITY_HPP
+#define EGGLIB_MICROSATELLITEDIVERSITY_HPP
+
+#include "DataMatrix.hpp"
+#include <cstdlib>
+
+namespace egglib {
+
+   /** \brief Analyzes microsatellite data
+    *
+    * \ingroup polymorphism
+    *
+    * Use the load() method to analyze data. All sites will be analyzed
+    * and accessors allow to access the value of a given statistics for
+    * a given site. There is no out-of-bound checking implemented in
+    * accessors.
+    *
+    */
+    class MicrosatelliteDiversity {
+
+          public:
+
+           /** \brief Creates an object
+            *
+            */
+            MicrosatelliteDiversity();
+
+
+           /** \brief Destroys an object
+            *
+            */
+            virtual ~MicrosatelliteDiversity();
+
+
+           /** \brief Performs the analysis
+            *
+            * \param dataMatrix the object to analyze.
+            *
+            * \param missingData the integer identifying missing data.
+            *
+            * \param noMissingData if true, no allele will be
+            * excluded (including the one identified by the argument
+            * missingData).
+            *
+            */
+            void load(const DataMatrix& dataMatrix,
+                    int missingData=999, bool noMissingData=false);
+
+
+            /// Number of sites (or markers)
+            unsigned int numberOfSites() const;
+
+            /// Heterozygosity
+            double He(unsigned int siteIndex) const;
+
+            /// Number of alleles
+            unsigned int numberOfAlleles(unsigned int siteIndex) const;
+
+            /// Variance of allele size
+            double sizeVariance(unsigned int siteIndex) const;
+
+            /// IAM-based estimator of theta
+            double thetaAssumingIAM(unsigned int siteIndex) const;
+
+            /// SMM-based estimator of theta, calculated from He
+            double thetaAssumingSMMfromHe(unsigned int siteIndex) const;
+
+            /// SMM-based estimator of theta, calculated from VarSize
+            double thetaAssumingSMMfromSizeVariance(unsigned int siteIndex) const;
+
+
+        protected:
+
+            unsigned int  v_numberOfSites;
+            double       *v_He;
+            unsigned int *v_numberOfAlleles;
+            double       *v_sizeVariance;
+            double       *v_thetaAssumingIAM;
+            double       *v_thetaAssumingSMMfromHe;
+            double       *v_thetaAssumingSMMfromSizeVariance;
+
+            void init();
+            void clear();
+
+
+        private:
+
+
+            /// No copy allowed
+            MicrosatelliteDiversity(const MicrosatelliteDiversity& source) {
+            }
+
+            /// No copy allowed
+            MicrosatelliteDiversity& operator=(const MicrosatelliteDiversity& source) {
+                return *this;
+            }
+
+    };
+}
+
+#endif

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/Ms.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/Ms.hpp Fri Jul 10 04:39:30 2015 -0400

b'@@ -0,0 +1,199 @@\n+/*\r\n+ Copyright 2008,2009,2011 St\xe9phane De Mita and Mathieu Siol\r\n+\r\n+ This file is part of the EggLib library.\r\n+\r\n+ EggLib is free software: you can redistribute it and/or modify\r\n+ it under the terms of the GNU General Public License as published by\r\n+ the Free Software Foundation, either version 3 of the License, or\r\n+ (at your option) any later version.\r\n+\r\n+ EggLib is distributed in the hope that it will be useful,\r\n+ but WITHOUT ANY WARRANTY; without even the implied warranty of\r\n+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\r\n+ GNU General Public License for more details.\r\n+\r\n+ You should have received a copy of the GNU General Public License\r\n+ along with EggLib. If not, see <http://www.gnu.org/licenses/>.\r\n+*/\r\n+\r\n+#ifndef EGGLIB_GMS_HPP\r\n+#define EGGLIB_GMS_HPP\r\n+\r\n+#include "DataMatrix.hpp"\r\n+#include <string>\r\n+#include <istream>\r\n+\r\n+namespace egglib {\r\n+\r\n+ /** \\brief ms-like sequence format parser\r\n+ * \r\n+ * The class provides parsing (input) and formatting (output)\r\n+ * operations in ms format, that is the format used by Richard\r\n+ * Hudson\'s program ms for outputting genotypes and by the\r\n+ * associated program samplestat for reading them. Both types of\r\n+ * operations are available through static methods using either\r\n+ * a string or a stream (which can be a stream to or from a file\r\n+ * or a string). In either case, types from the STL are used.\r\n+ * Although ms deals only with data coded with 0 and 1, the class Ms\r\n+ * offers the possibility of both importing and exporting data coded\r\n+ * with by integer. All methods have an option named "separated". If\r\n+ * this option is true, the parser or formatter introduces a slight\r\n+ * modification of the format: genotypes individual data are\r\n+ * separated by a white space ("1 0 1 1" instead of "1011", allowing\r\n+ * genotype values larger than 9: "1 0 11 1").\r\n+ *\r\n+ * \\ingroup core\r\n+ *\r\n+ */\r\n+ class Ms {\r\n+\r\n+ public:\r\n+ \r\n+ /** \\brief Imports a sequence alignment\r\n+ * \r\n+ * Creates a istringstream from the string and calls the\r\n+ * overloaded method.\r\n+ * \r\n+ * \\param str the string to parse.\r\n+ * \\param ns the expected number of sequences.\r\n+ * \\param separated true if a white space separator is placed\r\n+ * between genotype at each site.\r\n+ *\r\n+ * \\return A sequence alignment as a data matrix.\r\n+ */\r\n+ static DataMatrix get(std::string, unsigned int ns, bool separated=false);\r\n+\r\n+\r\n+ /** \\brief Imports a sequence alignment\r\n+ * \r\n+ * Attemps to generate a DataMatrix object from the stream.\r\n+ * Reads only one simulation and throws a SeqlibFormatError\r\n+ * exception in case of format error.\r\n+ * \r\n+ * Allows any number of white lines before the //, but no other\r\n+ * data. Supports \\r at the end of lines (before the \\n).\r\n+ * Accepted symbols are all integers (0-9).\r\n+ *\r\n+ * \\param stream the stream to parse.\r\n+ * \\param ns the expected number of sequences.\r\n+ * \\param separated true if a white space separator is placed\r\n+ * between genotype at each site.\r\n+ * \r\n+ * \\return A sequence alignment as a data matrix.\r\n+ */\r\n+ static DataMatrix get(std::istream& stream, unsigned int ns, bool separated=false);\r\n+\r\n+\r\n+ /** \\brief Exports a sequence alignment\r\n+ * \r\n+ * Internally creates a stringstream, calls the overloaded method\r\n+ * and returns the outcome.\r\n+ *\r\n+ * \\param dataMatrix the alignment object to write.\r\n+ * \\param separated true if a white space separator must be placed\r\n+ * between the genotype at each site.\r\n+ * \r\n+ */\r\n+ static std::string format(DataMatrix& dataMatrix, bool separated=false);\r\n+ '..b'd string to the stream \'on the fly\'. The\r\n+ * formatted string is guaranteed to starts with a // line and\r\n+ * ends with an empty line. The client is expected to take care\r\n+ * of writing any header and add an additional white line between\r\n+ * simulations if needed. The method throws a SeqlibRuntimeError\r\n+ * if the stream is not writable. The data matrix should contain\r\n+ * only data within range 0-9 if separated is false (default) and\r\n+ * any positive (>=0) integer if separated is true. Note that\r\n+ * output generated with separated=true is never compatible with\r\n+ * the original ms format, and that output generated with\r\n+ * separator=false is compatible with the original ms format only\r\n+ * if all alleles are 0 or 1 (which is not checked by this\r\n+ * formatted).\r\n+ * \r\n+ * \\param stream the stream (file or string stream) where to\r\n+ * write the output.\r\n+ * \\param dataMatrix the alignment object to write.\r\n+ * \\param separated true if a white space separator must be placed\r\n+ * between the genotype at each site.\r\n+ * \r\n+ */\r\n+ static void format(std::ostream& stream, DataMatrix& dataMatrix, bool separated=false);\r\n+\r\n+\r\n+ /** \\brief Returns the last tMRCA read by any Ms instance\r\n+ * \r\n+ * If a tMRCA value was present in the last simulation read by\r\n+ * any Ms instance, it will be returned by this method. A value\r\n+ * of -1. is returned if no simulation was read, or if the last\r\n+ * simulation didn\'t contain a tMRCA value or if the last\r\n+ * simulation provoked an exception before reaching the tMRCA\r\n+ * line.\r\n+ * \r\n+ */\r\n+ static double tMRCA();\r\n+\r\n+\r\n+ /** \\brief Returns the last "prob" read by any Ms instance\r\n+ * \r\n+ * "prob" is returned by ms when a fixed number of segregating\r\n+ * sites is used in conjunction with a theta value. If a "prob"\r\n+ * value was present in the last simulation read by any Ms\r\n+ * instance, it will be returned by this method. A value of -1\r\n+ * is returned if no simulation was read, or if the last\r\n+ * simulation didn\'t contain a "prob" value or if the last\r\n+ * simulation provoked an exception before reaching the "prob"\r\n+ * line.\r\n+ * \r\n+ */\r\n+ static double prob();\r\n+ \r\n+\r\n+ /** \\brief Returns the tree string found in the last simulation read by any Ms instance\r\n+ * \r\n+ * If one or more trees were present in the last simulation read\r\n+ * by any Ms instance, they will be returned as a unique string\r\n+ * by this method. An empty string is returned if no simulation\r\n+ * was read, or if the last simulation, or if the last simulation\r\n+ * didn\'t contain any tree value or if the last simulation\r\n+ * provoked an exception before reaching the tree line.\r\n+ * \r\n+ * Note: the trees are returned as a single line.\r\n+ * \r\n+ */\r\n+ static std::string trees();\r\n+\r\n+ \r\n+ private:\r\n+ // Line parser (the last \\n is extracted and discarded - no error upon EOF)\r\n+ std::string next_line(std::istream& stream);\r\n+ \r\n+ /// tMRCA (-1 if not found in ms output)\r\n+ static double _tMRCA;\r\n+ \r\n+ /// probability (-1 if not found in ms output)\r\n+ static double _prob;\r\n+ \r\n+ /// tree string (maybe contain several trees) (empty string if not found in ms output)\r\n+ static std::string _trees;\r\n+\r\n+ \r\n+ /// No instantiation allowed\r\n+ Ms() { }\r\n+ \r\n+ /// A fortiori no destruction allowed\r\n+ ~Ms() { }\r\n+\r\n+ /// No copy allowed\r\n+ Ms(const Ms&) { }\r\n+\r\n+ /// No copy allowed\r\n+ Ms& operator=(const Ms&) { return *this; }\r\n+ \r\n+ };\r\n+}\r\n+ \r\n+#endif\r\n'

