| Next changeset 1:c95456522e04 (2016-12-21) |
|
Commit message:
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 0065dafe7bbd382bb995b28cc4089c9e4f4eeeb9 |
|
added:
macros.xml rnadistance.xml test-data/kinfold_input.txt test-data/rna2dfold_input1.txt test-data/rna2dfold_result1.txt test-data/rnaaliduplex_input1.clustal test-data/rnaaliduplex_result1.txt test-data/rnaalifold_input1.clustal test-data/rnaalifold_result1.txt test-data/rnacofold_input1.fas test-data/rnacofold_result1.txt test-data/rnadistance_input1.dbn test-data/rnadistance_result1.txt test-data/rnaduplex_input1.fa test-data/rnaduplex_result1.txt test-data/rnaeval_input1.dbn test-data/rnaeval_result1.txt test-data/rnafold_input1.fa test-data/rnafold_input2.fa test-data/rnafold_result1.txt test-data/rnafold_result2.txt test-data/rnafold_result3.txt test-data/rnaheat_input1.fa test-data/rnaheat_result1.txt test-data/rnainverse_input1.clu test-data/rnalalifold_input1.clustal test-data/rnalalifold_result1.txt test-data/rnalfold_input1.fa test-data/rnalfold_result1.txt test-data/rnapaln_input1.fa test-data/rnapaln_input1.fas test-data/rnapaln_result1.txt test-data/rnapdist_input1.fa test-data/rnapdist_result1.txt test-data/rnapkplex_input1.fa test-data/rnapkplex_result1.txt test-data/rnaplex_input1.fa test-data/rnaplex_result1.txt test-data/rnaplfold_input1.fa test-data/rnaplfold_result1.ps test-data/rnaplfold_result2.ps test-data/rnaplot_input1.dbn test-data/rnaplot_input1.fa test-data/rnasnoop_input1a.fa test-data/rnasnoop_input1b.fa test-data/rnasnoop_result1.txt test-data/rnasubopt_input1.fa test-data/rnasubopt_result1.txt test-data/rnaup_input1.fa test-data/rnaup_result1.txt vienna_rna.tar.gz |
| b |
| diff -r 000000000000 -r 4286146cb3aa macros.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,26 @@ +<macros> + <xml name="requirements"> + <requirements> + <requirement version="2.2.10">viennarna</requirement> + </requirements> + </xml> + <token name="@VERSION@">2.2.10</token> + <xml name="version_command"> + <version_command>@EXECUTABLE@ --version</version_command> + </xml> + + <xml name="stdio"> + <stdio> + <exit_code range="1:" /> + <exit_code range=":-1" /> + <regex match="Error:" /> + <regex match="Exception:" /> + </stdio> + </xml> + + <xml name="citations"> + <citations> + <citation type="doi">10.1186/1748-7188-6-26</citation> + </citations> + </xml> +</macros> |
| b |
| diff -r 000000000000 -r 4286146cb3aa rnadistance.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/rnadistance.xml Tue Dec 06 12:35:35 2016 -0500 |
| [ |
| @@ -0,0 +1,85 @@ +<tool id="viennarna_rnadistance" name="@EXECUTABLE@" version="@VERSION@.0"> + <description>Calculate distance between secondary structures of two RNAs</description> + <macros> + <token name="@EXECUTABLE@">RNAdistance</token> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="stdio" /> + <expand macro="version_command" /> + <command> +<![CDATA[ + RNAdistance < '$input' > '$outfile' + --distance=#echo ''.join(str($distance).split(','))# + --compare=$compare + $shapiro + $backtrack + #if $backtrack and str($compare)=="m" + && cat backtrack.file >> '$outfile' + #end if +]]> + </command> + <inputs> + <param name="input" type="data" format="*" label="Primary and secondary stuctures file"/> + <param name="distance" type="select" multiple="true" display="checkboxes" label="Representation to calculate the distance / alignment option"> + <option value="f" selected="true">full/tree</option> + <option value="F">full/string</option> + <option value="h">hit/tree</option> + <option value="H">hit/string</option> + <option value="w">weighted coarse/tree</option> + <option value="W">weighted coarse/string</option> + <option value="c">coarse/tree</option> + <option value="C">coarse/string</option> + <validator type="no_options" message="Please select at least one type."/> + </param> + <param name="compare" type="select" label="Comparison Option" help="-d"> + <option value="p" selected="True">p: pairwise (1st with 2nd, 3rd with 4th, ...)</option> + <option value="m">m: matrix (each with each, output in matrix form)</option> + <option value="f" >f: first (1st with 2nd, 1st with 3rd, ...)</option> + <option value="c">c: continuous (1st with 2nd, 2nd with 3rd, ...)</option> + </param> + <param argument="--shapiro" type="boolean" checked="false" truevalue="--shapiro" falsevalue="" label="Use cost matrix by Bruce Shapiro" help="--shapiro"/> + <param argument="--backtrack" type="boolean" checked="false" truevalue="--backtrack" falsevalue="" label="Print an alignment" help="--backtrack"/> + </inputs> + <outputs> + <data format="txt" name="outfile"/> + </outputs> + <tests> + <test> + <param name="input" value="rnadistance_input1.dbn"/> + <output name="outfile" file="rnadistance_result1.txt"/> + </test> + </tests> + <help> +<![CDATA[ +**RNAdistance** + + +----- + +**Input format** + +RNAdistance requires one input file with the following structure: +1st line: can be a comment line like in Fasta, begins with '>' +2nd line: sequence +3rd line: first secondary structure in dot-bracket notation +4th line: second secondary structure in dot-bracket notation +... +nth line: another sequence +... + +Several different RNA secondary structures can be specified. The input has a Fasta-like structure but with secondary structure information. + + +------ + +**Outputs** + +* distance of the structures +* with the backtrack options it is possible to get alignment ouput + + +]]> + </help> + <expand macro="citations" /> +