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/Mutation.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/Mutation.hpp Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,63 @@
+/*
+    Copyright 2009-2010 St�phane De Mita, Mathieu Siol
+
+    This file is part of the EggLib library.
+
+    EggLib is free software: you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation, either version 3 of the License, or
+    (at your option) any later version.
+
+    EggLib is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with EggLib.  If not, see <http://www.gnu.org/licenses/>.
+*/
+
+#ifndef EGGLIB_MUTATION_HPP
+#define EGGLIB_MUTATION_HPP
+
+#include <vector>
+#include "Edge.hpp"
+
+namespace egglib {
+
+   /** \brief Very simple container of some information relative to a mutation
+    *
+    * \ingroup coalesce
+    *
+    */
+    class Mutation {
+
+        public:
+
+            /// Default constructor
+            Mutation();
+
+            /// Age
+            //double age;
+
+            /// Mutation index (for finding in Edge)
+            unsigned int actualSiteIndex;
+
+            /// Position
+            double position;
+
+            /// Segment index
+            unsigned int segmentIndex;
+
+            /// Pointer to edge
+            //const Edge* edge;
+
+        private:
+
+            void init();
+
+    };
+
+}
+
+#endif

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/Mutator.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/Mutator.hpp Fri Jul 10 04:39:30 2015 -0400

[

b'@@ -0,0 +1,397 @@\n+/*\r\n+ Copyright 2009, 2010, 2012 St\xe9phane De Mita, Mathieu Siol\r\n+\r\n+ This file is part of the EggLib library.\r\n+\r\n+ EggLib is free software: you can redistribute it and/or modify\r\n+ it under the terms of the GNU General Public License as published by\r\n+ the Free Software Foundation, either version 3 of the License, or\r\n+ (at your option) any later version.\r\n+\r\n+ EggLib is distributed in the hope that it will be useful,\r\n+ but WITHOUT ANY WARRANTY; without even the implied warranty of\r\n+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\r\n+ GNU General Public License for more details.\r\n+\r\n+ You should have received a copy of the GNU General Public License\r\n+ along with EggLib. If not, see <http://www.gnu.org/licenses/>.\r\n+*/\r\n+\r\n+#ifndef EGGLIB_MUTATOR_HPP\r\n+#define EGGLIB_MUTATOR_HPP\r\n+\r\n+\r\n+#include "DataMatrix.hpp"\r\n+#include "Random.hpp"\r\n+#include "Arg.hpp"\r\n+#include "Mutation.hpp"\r\n+\r\n+\r\n+namespace egglib {\r\n+ \r\n+\r\n+ /** \\brief Implements mutation models\r\n+ *\r\n+ * \\ingroup coalesce\r\n+ * \r\n+ * Works with a previously built Ancestral Reconbination Graph. The\r\n+ * user must sets options using the setter-based interface. After\r\n+ * that he or she can call the method mute() that will generates\r\n+ * a DataMatrix object.\r\n+ * \r\n+ * Genotype data are represented by integer numbers. Regardless of\r\n+ * the mutation model, the ancestral state is always 0. The user can\r\n+ * set the rate of mutation (or, alternatively, fix the number of\r\n+ * mutations that occurred - which is the number of segregating sites\r\n+ * only with an infinite site model).\r\n+ * \r\n+ * Other options fall into two separate groups: the positions of the\r\n+ * mutated sites and the process of mutation (how new alleles are\r\n+ * generated).\r\n+ * \r\n+ * Concerning allele generation, several mutation models are available\r\n+ * (coded by single letters):\r\n+ * - F: fixed number of alleles. Among other markers, this model is\r\n+ * appropriate for simulating nucleotides. The user is able\r\n+ * to choose the number of alleles (where 2 is the standard\r\n+ * for an infinite site model and 4 for a finite site model).\r\n+ * Mutator allows assigning independent weights between all\r\n+ * different transition types and can draw randomly the\r\n+ * ancestral states, providing a way to emulate evolution of\r\n+ * nucleotides with multiple mutations at the same site and\r\n+ * reversion.\r\n+ * - I: infinite number of alleles. At a given site, each mutation\r\n+ * raises a new allele. The value of the alleles is therefore\r\n+ * irrelevant (it only denotes its order of appearance). This\r\n+ * model does not permit homoplasy.\r\n+ * - S: stepwise mutation model. In this model the value of the\r\n+ * alleles are interpreted as a size (typically for simulating\r\n+ * a microsatellite marker). Each mutation either increases\r\n+ * or decreases the allele size by an increment of one.\r\n+ * - T: two-phase mutation model. This model is a generalization\r\n+ * of the stepwise mutation model (S). For a mutation, the\r\n+ * increment (either increase or decrease) is 1 with the\r\n+ * probability given by the parameter (1-TPMproba). With\r\n+ * probability TPMproba, the increment is drawn from a\r\n+ * geometric distribution of parameter given by the other\r\n+ * parameter (TPMparam).\r\n+ * \r\n+ * By default, the program will assume an infinite site model (ISM).\r\n+ * Each mutation will occur to a new position drawn from the interval\r\n+ * [0,1]. It is possible to set any mutation model with an ISM \r\n+ * (including microsatellite-like models I, S and T). Alternatively,\r\n+ * the user can specify a finite number of sites available for\r\n+ * mutation. For a microsatellite mark'..b'del). It gives the parameter\r\n+ * of the geometric distribution which is used to generate\r\n+ * the mutation step (if it is not one).\r\n+ * \r\n+ * The value must be >=0. and <=1. \r\n+ * \r\n+ */\r\n+ void TPMparam(double value);\r\n+\r\n+\r\n+ /** \\brief Gets the number of mutable sites\r\n+ * \r\n+ * A value a zero must be interpreted as the infinite site\r\n+ * model. Note that after all calls all data from the tables\r\n+ * sitePositions and siteWeights will be reset.\r\n+ * \r\n+ */\r\n+ unsigned int numberOfSites() const;\r\n+ \r\n+ \r\n+ /** \\brief Sets the number of mutable sites\r\n+ * \r\n+ * The value of zero is accepted and imposed the infinite\r\n+ * site model.\r\n+ * \r\n+ */\r\n+ void numberOfSites(unsigned int);\r\n+ \r\n+ \r\n+ /** \\brief Gets the position of a given site\r\n+ * \r\n+ */\r\n+ double sitePosition(unsigned int siteIndex) const;\r\n+\r\n+ \r\n+ /** \\brief Set the position of a given site\r\n+ * \r\n+ * The position must be >=0 and <=1\r\n+ * \r\n+ */\r\n+ void sitePosition(unsigned int siteIndex, double position);\r\n+\r\n+\r\n+ /** \\brief Gets the mutation weight of a given site\r\n+ * \r\n+ */\r\n+ double siteWeight(unsigned int siteIndex) const;\r\n+\r\n+ \r\n+ /** \\brief Set the site weight of a given site\r\n+ * \r\n+ * The weight must be strictly positive.\r\n+ * \r\n+ */\r\n+ void siteWeight(unsigned int siteIndex, double weight);\r\n+\r\n+\r\n+ /** \\brief Performs mutation\r\n+ * \r\n+ * \\param arg Ancestral recombination graph instance. If the\r\n+ * ARG is partially built or not a all, or improperly so,\r\n+ * the behaviour of this method is not defined.\r\n+ * \r\n+ * \\param random The address of a Random instance to be\r\n+ * used for generating random numbers.\r\n+ * \r\n+ * \\return A DataMatrix instance containing simulated data.\r\n+ * \r\n+ */\r\n+ DataMatrix mute(Arg* arg, Random* random);\r\n+\r\n+\r\n+ /** \\brief Gets the last number of mutations\r\n+ *\r\n+ * Returns the number of mutations of the last call of mute( ).\r\n+ * By default, this method returns 0.\r\n+ *\r\n+ */\r\n+ unsigned int numberOfMutations() const; \r\n+\r\n+\r\n+ private:\r\n+ \r\n+ void clear();\r\n+ void init();\r\n+ void copy(const Mutator&);\r\n+\r\n+ //int nextAllele(int allele, Random* random);\r\n+ int TPMstep(double inTPMproba, Random* random);\r\n+ void apply_mutation(unsigned int matrixIndex,\r\n+ unsigned int actualSite, DataMatrix& data,\r\n+ const Edge* edge, int allele,\r\n+ unsigned int segment, Random* random);\r\n+\r\n+ \r\n+ char _model;\r\n+ double _mutationRate;\r\n+ unsigned int _fixedNumberOfMutations;\r\n+ unsigned int _numberOfAlleles;\r\n+ double** _transitionWeights;\r\n+ bool _randomAncestralAllele;\r\n+ unsigned int _numberOfSites;\r\n+ double* _sitePositions;\r\n+ double* _siteWeights;\r\n+ double _TPMproba;\r\n+ double _TPMparam;\r\n+ int maxAllele;\r\n+ unsigned int _numberOfMutations;\r\n+ std::vector<Mutation> _cache_mutations;\r\n+ unsigned int _cache_mutations_reserved;\r\n+\r\n+ };\r\n+\r\n+\r\n+ bool compare(Mutation mutation1, Mutation mutation2); // returns True if mutation1 is older\r\n+\r\n+}\r\n+\r\n+\r\n+\r\n+\r\n+#endif\r\n+\r\n'

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/NucleotideDiversity.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/NucleotideDiversity.hpp Fri Jul 10 04:39:30 2015 -0400

b'@@ -0,0 +1,377 @@\n+/*\r\n+ Copyright 2008-2009 St\xc3\xa9phane De Mita, Mathieu Siol\r\n+\r\n+ This file is part of the EggLib library.\r\n+\r\n+ EggLib is free software: you can redistribute it and/or modify\r\n+ it under the terms of the GNU General Public License as published by\r\n+ the Free Software Foundation, either version 3 of the License, or\r\n+ (at your option) any later version.\r\n+\r\n+ EggLib is distributed in the hope that it will be useful,\r\n+ but WITHOUT ANY WARRANTY; without even the implied warranty of\r\n+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\r\n+ GNU General Public License for more details.\r\n+\r\n+ You should have received a copy of the GNU General Public License\r\n+ along with EggLib. If not, see <http://www.gnu.org/licenses/>.\r\n+*/\r\n+\r\n+\r\n+#ifndef EGGLIB_NUCLEOTIDEDIVERSITY_HPP\r\n+#define EGGLIB_NUCLEOTIDEDIVERSITY_HPP\r\n+\r\n+\r\n+#include "BaseDiversity.hpp"\r\n+#include <string>\r\n+#include <vector>\r\n+\r\n+\r\n+\r\n+namespace egglib {\r\n+\r\n+\r\n+ /** \\brief Performs analyzes of population genetics\r\n+ *\r\n+ * \\ingroup polymorphism\r\n+ * \r\n+ * This class computes several summary statistics based on\r\n+ * nucleotide analysis. Note that it is possible to use the same\r\n+ * object to analyze different data set. Calling the load() method\r\n+ * erases all data preivously computed (if any). Calling the load()\r\n+ * method is absolutely required to compute any statistics. Some\r\n+ * statistics are not computed by default, but are if the\r\n+ * corresponding accessor is used (only load() is required).\r\n+ * \r\n+ * Note that "unsecure" accessors don\'t perform out-of-bound checks.\r\n+ * \r\n+ * S is the number of varying sites (only in sites that were not\r\n+ * rejected).\r\n+ * \r\n+ * eta is the minimum number of mutations, that is the sum of the\r\n+ * number of alleles minus 1 for each varying site. eta = S if all\r\n+ * sites have no variant or 2 alleles. eta is computed independently\r\n+ * of the option multiple and IS NOT computed over lseff sites.\r\n+ *\r\n+ * Pi is the average number of pairwise differences between sequences\r\n+ * (expressed here per site) or (as computed here) the mean per site\r\n+ * (unbiased) heterozygosity. Pi is zero if no polymorphic sites.\r\n+ *\r\n+ * D is the Tajima\'s test of neutrality\r\n+ * Ref. Tajima F.: Statistical method for testing the neutral\r\n+ * mutation hypothesis by DNA polymorphism. Genetics 1989, 123:585-595.\r\n+ * It is arbitrary set to 0 if no polymorphic sites.\r\n+ *\r\n+ * tW: thetaW: estimator of theta based on polymorphic sites (ref.\r\n+ * e.g. Watterson 1975 Theor. Pop. Biol.).\r\n+ * Both D and thetaW are computed assuming that rounded nseff samples\r\n+ * have been sampled.\r\n+ * The variance of D is computed using rounded nseff instead of ns.\r\n+ *\r\n+ * H is the Fay and Wu\'s test of neutrality.\r\n+ * Z is the standardized version and E a similar test.\r\n+ * Ref. Fay J. C., Wu C.-I.: Hitchhiking under positive Darwinian\r\n+ * selection. Genetics 2000, 155:1405-1413. and Zeng K., Fu Y. X.,\r\n+ * Shi S., Wu C.-I.: Statistical tests for detecting positive\r\n+ * selection by utilizing high-frequency variants. Genetics 2006,\r\n+ * 174:1431-9. Both are arbitrary set to 0 if no polymorphic or\r\n+ * orientable sites.\r\n+ *\r\n+ * tH and tL: theta H: estimators of theta based on derived\r\n+ * polymorphic sites (ref in Fay and Wu and Zeng al.). The variance\r\n+ * of H/Z are computed assuming that rounded nseff samples have\r\n+ * been sampled.\r\n+ * \r\n+ */\r\n+ class NucleotideDiversity : public BaseDiversity {\r\n+\r\n+ public:\r\n+\r\n+ /** \\brief Builds an object\r\n+ * \r\n+ */\r\n+ NucleotideDiversity();\r\n+\r\n+\r\n+ /** \\brief Destroys an object\r\n+ * \r\n+ */\r\n+ virtual ~NucleotideDiversity();\r\n+\r\n+\r\n+ /** \\brief Identifies polymorphic sites and computes basis\r\n+ '..b" * - 1: A&G A G specific 1 + fixed 2-3\r\n+ * - 2: A A&G A specific 2\r\n+ * - 3: A A&G G specific 2 + fixed 1-3\r\n+ * - 4: A A A&G specific 3\r\n+ * - 5: A G A&G specific 3 + fixed 1-2\r\n+ * - 6: A&G A&G A shared 1-2\r\n+ * - 7: A&G A A&G shared 1-3\r\n+ * - 8: A A&G A&G shared 2-3\r\n+ * - 9: A&G A&G A&G shared 1-2-3\r\n+ * - 10: A G G fixed 1\r\n+ * - 11: A G A fixed 2\r\n+ * - 12: A A G fixed 3\r\n+ *\r\n+ * \\param index must be an index from 0 to 12.\r\n+ * \r\n+ */\r\n+ unsigned int triConfiguration(unsigned int index);\r\n+\r\n+\r\n+ /// Builds and returns the vector of positions of all polymorphic sites\r\n+ std::vector<unsigned int> polymorphic_positions() const;\r\n+\r\n+\r\n+ /** \\brief Builds and returns the vector of positions of all singleton sites\r\n+ * \r\n+ * A site singleton when it is polymorphic according to\r\n+ * parameter of the diversity analysis, when it has exactly two\r\n+ * alleles and one of them is at absolute frequency 1 (one\r\n+ * copy) disregarding the outgroup.\r\n+ * \r\n+ */\r\n+ std::vector<unsigned int> singleton_positions() const;\r\n+\r\n+\r\n+ protected:\r\n+\r\n+ /** \\brief This class cannot be copied\r\n+ * \r\n+ */\r\n+ NucleotideDiversity(const NucleotideDiversity& source) { }\r\n+\r\n+\r\n+ /** \\brief This class cannot be copied\r\n+ * \r\n+ */\r\n+ NucleotideDiversity& operator=(const NucleotideDiversity& source) { return *this; }\r\n+\r\n+\r\n+ void init(); // initializes values\r\n+ void clear(); // free memory but doesn't initializes\r\n+ \r\n+ // diversity (without outgroup)\r\n+ void diversity();\r\n+ \r\n+ // diversity with outgroup\r\n+ void outgroupDiversity();\r\n+ \r\n+ // site patterns\r\n+ void differentiation();\r\n+ \r\n+ // triconfigurations\r\n+ void triConfigurations();\r\n+ \r\n+\r\n+ // holders for statistics, with booleans flagging groups of stats\r\n+ \r\n+ bool b_analysisSites;\r\n+ \r\n+ bool b_diversity;\r\n+ \r\n+ double v_Pi; // nucleotide diversity\r\n+ double v_thetaW; // theta (Watterson estimator)\r\n+ double v_average_Pi; // average diversity across populations\r\n+ double *v_pop_Pi; // diversity per population\r\n+ double v_D; // Tajima's D\r\n+ \r\n+ bool b_outgroupDiversity;\r\n+ \r\n+ double v_thetaH; // theta (Fay and Wu estimator)\r\n+ double v_thetaL; // theta (Zeng estimator)\r\n+ double v_H; // Fay and Wu's H\r\n+ double v_Z; // normalized Fay and Wu's H\r\n+ double v_E; // Zeng et al.'s E\r\n+ \r\n+ bool b_differentiation;\r\n+ \r\n+ unsigned int *v_pairwiseFixedDifferences;\r\n+ unsigned int *v_pairwiseCommonAlleles;\r\n+ unsigned int *v_pairwiseSharedAlleles;\r\n+ unsigned int *v_popPolymorphic;\r\n+ unsigned int *v_popSpecific;\r\n+ unsigned int *v_popSpecificDerived;\r\n+ unsigned int v_countFixedDifferences;\r\n+ unsigned int v_countCommonAlleles;\r\n+ unsigned int v_countSharedAlleles;\r\n+ unsigned int v_countSpecificAlleles;\r\n+ unsigned int v_countSpecificDerivedAlleles;\r\n+ \r\n+ \r\n+ bool b_triConfigurations;\r\n+ \r\n+ unsigned int *v_triConfigurations;\r\n+\r\n+ };\r\n+}\r\n+\r\n+#endif\r\n"

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/ParamSet.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/ParamSet.hpp Fri Jul 10 04:39:30 2015 -0400

b'@@ -0,0 +1,279 @@\n+/*\r\n+ Copyright 2009-2010 St\xe9phane De Mita, Mathieu Siol\r\n+\r\n+ This file is part of the EggLib library.\r\n+\r\n+ EggLib is free software: you can redistribute it and/or modify\r\n+ it under the terms of the GNU General Public License as published by\r\n+ the Free Software Foundation, either version 3 of the License, or\r\n+ (at your option) any later version.\r\n+\r\n+ EggLib is distributed in the hope that it will be useful,\r\n+ but WITHOUT ANY WARRANTY; without even the implied warranty of\r\n+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\r\n+ GNU General Public License for more details.\r\n+\r\n+ You should have received a copy of the GNU General Public License\r\n+ along with EggLib. If not, see <http://www.gnu.org/licenses/>.\r\n+*/\r\n+\r\n+#ifndef EGGLIB_PARAMSET_HPP\r\n+#define EGGLIB_PARAMSET_HPP\r\n+\r\n+\r\n+#include "DataMatrix.hpp"\r\n+\r\n+\r\n+namespace egglib {\r\n+\r\n+ class Change;\r\n+ class Controller;\r\n+\r\n+\r\n+ /** \\brief Set of parameters\r\n+ *\r\n+ * \\ingroup coalesce\r\n+ *\r\n+ */\r\n+ class ParamSet {\r\n+\r\n+ public:\r\n+ \r\n+ /** \\brief Default constructor\r\n+ *\r\n+ * Initializes all parameters to reasonnable values (except\r\n+ * that the sample size is null: 1 population, 0 samples,\r\n+ * selfing rate of 0, recombination rate of 0, growth rate of\r\n+ * 0, population size of 1 and no changes.\r\n+ *\r\n+ */\r\n+ ParamSet();\r\n+\r\n+ /** \\brief Destructor\r\n+ * \r\n+ */\r\n+ ~ParamSet();\r\n+ \r\n+ /** \\brief Copy constructor\r\n+ * \r\n+ */\r\n+ ParamSet(const ParamSet&);\r\n+ \r\n+ /** \\brief Assignment operator\r\n+ * \r\n+ */\r\n+ ParamSet& operator=(const ParamSet&);\r\n+\r\n+ /** \\brief Restores default value of all parameters\r\n+ * \r\n+ */\r\n+ void reset();\r\n+\r\n+ /** \\brief Gets the number of populations\r\n+ * \r\n+ */\r\n+ unsigned int numberOfPopulations() const;\r\n+ \r\n+ /** \\brief Gets a pairwise migration rate\r\n+ * \r\n+ * It is allowed to access a diagonal value. Diagonal\r\n+ * values contain the sum of values of the corresponding\r\n+ * line (diagonal cell excepted, of course).\r\n+ * \r\n+ */\r\n+ double pairwiseMigrationRate(unsigned int source, unsigned int dest) const;\r\n+ \r\n+ /** \\brief Sets a pairwise migration rate\r\n+ * \r\n+ * It is not allowed to set a value on the diagonal (this\r\n+ * would raise an exception). The method takes care of\r\n+ * modifying the diagonal accordingly (still this is not\r\n+ * relevant for the client);\r\n+ * \r\n+ */\r\n+ void pairwiseMigrationRate(unsigned int source, unsigned int dest, double value);\r\n+ \r\n+ /** \\brief Sets the migration rate for all matrix\r\n+ * \r\n+ */\r\n+ void migrationRate(double value);\r\n+ \r\n+ /** \\brief Gets a population size\r\n+ * \r\n+ */\r\n+ double populationSize(unsigned int populationIndex) const;\r\n+ \r\n+ /** \\brief Sets a population size\r\n+ * \r\n+ * The size must be strictly positive.\r\n+ * \r\n+ */\r\n+ void populationSize(unsigned int populationIndex, double value);\r\n+ \r\n+ /** \\brief Gets a growth rate\r\n+ * \r\n+ */\r\n+ double growthRate(unsigned int populationIndex) const;\r\n+ \r\n+ /** \\brief Sets a growth rate\r\n+ * \r\n+ */\r\n+ void growthRate(unsigned int populationIndex, double value);\r\n+ \r\n+ /** \\brief Gets the recombination rate\r\n+'..b'e is planned.\r\n+ * \r\n+ */\r\n+ double nextChangeDate() const;\r\n+ \r\n+ /** \\brief Applies the next change event\r\n+ * \r\n+ * \\param controller the Change event might need to have\r\n+ * access to simulation controller (to trigger coalescent\r\n+ * events, for example).\r\n+ * \r\n+ */\r\n+ void nextChangeDo(Controller* controller);\r\n+ \r\n+ /** \\brief Gets the number of single sample from a population\r\n+ * \r\n+ */\r\n+ unsigned int singles(unsigned int populationIndex) const;\r\n+\r\n+ /** \\brief Sets the number of single sample from a population\r\n+ * \r\n+ */\r\n+ void singles(unsigned int populationIndex, unsigned int value);\r\n+\r\n+ /** \\brief Gets the number of double sample from a population\r\n+ * \r\n+ */\r\n+ unsigned int doubles(unsigned int populationIndex) const;\r\n+\r\n+ /** \\brief Sets the number of double sample from a population\r\n+ * \r\n+ */\r\n+ void doubles(unsigned int populationIndex, unsigned int value);\r\n+ \r\n+ /** \\brief Computes the total number of samples\r\n+ * \r\n+ */\r\n+ unsigned int numberOfSamples() const;\r\n+ \r\n+ /** \\brief Gives the date of the last size change\r\n+ * \r\n+ * \\param populationIndex the index of the population.\r\n+ * \\return The date where the last change occurred, or 0. if\r\n+ * no change occurred during the simulation.\r\n+ *\r\n+ */\r\n+ double dateOfLastChange(unsigned int populationIndex) const;\r\n+\r\n+\r\n+ /** \\brief Sets the date of the last size change\r\n+ * \r\n+ * \\param populationIndex the index of the population.\r\n+ * \\param date the date where the last change occurred, or 0.\r\n+ * if no change occurred during the simulation.\r\n+ *\r\n+ */\r\n+ void dateOfLastChange(unsigned int populationIndex, double date) const;\r\n+\r\n+ \r\n+ /** \\brief Set groups labels\r\n+ * \r\n+ * Sets the group labels of the DataMatrix, according to the\r\n+ * current state of population structure, and assuming that\r\n+ * the DataMatrix was generated by the class Arg.\r\n+ * \r\n+ * \\param dataMatrix the DataMatrix object to modify. The\r\n+ * number of sequences must match the total number of samples\r\n+ * defined by the ParamSet object this method is called on.\r\n+ * \r\n+ * \\param labelIndividuals by default, labels the different\r\n+ * samples depending on the population they come from (0\r\n+ * being the label of the first population). If this flag is\r\n+ * set to true, then the samples are labelled depending on\r\n+ * the individual they come from, regardless of populations.\r\n+ * In that case there can be only one or two genes for a\r\n+ * given group label.\r\n+ * \r\n+ */\r\n+ void setGroups(DataMatrix& dataMatrix, bool labelIndividuals=false);\r\n+\r\n+ private:\r\n+\r\n+ void clear();\r\n+ void init();\r\n+ void copy(const ParamSet&);\r\n+ \r\n+ double _selfingRate;\r\n+ double _recombinationRate;\r\n+ unsigned int _numberOfSegments;\r\n+ unsigned int _numberOfPopulations;\r\n+ unsigned int* _singles;\r\n+ unsigned int* _doubles;\r\n+ double* _growthRates;\r\n+ double* _populationSize;\r\n+ double* _dateOfLastChange;\r\n+ double** migrationMatrix;\r\n+ unsigned int _numberOfChanges;\r\n+ unsigned int nextChangeIndex;\r\n+ Change const** changes;\r\n+ };\r\n+\r\n+}\r\n+\r\n+#endif\r\n'

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/Population.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/Population.hpp Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,143 @@
+/*
+    Copyright 2009-2010 St�phane De Mita, Mathieu Siol
+
+    This file is part of the EggLib library.
+
+    EggLib is free software: you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation, either version 3 of the License, or
+    (at your option) any later version.
+
+    EggLib is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with EggLib.  If not, see <http://www.gnu.org/licenses/>.
+*/
+
+#ifndef EGGLIB_POPULATION_HPP
+#define EGGLIB_POPULATION_HPP
+
+
+#include "Edge.hpp"
+
+namespace egglib {
+
+    class Random;
+
+   /** \brief Handles a single population
+    *
+    * \ingroup coalesce
+    *
+    */
+    class Population {
+
+        public:
+
+           /** \brief Default constructor
+            *
+            * Generates an empty population.
+            *
+            */
+            Population();
+
+           /** \brief Copy constructor
+            *
+            */
+            Population(const Population& source);
+
+           /** \brief Assignment operator
+            *
+            */
+            Population& operator=(const Population& source);
+
+           /** \brief Destructor
+            *
+            * The object only cleans Edge objects currently stored in it.
+            *
+            */
+            ~Population();
+
+           /** \brief Standard constructor
+            *
+            * The Edge instances will be handled by address and they
+            * MUST be passed using the method set().
+            *
+            * \param numberOfSegments number of recombining segments.
+            *
+            * \param numberOfLineages the number of lineages contained
+            * in this population.
+            *
+            * \param firstIndex the absolute index (or ID) of the first
+            * lineage (the other will have consecutive incremented
+            * ID's).
+            *
+            */
+            Population(unsigned int numberOfSegments,
+                    unsigned int numberOfLineages, unsigned firstIndex);
+
+           /** \brief Gets the number of lineages
+            *
+            */
+            unsigned int numberOfLineages() const;
+
+           /** \brief Gets the efficient number of lineages
+            *
+            * The number of lineages is multiplied by the number of
+            * covered segments of each lineages.
+            *
+            */
+            unsigned int efficientNumberOfLineages() const;
+
+           /** \brief Sets the Edge of a lineage
+            *
+            * \param index the index of the lineage within the
+            * population.
+            * \param edge the address of the Edge instance representing
+            * the lineage.
+            *
+            */
+            void set(unsigned int index, Edge* edge);
+
+           /** \brief Removes and returns a random lineage.
+            *
+            * \param random pointer to simulator's random generator
+            * instance.
+            *
+            */
+            Edge* extractRandomly(Random* random);
+
+           /** \brief Removes and returns a given lineage.
+            *
+            * \param index the relative index of the lineage.
+            *
+            */
+            Edge* extractByIndex(unsigned int index);
+
+           /** \brief Appends a lineage to the object
+            *
+            */
+            void push(Edge* edge);
+
+           /** \brief Gets coverage
+            *
+            */
+            unsigned int coverage(unsigned int edgeIndex) const;
+
+
+        private:
+
+            void copy(const Population& source);
+            void clear();
+            Edge* pick(unsigned int index);
+            void init();
+            unsigned int _numberOfLineages;
+            unsigned int _efficientNumberOfLineages;
+            Edge** lineages;
+    };
+
+}
+
+#endif

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/Random.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/Random.hpp Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,134 @@
+/*
+    Copyright 2008,2009,2012 St�phane De Mita, Mathieu Siol
+    Adapted from MStrat, developed by Charles-Edouard Coste,
+    Thomas M. Bataillon, Mathieu Cotisson, Guy Decoux, Chistophe Rozale,
+    Daniel J. Schoen and Jacques L. David.
+
+    This file is part of the EggLib library.
+
+    EggLib is free software: you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation, either version 3 of the License, or
+    (at your option) any later version.
+
+    EggLib is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with EggLib.  If not, see <http://www.gnu.org/licenses/>.
+*/
+
+#ifndef EGGLIB_RANDOM_HPP
+#define EGGLIB_RANDOM_HPP
+
+namespace egglib {
+
+    /** \brief Pseudo-random number generator
+     *
+     * \ingroup core
+     *
+     * Random is a pseudo-random number generator, adapted from a part of MStrat,
+     * developed by Charles-Edouard Coste, Thomas M. Bataillon, Mathieu Cotisson,
+     * Guy Decoux, Chistophe Rozale, Daniel J. Schoen and Jacques L. David.
+     *
+     * It uses two different seeds. By default, they are initialized to available
+     * arbitrary values. However, a given sequence can be repeated by passing the
+     * same two seeds.
+     *
+     */
+    class Random {
+       public:
+            /** \brief Initializes using default seeds
+             *
+             * Uses the current system time and the memory address of the object as an attempt to generate unique sequences.
+             */
+            Random();
+
+            /** \brief Initializes using given seeds
+             *
+             * This constructor can be used to reproduce a given sequence.
+             */
+            Random(double seed1, double seed2);
+
+           /** \brief Draws a number from an exponential distribution
+            *
+            * \param expectation the distribution mean (also 1/lambda
+            * where lambda is the rate parameter).
+            *
+            */
+            double erand(double expectation);
+
+           /** \brief Draws an integer from a uniform distribution bound by 0 and max (max is not included)
+            *
+            * max is not included.
+            *
+            */
+            unsigned int irand(unsigned int max);
+
+            /** \brief Draws an integer from a Poisson distribution with parameter p
+             *
+             * The Poisson transformation algorithm was taken from (in French)
+             * http://www.u-picardie.fr/~cochard/IEM/demos/C107/C107_3.htm.
+             */
+            unsigned int prand(double p);
+
+           /** \brief Draws a number from a normal distribution of expectation 0 and variance 1
+            *
+            * The algorithm used is the polar form of the Box-Muller
+            * algorithm. \todo use the Ziggurat algorithm for the
+            * nrand() method of Random.
+            *
+            */
+            double nrand();
+
+           /** \brief Draws a number from a geometric law
+            *
+            * \param param the parameter of the law
+            *
+            */
+            unsigned int grand(double);
+
+           /** \brief Draws a number from a uniform distribution between 0 and 1
+            *
+            */
+            double uniform();
+
+           /** \brief Gets the current value of the first seed
+            *
+            */
+            double seed1() const;
+
+           /** \brief Gets the current value of the second seed
+            *
+            */
+            double seed2() const;
+
+           /** \brief Sets the current value of the first seed
+            *
+            */
+            void seed1(double);
+
+           /** \brief Sets the current value of the second seed
+            *
+            */
+            void seed2(double);
+
+        private:
+            // First seed
+            double _seed1;
+
+            // Second seed
+            double _seed2;
+
+            /* since the normal random generator draws two numbers at
+             * a time, one is cached and returned at any subsequent call
+             */
+            bool b_ncached;
+            double v_ncached;
+
+    };
+}
+
+#endif

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/SitePolymorphism.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/SitePolymorphism.hpp Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,207 @@
+/*
+    Copyright 2008-2009 Stéphane De Mita, Mathieu Siol
+
+    This file is part of the EggLib library.
+
+    EggLib is free software: you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation, either version 3 of the License, or
+    (at your option) any later version.
+
+    EggLib is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with EggLib.  If not, see <http://www.gnu.org/licenses/>.
+*/
+
+
+#ifndef EGGLIB_SITEPOLYMORPHISM_HPP
+#define EGGLIB_SITEPOLYMORPHISM_HPP
+
+
+
+namespace egglib {
+
+
+   /** \brief Implements diversity analysis at the site level
+    *
+    * \ingroup polymorphism
+    *
+    * Data are loaded along with a population index. It is necessary to
+    * set the number of populations prior to use.
+    *
+    * Outgroup sequence must be loaded separetedly. There can be any
+    * number of outgroups, but they must be all consistent otherwise the
+    * site will be considered as not orientable.
+    *
+    */
+    class SitePolymorphism {
+
+        public:
+
+           /** \brief Builds an object
+            *
+            */
+            SitePolymorphism();
+
+
+           /** \brief Builds an object
+            *
+            * \param npop number of populations
+            *
+            */
+            SitePolymorphism(unsigned int npop);
+
+
+           /** \brief Destroys an object
+            *
+            */
+            virtual ~SitePolymorphism();
+
+
+           /** \brief Copy constructor
+            *
+            */
+            SitePolymorphism(const SitePolymorphism& source);
+
+
+           /** \brief Assignment operator
+            *
+            */
+            SitePolymorphism& operator=(const SitePolymorphism& source);
+
+
+           /** \brief Sets the number of populations
+            *
+            * NOTE THAT all previous data is lost.
+            *
+            */
+            void numberOfPopulations(unsigned int npop);
+
+
+           /** \brief Adds a character
+            *
+            * \param populationIndex the index of the population from
+            * which is sampled this character (do not use "population
+            * label").
+            *
+            * \param character the character value (it is assumed it
+            * represents a valid character.
+            *
+            */
+            void load(unsigned int populationIndex, char character);
+
+
+           /** \brief Loads outgroup state
+            *
+            * There can be any number of outgroup states. Only
+            * characters that are considered as valid (whatever the list
+            * is) should be loaded.
+            *
+            */
+            void outgroup(char state);
+
+
+           /** \brief Number of different alleles
+            *
+            */
+            unsigned int numberOfAlleles() const;
+
+
+           /** \brief Gets an allele (unsecure)
+            *
+            * Assumes that the index provided lies in the valid range
+            *
+            */
+            char allele(unsigned int index) const;
+
+
+           /** \brief Gets a frequency (unsecure)
+            *
+            * The sum of of frequencies of the allele over populations
+            * is computed. Not out-of-bounds check is performed.
+            *
+            */
+            unsigned int alleleFrequency(unsigned int alleleIndex) const;
+
+
+           /** \brief Gets the frequency of an allele in one pop (unsecure)
+            *
+            * The frequency of the allele in the given population is
+            * returned. Not out-of-bounds check is performed.
+            *
+            */
+            unsigned int alleleFrequency(unsigned int popIndex, unsigned int alleleIndex) const;
+
+
+           /** \brief Sums the frequency of derived allele(s)
+            *
+            * This method assumes that the site is orientable. It will
+            * use as outgroup the first outgroup character entered,
+            * assuming at least one was entered and that all (if more
+            * than one) were identical.
+            *
+            */
+            unsigned int derivedAlleleFrequency() const;
+
+
+           /** \brief Number of sequences that were analyzed
+            *
+            */
+            unsigned int ns() const;
+
+
+           /** \brief Gets the number of analyzed sequences for a population
+            *
+            * No out-of-bound check is performed
+            *
+            */
+            unsigned int ns(unsigned int popIndex) const;
+
+
+           /** \brief Checks if the site can be oriented
+            *
+            * Returns true if at least one outgroup datum has been
+            * loaded, if all outgroup data are identical (regardless of
+            * their value) and if the outgroup allele is one of the
+            * allele in the sample.
+            *
+            */
+            bool isOrientable() const;
+
+            bool isPolymorphic(unsigned int popIndex) const;
+            bool hasSpecificAllele(unsigned int popIndex, bool restrictToDerived) const;
+            bool haveFixedDifference(unsigned int pop1, unsigned int pop2) const;
+            bool haveCommonAllele(unsigned int pop1, unsigned int pop2) const;
+            bool haveSharedAllele(unsigned int pop1, unsigned int pop2) const;
+
+
+
+
+        protected:
+
+            // helpers
+            void init();
+            void clear();
+            void copy(const SitePolymorphism& site);
+
+
+            // data
+            unsigned int m_numberOfPopulations;
+            unsigned int m_numberOfStates;
+            char * m_states;
+            unsigned int ** m_frequencies;
+            unsigned int m_numberOfOutgroups;
+            char * m_outgroups;
+            unsigned int m_ns;
+            unsigned int * m_pop_ns;
+
+            bool m_cache_orientable;
+
+    };
+}
+
+#endif

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/Staden.hpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/Staden.hpp Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,140 @@
+/*
+    Copyright 2008-2009 St�phane De Mita, Mathieu Siol
+
+    This file is part of EggLib.
+
+    EggLib is free software: you can redistribute it and/or modify
+    it under the terms of the GNU General Public License as published by
+    the Free Software Foundation, either version 3 of the License, or
+    (at your option) any later version.
+
+    EggLib is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU General Public License for more details.
+
+    You should have received a copy of the GNU General Public License
+    along with EggLib.  If not, see <http://www.gnu.org/licenses/>.
+*/
+
+#ifndef EGGLIB_STADEN_HPP
+#define EGGLIB_STADEN_HPP
+
+#include <string>
+#include <istream>
+#include "Align.hpp"
+
+namespace egglib {
+
+    /** \brief Parser of Staden output format
+     *
+     * \ingroup core
+     *
+     * The parser is available as a static method. It takes either a
+     * stream or a string containing data formatted by the program GAP4
+     * of the Staden package (command 'dump contig to file').
+     *
+     */
+    class Staden {
+
+        public:
+
+
+           /** \brief Parses a string
+            *
+            * \param string a string containing an alignment formatted
+            * by the program GAP4 of the Staden package.
+            *
+            * \param deleteConsensus if true, the sequence named
+            * "CONSENSUS" is deleted from the file (if it is present).
+            *
+            * \return An Align instance containing the data found in
+            * the Staden while, after recoding the character following
+            * the standard codes.
+            *
+            * This method opens a stream to the string and calls the
+            * overloaded method.
+            *
+            * The character replacement rules assume Staden default
+            * convention, as follows:
+            *    - "-" codes for an unknown base and is replaced by "N".
+            *    - "*" codes for an alignment gap and is replaced by "-".
+            *    - A white space represents missing data and is replaced
+            * by "?".
+            *
+            */
+            static Align parse(const std::string& string, bool deleteConsensus=true);
+
+
+           /** \brief Parses an open stream
+            *
+            * \param stream the open containing an alignment formatted
+            * by the program GAP4 of the Staden package.
+            *
+            * \param deleteConsensus if true, the sequence named
+            * "CONSENSUS" is deleted from the file (if it is present).
+            *
+            * \return An Align instance containing the data found in
+            * the Staden while, after recoding the character following
+            * the standard codes.
+            *
+            * The character replacement rules assume Staden default
+            * convention, as follows:
+            *    - "-" codes for an unknown base and is replaced by "N".
+            *    - "*" codes for an alignment gap and is replaced by "-".
+            *    - A white space represents missing data and is replaced
+            * by "?".
+            *
+            */
+            static Align parse(std::istream& stream, bool deleteConsensus=true);
+
+
+        private:
+
+            /// Not allowed to instantiate this class
+            Staden() { }
+
+            /// Not allowed to instantiate this class
+            Staden(const Staden& source) { }
+
+            /// Not allowed to instantiate this class
+            ~Staden() { }
+
+
+           /* Gets the start position of sequences
+            *
+            * The functions gives total number of characters before the start of sequences
+            * and reads through until the next backspace (ignores the first line).
+            */
+            static void getShift();
+
+            // Translates according to the Staden format
+            static char transforme(char);
+
+            // Imports one sequence
+            static bool readOneSequence();
+
+            // Imports and concatenates one sequence
+            static bool readAppendOneSequence();
+
+            // Replaces dots by the matching character from CONSENSUS
+            static void undot(bool delete_consensus=true);
+
+            // The number of characters before the start of sequences
+            static int shift;
+
+            // The dynamically filled container (will result in an aligment)
+            static Container container;
+
+            // The current position
+            static int currpos;
+
+            // The reading stream
+            static std::istream* stream;
+
+            // Stores unique 8 characters discriminating readings
+            static std::vector<std::string> ID;
+    };
+}
+
+#endif

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/include/egglib-cpp/config.h
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/egglib/egglib-2.1.5/include/egglib-cpp/config.h Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,80 @@
+/* config.h.  Generated from config.h.in by configure.  */
+/* config.h.in.  Generated from configure.ac by autoheader.  */
+
+/* Define to 1 if you have the <inttypes.h> header file. */
+#define HAVE_INTTYPES_H 1
+
+/* Define to 1 if you have the `bpp-core' library (-lbpp-core). */
+/* #undef HAVE_LIBBPP_CORE */
+
+/* Define to 1 if you have the `bpp-seq' library (-lbpp-seq). */
+/* #undef HAVE_LIBBPP_SEQ */
+
+/* Define to 1 if you have the <memory.h> header file. */
+#define HAVE_MEMORY_H 1
+
+/* Define to 1 if you have the `sqrt' function. */
+/* #undef HAVE_SQRT */
+
+/* Define to 1 if stdbool.h conforms to C99. */
+#define HAVE_STDBOOL_H 1
+
+/* Define to 1 if you have the <stdint.h> header file. */
+#define HAVE_STDINT_H 1
+
+/* Define to 1 if you have the <stdlib.h> header file. */
+#define HAVE_STDLIB_H 1
+
+/* Define to 1 if you have the <strings.h> header file. */
+#define HAVE_STRINGS_H 1
+
+/* Define to 1 if you have the <string.h> header file. */
+#define HAVE_STRING_H 1
+
+/* Define to 1 if you have the <sys/stat.h> header file. */
+#define HAVE_SYS_STAT_H 1
+
+/* Define to 1 if you have the <sys/types.h> header file. */
+#define HAVE_SYS_TYPES_H 1
+
+/* Define to 1 if you have the <unistd.h> header file. */
+#define HAVE_UNISTD_H 1
+
+/* Define to 1 if the system has the type `_Bool'. */
+#define HAVE__BOOL 1
+
+/* Name of package */
+#define PACKAGE "egglib-cpp"
+
+/* Define to the address where bug reports for this package should be sent. */
+#define PACKAGE_BUGREPORT "demita@gmail.com"
+
+/* Define to the full name of this package. */
+#define PACKAGE_NAME "EggLib C++ library"
+
+/* Define to the full name and version of this package. */
+#define PACKAGE_STRING "EggLib C++ library 2.1.5"
+
+/* Define to the one symbol short name of this package. */
+#define PACKAGE_TARNAME "egglib-cpp"
+
+/* Define to the home page for this package. */
+#define PACKAGE_URL ""
+
+/* Define to the version of this package. */
+#define PACKAGE_VERSION "2.1.5"
+
+/* Define to 1 if you have the ANSI C header files. */
+#define STDC_HEADERS 1
+
+/* Version number of package */
+#define VERSION "2.1.5"
+
+/* Define to `__inline__' or `__inline' if that's what the C compiler
+   calls it, or to nothing if 'inline' is not supported under any name.  */
+#ifndef __cplusplus
+/* #undef inline */
+#endif
+
+/* Define to `unsigned int' if <sys/types.h> does not define. */
+/* #undef size_t */

diff -r 3e19d0dfcf3e -r 420b57c3c185 egglib/egglib-2.1.5/lib/libegglib-cpp.a

Binary file egglib/egglib-2.1.5/lib/libegglib-cpp.a has changed

diff -r 3e19d0dfcf3e -r 420b57c3c185 hapmap2mlmm/HapmapToMLMMFiles.pl
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/hapmap2mlmm/HapmapToMLMMFiles.pl Fri Jul 10 04:39:30 2015 -0400

[

@@ -0,0 +1,117 @@
+#!/usr/bin/perl
+
+use strict;
+use Switch;
+use Getopt::Long;
+
+my $usage = qq~Usage:$0 <args> [<opts>]
+where <args> are:
+    -h, --hapmap       <Hapmap input file>
+    -m, --map          <Map output file>
+    -g, --geno         <Genotype output file>
+    -p, --path         <Path for transpose executable>
+~;
+$usage .= "\n";
+
+my ($hapmap,$map,$geno,$path);
+
+
+GetOptions(
+        "geno=s"       => \$geno,
+        "map=s"        => \$map,
+        "hapmap=s"     => \$hapmap,
+        "path=s"       => \$path,
+);
+
+
+die $usage
+  if ( !$geno || !$map || !$hapmap || !$path);
+
+my $TRANSPOSE_EXE = "$path/transpose.awk";
+
+my @snps;
+my %chrom_pos;
+my $num_line = 0;
+open(my $O,">geno_transposed");
+open(my $H,$hapmap);
+while(<$H>)
+{
+ $num_line++;
+ my $line = $_;
+ chomp($line);
+ $line =~s/\r//g;
+ $line =~s/\n//g;
+ my @infos = split(/\t/,$line);
+ if ($num_line == 1)
+ {
+ print $O "Ind_id";
+ for (my $i = 11; $i <= $#infos; $i++)
+ {
+ my $individual = $infos[$i];
+ print $O " " . $individual;
+ }
+ print $O "\n";
+ }
+ elsif ($num_line > 1)
+ {
+ my $snp = $infos[0];
+ my $variation = $infos[1];
+ my %scores;
+ if ($variation =~/(\w)\/(\w)/)
+ {
+ my $allele1 = $1;
+ my $allele2 = $2;
+ $scores{$allele1} = 0;
+ $scores{$allele2} = 1;
+ }
+ my $chrom = $infos[2];
+ my $pos = $infos[3];
+ $chrom_pos{$snp}{"chrom"} = $chrom;
+ $chrom_pos{$snp}{"pos"} = $pos;
+ push(@snps,$snp);
+ print $O "$snp";
+ for (my $i = 11; $i <= $#infos; $i++)
+ {
+ my $genotype = $infos[$i];
+ my @alleles = split("",$genotype);
+ if ($genotype ne "NN")
+ {
+ my $score = $scores{$alleles[0]} + $scores{$alleles[1]};
+ print $O " $score";
+ }
+ else
+ {
+ print $O " NA";
+ }
+ }
+ print $O "\n";
+ }
+}
+close($H);
+close($O);
+
+open(my $M,">$map");
+print $M "SNP Chr Pos\n";
+foreach my $snp(@snps)
+{
+ print $M "$snp " . $chrom_pos{$snp}{"chrom"} . " ". $chrom_pos{$snp}{"pos"} . "\n";
+}
+close($M);
+
+system("$TRANSPOSE_EXE geno_transposed >geno_transposed2");
+
+open(my $F,">$geno");
+open(my $G,"geno_transposed2");
+while(<$G>)
+{
+ my $line = $_;
+ $line =~s/ /\t/g;
+ print $F $line;
+}
+close($G);
+close($F);
+
+unlink("geno_transposed");
+unlink("geno_transposed2");
+
+

diff -r 3e19d0dfcf3e -r 420b57c3c185 hapmap2mlmm/HapmapToMLMMFiles.sh
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/hapmap2mlmm/HapmapToMLMMFiles.sh Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,11 @@
+#!/bin/bash
+hapmap=$1
+map=$2
+geno=$3
+
+directory=`dirname $0`
+
+perl $directory/HapmapToMLMMFiles.pl -h $hapmap -g $geno -m $map -p $directory
+
+
+

diff -r 3e19d0dfcf3e -r 420b57c3c185 hapmap2mlmm/HapmapToMLMMFiles.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/hapmap2mlmm/HapmapToMLMMFiles.xml Fri Jul 10 04:39:30 2015 -0400

[

@@ -0,0 +1,158 @@
+<tool id="hapmap_to_mlmm_files" name="HapmapToMLMMFiles" version="1.1">
+ <description>converts a hapmap file into MLMM input files</description>
+ <command interpreter="bash">./HapmapToMLMMFiles.sh $input $snp_info $genot
+    </command>
+ <inputs>
+ <param format="txt" name="input" type="data" label="Allelic file in Hapmap format" help="Allelic file in Hapmap format"/>
+ </inputs>
+ <outputs>
+ <data format="txt" name="snp_info" label="SNP Info file"/>
+ <data format="txt" name="genot" label="Genotyping file for MLMM"/>
+ </outputs>
+    
+    <stdio>
+        
+        <exit_code range="1:" level="fatal" />
+    </stdio>
+
+    
+    <tests>
+        
+        
+
+    </tests>
+ <help>
+
+
+
+
+.. class:: infomark
+
+**Authors** Dereeper Alexis (alexis.dereeper@ird.fr), IRD, South Green platform
+
+  | **Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1).
+
+.. class:: infomark
+
+**Galaxy integration** South Green.
+
+---------------------------------------------------
+
+
+=================
+HapmapToMLMMFiles
+=================
+
+-----------
+Description
+-----------
+
+  | HapmapToMLMMFiles converts a hapmap file into input files compatible with the MLMM software.
+
+
+-----------------
+Workflow position
+-----------------
+
+**Upstream tool**
+
+=============== ====================== ===========
+Name            output file(s)         format
+=============== ====================== ===========
+VCF to Hapmap   Fasta alignment        fasta
+=============== ====================== ===========
+
+
+**Downstream tool**
+
+=========== ========================== =======
+Name            input file(s)          format
+=========== ========================== =======
+MLMM
+=========== ========================== =======
+
+
+
+----------
+Input file
+----------
+
+Hapmap file
+ Allelic file in Hapmap format
+
+
+
+------------
+Output files
+------------
+
+SNP Info file
+
+Genotyping file for MLMM
+
+
+
+---------------------------------------------------
+
+---------------
+Working example
+---------------
+
+Input files
+===========
+
+Hapmap file
+-----------
+
+::
+
+ rs# alleles chrom pos strand assembly# center protLSID assayLSID panel QCcode Ind1 Ind2
+ SNP1 A/T 1 3102 + assembly NA NA NA speciesname NA AA AA AA
+ SNP2 A/T 1 4648 + assembly NA NA NA speciesname NA AA AA AA
+
+
+Output files
+============
+
+SNP Info file
+-------------
+
+::
+
+ SNP Chr Pos
+ SNP1 1 3102
+ SNP2 1 4648
+ SNP3 1 7601
+
+
+Genotyping file for MLMM
+------------------------
+
+::
+
+ Ind_id SNP1 SNP2 SNP3 SNP4 SNP5 SNP6 SNP7 SNP8 SNP9 SNP10 SNP11 SNP12 SNP13 SNP14
+ Ind1 0 0 0 0 0 0 2 0 2 0 0 0 2 0
+ Ind2 0 0 0 0 0 2 2 0 0 0 0 0 0 0
+
+
+ </help>
+    <citations>
+        
+     <citation type="bibtex">@article{Dereeper03062015,
+author = {Dereeper, Alexis and Homa, Felix and Andres, Gwendoline and Sempere, Guilhem and Sarah, Gautier and Hueber, Yann and Dufayard, Jean-François and Ruiz, Manuel},
+title = {SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations},
+year = {2015},
+doi = {10.1093/nar/gkv351},
+abstract ={SNiPlay is a web-based tool for detection, management and analysis of genetic variants including both single nucleotide polymorphisms (SNPs) and InDels. Version 3 now extends functionalities in order to easily manage and exploit SNPs derived from next generation sequencing technologies, such as GBS (genotyping by sequencing), WGRS (whole gre-sequencing) and RNA-Seq technologies. Based on the standard VCF (variant call format) format, the application offers an intuitive interface for filtering and comparing polymorphisms using user-defined sets of individuals and then establishing a reliable genotyping data matrix for further analyses. Namely, in addition to the various scaled-up analyses allowed by the application (genomic annotation of SNP, diversity analysis, haplotype reconstruction and network, linkage disequilibrium), SNiPlay3 proposes new modules for GWAS (genome-wide association studies), population stratification, distance tree analysis and visualization of SNP density. Additionally, we developed a suite of Galaxy wrappers for each step of the SNiPlay3 process, so that the complete pipeline can also be deployed on a Galaxy instance using the Galaxy ToolShed procedure and then be computed as a Galaxy workflow. SNiPlay is accessible at http://sniplay.southgreen.fr.},
+URL = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.abstract},
+eprint = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.full.pdf+html},
+journal = {Nucleic Acids Research}
+}
+
+     </citation>
+
+    </citations>
+</tool>

diff -r 3e19d0dfcf3e -r 420b57c3c185 hapmap2mlmm/transpose.awk
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/hapmap2mlmm/transpose.awk Fri Jul 10 04:39:30 2015 -0400

[

@@ -0,0 +1,27 @@
+#!/usr/bin/gawk -f
+
+BEGIN {
+    max_x =0;
+    max_y =0;
+}
+
+{
+    max_y++;
+    for( i=1; i<=NF; i++ )
+    {
+        if (i>max_x) max_x=i;
+        A[i,max_y] = $i;
+    }
+}
+
+END {
+    for ( x=1; x<=max_x; x++ )
+    {
+        for ( y=1; y<=max_y; y++ )
+        {
+            if ( (x,y) in A ) printf "%s",A[x,y];
+            if ( y!=max_y ) printf " ";
+        }
+        printf "\n";
+    }
+}

diff -r 3e19d0dfcf3e -r 420b57c3c185 ped2bed/ped2bed.sh
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/ped2bed/ped2bed.sh Fri Jul 10 04:39:30 2015 -0400

@@ -0,0 +1,20 @@
+#!/bin/bash
+ped=$1
+map=$2
+bed=$3
+fam=$4
+bim=$5
+logs=$6
+
+directory=`dirname $0`
+mkdir tmpdir$$
+cp -rf $ped tmpdir$$/input.ped
+cp -rf $map tmpdir$$/input.map
+
+plink --file tmpdir$$/input --out tmpdir$$/out --make-bed --noweb >>$logs 2>&1
+
+mv tmpdir$$/out.bed $bed
+mv tmpdir$$/out.fam $fam
+mv tmpdir$$/out.bim $bim
+
+

diff -r 3e19d0dfcf3e -r 420b57c3c185 ped2bed/ped2bed.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/ped2bed/ped2bed.xml Fri Jul 10 04:39:30 2015 -0400

[

@@ -0,0 +1,196 @@
+<tool id="ped2bed" name="plink: ped2bed" version="1.24">
+ <description>Convert ped to bed</description>
+ <requirements>
+ <requirement type="package" version="1.07">plink</requirement>
+ </requirements>
+ <command interpreter="bash">./ped2bed.sh $ped $map $bed $fam $bim $logs
+    </command>
+ <inputs>
+ <param format="txt" name="ped" type="data" label="Allelic file in PED format" help="Allelic file in PED format"/>
+ <param format="txt" name="map" type="data" label="Map file" help="Map file"/>
+ </inputs>
+ <outputs>
+ <data format="txt" name="bed" label="Bed file"/>
+ <data format="txt" name="fam" label="Fam file"/>
+ <data format="txt" name="bim" label="Bim file"/>
+ <data format="txt" name="logs" label="All Logs"/>
+ </outputs>
+    
+    <stdio>
+        
+        <exit_code range="1:" level="fatal" />
+    </stdio>
+
+    
+    <tests>
+        
+        
+
+    </tests>
+ <help>
+
+
+.. class:: infomark
+
+**Authors** plink_
+
+.. _plink: http://pngu.mgh.harvard.edu/purcell/plink/
+
+  | "PLINK: a toolset for whole-genome association and population-based linkage analysis.", **Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MAR, Bender D, Maller J, Sklar P, de Bakker PIW, Daly MJ, Sham PC.**, American Journal of Human Genetics, 81, 2007.
+
+.. class:: infomark
+
+**Galaxy integration** South Green.
+
+.. class:: infomark
+
+**Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1).
+
+
+---------------------------------------------------
+
+
+
+=======
+Ped2Bed
+=======
+
+-----------
+Description
+-----------
+
+  | PLINK is a free, open-source whole genome association analysis toolset, designed to perform a range of basic, large-scale analyses in a computationally efficient manner.
+  | For further informations, please visite the plink website_.
+
+.. _website: http://pngu.mgh.harvard.edu/purcell/plink/
+
+
+-----------------
+Workflow position
+-----------------
+
+**Upstream tool**
+
+=============== ========================== ===========
+Name            output file(s)             format
+=============== ========================== ===========
+VCFtools filter PED and map files          ped and map
+=============== ========================== ===========
+
+
+**Downstream tool**
+
+=========== ========================== =======
+Name            input file(s)          format
+=========== ========================== =======
+Admixture   Bed, fam and bim file      txt
+=========== ========================== =======
+
+
+----------
+Input file
+----------
+
+PED file
+ Allelic file in PED format
+
+MAP file
+
+
+
+------------
+Output files
+------------
+
+Bed file
+
+Fam file
+
+Bim file
+
+All logs
+ Log file
+
+
+------------
+Dependencies
+------------
+plink
+ version 1.07
+
+---------------------------------------------------
+
+---------------
+Working example
+---------------
+
+Input files
+===========
+
+PED file
+--------
+
+::
+
+ AZUCENA AZUCENA 0 0 0 0 G G A A C C T T T
+ BULUPANDAK BULUPANDAK 0 0 0 0 G G A A A A T
+
+MAP file
+--------
+
+::
+
+ 0 Chr1:4299 0 4299
+ 0 Chr1:26710 0 26710
+ 0 Chr1:56184 0 56184
+ 0 Chr1:93272 0 93272
+
+
+Output files
+============
+
+Bed file
+--------
+
+::
+
+ binary file
+
+Fam file
+--------
+
+::
+
+ AZUCENA AZUCENA 0 0 0 -9
+ BULUPANDAK BULUPANDAK 0 0 0 -9
+
+Bim file
+--------
+
+::
+
+ 0 Chr1:4299 0 4299 A G
+ 0 Chr8:18058 0 18058 C T
+
+
+ </help>
+    <citations>
+        
+     <citation type="bibtex">@article{Dereeper03062015,
+author = {Dereeper, Alexis and Homa, Felix and Andres, Gwendoline and Sempere, Guilhem and Sarah, Gautier and Hueber, Yann and Dufayard, Jean-François and Ruiz, Manuel},
+title = {SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations},
+year = {2015},
+doi = {10.1093/nar/gkv351},
+abstract ={SNiPlay is a web-based tool for detection, management and analysis of genetic variants including both single nucleotide polymorphisms (SNPs) and InDels. Version 3 now extends functionalities in order to easily manage and exploit SNPs derived from next generation sequencing technologies, such as GBS (genotyping by sequencing), WGRS (whole gre-sequencing) and RNA-Seq technologies. Based on the standard VCF (variant call format) format, the application offers an intuitive interface for filtering and comparing polymorphisms using user-defined sets of individuals and then establishing a reliable genotyping data matrix for further analyses. Namely, in addition to the various scaled-up analyses allowed by the application (genomic annotation of SNP, diversity analysis, haplotype reconstruction and network, linkage disequilibrium), SNiPlay3 proposes new modules for GWAS (genome-wide association studies), population stratification, distance tree analysis and visualization of SNP density. Additionally, we developed a suite of Galaxy wrappers for each step of the SNiPlay3 process, so that the complete pipeline can also be deployed on a Galaxy instance using the Galaxy ToolShed procedure and then be computed as a Galaxy workflow. SNiPlay is accessible at http://sniplay.southgreen.fr.},
+URL = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.abstract},
+eprint = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.full.pdf+html},
+journal = {Nucleic Acids Research}
+}
+
+     </citation>
+
+    </citations>
+</tool>

diff -r 3e19d0dfcf3e -r 420b57c3c185 snpEff/SnpEff.pl
--- a/snpEff/SnpEff.pl Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

[

@@ -1,82 +0,0 @@
-#!/usr/bin/perl
-
-use strict;
-use Getopt::Long;
-
-my $usage = qq~Usage:$0 <args> [<opts>]
-where <args> are:
-    -i, --input         <input VCF>
-    -o, --output        <output>
-    -g, --gff           <GFF annotation>
-    -f, --fasta         <Fasta of chromosomes>
-    -h, --html          <HTML output>
-~;
-$usage .= "\n";
-
-my ($input,$output,$gff,$fasta,$html);
-
-
-GetOptions(
- "input=s"      => \$input,
- "output=s"     => \$output,
- "gff=s"        => \$gff,
- "fasta=s"      => \$fasta,
- "html=s"       => \$html
-);
-
-
-die $usage
-  if ( !$input || !$output || !$fasta || !$gff || !$html);
-
-
-if (!-e $gff){
-        die "Error: GFF input does not exist\n"
-}
-if (!-e $fasta){
-        die "Error: Fasta input does not exist\n"
-}
-
-#my $SNPEFF_PATH = "/usr/local/bioinfo/galaxy/galaxy_dist/tools/SNiPlay/SnpEff/snpEff";
-my $SNPEFF_PATH = $ENV{SNPEFF_JAR_PATH};
-
-
-my $session = $$;
-mkdir($session);
-mkdir("$session/data");
-mkdir("$session/data/genomes");
-mkdir("$session/data/myspecies");
-
-system("cp -rf $fasta $session/data/genomes/myspecies.fa");
-system("cp -rf $gff $session/data/myspecies/genes.gff");
-
-open(my $C,"$SNPEFF_PATH/snpEff.config");
-open(my $C2,">$session/snpEff.config");
-while(<$C>)
-{
- if (/data_dir/)
- {
- print $C2 "data_dir = ./data\n";
- }
- elsif (/^genomes/)
- {
- print $C2 "genomes : \\n";
-         print $C2 "myspecies, myspecies \\n";
- }
- else
- {
- print $C2 $_;
- }
-}
-print $C2 "myspecies.genome : myspecies\n";
-close($C);
-close($C2);
-
-
-my $build_cmd = "java -jar $SNPEFF_PATH/snpEff.jar build -c $session/snpEff.config -gff3 myspecies";
-system($build_cmd);
-
-my $eff_cmd = "java -jar $SNPEFF_PATH/snpEff.jar eff -c $session/snpEff.config -o vcf -no-downstream -no-upstream myspecies -s $html $input >$output";
-system($eff_cmd);
-
-
-system("rm -rf $session");

diff -r 3e19d0dfcf3e -r 420b57c3c185 snpEff/snpEff-pipe.sh
--- a/snpEff/snpEff-pipe.sh Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

@@ -1,14 +0,0 @@
-#!/bin/bash
-vcf=$1
-genome=$2
-gff=$3
-output=$4
-html=$5
-log=$6
-
-directory=`dirname $0`
-
-/usr/bin/perl $directory/SnpEff.pl -i $vcf -f $genome -g $gff -o $output -h $html >>$log 2>&1
-
-
-

diff -r 3e19d0dfcf3e -r 420b57c3c185 snpEff/snpEff.xml
--- a/snpEff/snpEff.xml Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

@@ -1,63 +0,0 @@
-<tool id="snpEff" name="SnpEff" version="4.0">
- <description>predicts SNP effect from a genomic VCF file</description>
- <requirements>
- <requirement type="package" version="4.0">snpEff</requirement>
- </requirements>
-
- 
- <command interpreter="bash">./snpEff-pipe.sh $vcf $genome $gff $output $statsFile $log</command>
- <inputs>
- <param format="vcf" name="vcf" type="data" label="VCF input file" help="Positions must be genomic positions"/>
- <param format="fasta" name="genome" type="data" label="Reference genome in Fasta" help=""/>
- <param format="gff3" name="gff" type="data" label="GFF annotation of the genome" help=""/>
-
- </inputs>
- <outputs>
- <data format="vcf" name="output" label="Annotated VCF" />
- <data format="html" name="statsFile" label="HTML statistics output"/>
- <data format="txt" name="log" label="Log file"/>
- </outputs>
-
- <help>
-
-
-
-
-
-.. class:: infomark
-
-**Program encapsulated in Galaxy by Southgreen**
-
-.. class:: infomark
-
-**SnpEff version 4.0**
-
------
-
-==============
- Please cite:
-==============
-
-"A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3.", **Cingolani P, Platts A, Wang le L, Coon M, Nguyen T, Wang L, Land SJ, Lu X, Ruden DM.**, Fly (Austin). 2012 Apr-Jun;6(2):80-92.
-
------
-
-===========
- Overview:
-===========
-
-Genetic variant annotation and effect prediction toolbox. It annotates and predicts the effects of variants on genes (such as amino acid changes).
-
------
-
-For further informations, please visite the SnpEff_ website.
-
-
-.. _SnpEff: http://snpeff.sourceforge.net/
- </help>
-
-</tool>
-

diff -r 3e19d0dfcf3e -r 420b57c3c185 tassel/tassel.sh
--- a/tassel/tassel.sh Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

[

@@ -1,41 +0,0 @@
-#!/bin/bash
-
-analyseType=$1;
-out1=$2;
-out2=$3;
-out3=$4;
-log1=$5;
-galaxyOutDir=$6;
-
-
-mkdir $galaxyOutDir
-
-# Suppression des 6 premiers arguments de la liste des arguments $@
-shift; shift; shift; shift; shift; shift;
-
-if [[ $analyseType == glm ]]
-then
- run_pipeline.pl $* >> $log1 2>&1
- mv "$galaxyOutDir/TASSELGLM1.txt" $out1
- mv "$galaxyOutDir/TASSELGLM2.txt" $out2
-fi
-
-if [[ $analyseType == mlm ]]
-then
- run_pipeline.pl $* >> $log1 2>&1
- mv "$galaxyOutDir/TASSELMLM1.txt" $out1
- mv "$galaxyOutDir/TASSELMLM2.txt" $out2
- mv "$galaxyOutDir/TASSELMLM3.txt" $out3
-fi
-
-if [[ $analyseType == ld ]]
-then
- run_pipeline.pl $* >> $log1 2>&1
-fi
-
-
-if [[ $analyseType == ck ]]
-then
- run_pipeline.pl $* >> $log1 2>&1
- mv "$galaxyOutDir/kinship.txt" $out1
-fi

diff -r 3e19d0dfcf3e -r 420b57c3c185 tassel/tassel.xml
--- a/tassel/tassel.xml Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

[

@@ -1,153 +0,0 @@
-<tool id="Tassel" name="Tassel" version="5.0">
- <description> Software package to evaluate traits associations, evolutionary patterns, and linkage disequilibrium. </description>
- <requirements>
-                <requirement type="package" version="5.0">tassel</requirement>
-        </requirements>
- <command interpreter="bash">./tassel.sh $analysis_opts.fonction_selector $output1 $output2 $output3 $log tmpdir$$/
-#if $analysis_opts.fonction_selector == "mlm":
- -fork1 -h $hapmap -filterAlign -filterAlignMinFreq $filterAlignMinFreq
- -fork2 -r $analysis_opts.trait
- #if $analysis_opts.add_structure_file.additional_file_selector == "yes":
-  -fork3 -q $analysis_opts.add_structure_file.structure -excludeLastTrait
- #end if
- -fork4 -k $analysis_opts.kinship
- -combineA -input1 -input2
- #if $analysis_opts.add_structure_file.additional_file_selector == "yes":
-  -input3
- #end if
- -intersect -combineB -inputA -input4 -mlm -mlmVarCompEst $analysis_opts.mlmVarCompEst -mlmCompressionLevel $analysis_opts.mlmCompressionLevel -export tmpdir$$/TASSELMLM -runfork1 -runfork2
- #if $analysis_opts.add_structure_file.additional_file_selector == "yes":
-  -runfork3
- #end if
- -runfork4
-
-#else if $analysis_opts.fonction_selector == "glm":
- -fork1 -h $hapmap -filterAlign -filterAlignMinFreq $filterAlignMinFreq
- -fork2 -r $analysis_opts.trait
- #if $analysis_opts.add_file.additional_file_selector == "yes":
-  -fork3 -q $analysis_opts.add_file.structure -excludeLastTrait
- #end if
- -combineA -input1 -input2
- #if $analysis_opts.add_file.additional_file_selector == "yes":
-  -input3
- #end if
- -intersect -glm -export tmpdir$$/TASSELGLM -runfork1 -runfork2
- #if $analysis_opts.add_file.additional_file_selector == "yes":
-  -runfork3
- #end if
-#else if $analysis_opts.fonction_selector == "ld":
- -fork1 -h $hapmap
- -ld -ldType All -ldd png -ldplotsize 3000 -o $output1 -runfork1
-#else if $analysis_opts.fonction_selector == "ck":
- -fork1 -h $hapmap
- -ck -export tmpdir$$/kinship -runfork1
-#end if
- </command>
- <inputs>
- <param format="txt" name="hapmap" type="data" label="HapMap file"/>
- <conditional name="analysis_opts">
- <param name="fonction_selector" type="select" label="Type of analysis">
- <option value="mlm" selected="True">MLM</option>
- <option value="glm">GLM</option>
- <option value="ld">Linkage Disequilibrium</option>
- <option value="ck">Kinship</option>
- </param>
- <when value="glm">
-                 <param format="txt" name="trait" type="data" label="Trait file"/>
- <conditional name="add_file">
- <param name="additional_file_selector" type="select" label="Add structure file">
-                                  <option value="no" selected="True">no</option>
-                                  <option value="yes">yes</option>
-                          </param>
- <when value="yes">
- <param format="txt" name="structure" type="data" label="Structure file"/>
- </when>
- </conditional>
- </when>
- <when value="mlm">
-                 <param format="txt" name="trait" type="data" label="Trait file"/>
-                 <param format="txt" name="kinship" type="data" label="Kinship file"/>
- <conditional name="add_structure_file">
- <param name="additional_file_selector" type="select" label="Add structure file">
-                                  <option value="no" selected="True">no</option>
-                                  <option value="yes">yes</option>
-                          </param>
- <when value="yes">
- <param format="txt" name="structure" type="data" label="Structure file"/>
- </when>
- </conditional>
- <param name="mlmVarCompEst" type="select" label="Variance Component Estimation">
- <option value="P3D" selected="True">P3D</option>
- <option value="EachMarker">EachMarker</option>
- </param>
- <param name="mlmCompressionLevel" type="select" label="Compression Level">
- <option value="Optimum" selected="True">Optimum</option>
- <option value="Custom">Custom</option>
- <option value="None">None</option>
- </param>
-                        </when>
- <when value="ld"></when>
- <when value="ck"></when>
- </conditional>
- <param type="text" name="filterAlignMinFreq" label="Filter minimal frequency allele" value="0.05"/>
- </inputs>
- <outputs>
- <data format="txt" name="output1" label="Tassel output">
- <change_format>
- <when input="analysis_opts['fonction_selector']" value="ld" format="png"/>
- </change_format>
- </data>
-
- <data format="txt" name="output2" label="Allele effects">
- <filter>analysis_opts['fonction_selector'] == "glm" or analysis_opts['fonction_selector'] == "mlm"</filter>
- </data>
-
- <data format="txt" name="output3" label="Compression file">
- <filter>analysis_opts['fonction_selector'] == "mlm"</filter>
- </data>
-
- <data format="txt" name="log" label="Log file"/>
- </outputs>
- <help>
-
-.. class:: infomark
-
-**Program encapsulated in Galaxy by Southgreen**
-
-.. class:: infomark
-
-**Tassel**
-
------
-
-==========
- Authors:
-==========
-
-**Terry Casstevens**
-
------
-
-==========
- Overview
-==========
-
-Software package to evaluate traits associations, evolutionary patterns, and linkage disequilibrium.
-
------
-
-For further informations, please visite the website of TASSEL_.
-
-
-.. _TASSEL: http://www.maizegenetics.net/tassel/
-
- </help>
-
-</tool>

diff -r 3e19d0dfcf3e -r 420b57c3c185 tassel/tool-data/tool_dependencies.xml
--- a/tassel/tool-data/tool_dependencies.xml Mon Mar 23 05:57:27 2015 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

@@ -1,8 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-    <package name="tassel" version="5.0">
-        <repository changeset_revision="097d4c366e0d" name="package_tassel_5_0" owner="dereeper" toolshed="https://toolshed.g2.bx.psu.edu/" />
-    </package>
-</tool_dependency>
-
-

diff -r 3e19d0dfcf3e -r 420b57c3c185 tool_dependencies.xml
--- a/tool_dependencies.xml Mon Mar 23 05:57:27 2015 -0400
+++ b/tool_dependencies.xml Fri Jul 10 04:39:30 2015 -0400

@@ -1,20 +1,6 @@
<?xml version="1.0"?>
<tool_dependency>
     <package name="plink" version="1.07">
-        <repository changeset_revision="65400c333b88" name="package_plink_1_07" owner="dereeper" toolshed="https://toolshed.g2.bx.psu.edu/" />
-    </package>
-    <package name="admixture" version="1.23">
-        <repository changeset_revision="61e04b2aa621" name="package_admixture_1_23" owner="dereeper" toolshed="https://toolshed.g2.bx.psu.edu/" />
-    </package>
-    <package name="tassel" version="5.0">
-        <repository changeset_revision="097d4c366e0d" name="package_tassel_5_0" owner="dereeper" toolshed="https://toolshed.g2.bx.psu.edu/" />
-    </package>
-    <package name="vcftools" version="0.1.12b">
-        <repository changeset_revision="a655cb1dfc58" name="package_vcftools_0_1_12b" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu/" />
-    </package>
-    <package name="snpEff" version="4.0">
-        <repository name="package_snpeff_4_0" owner="iuc" changeset_revision="6bc55957927b" toolshed="http://toolshed.g2.bx.psu.edu" />
+        <repository changeset_revision="65400c333b88" name="package_plink_1_07" owner="dereeper" toolshed="http://toolshed.g2.bx.psu.edu" />
     </package>
</tool_dependency>
-
-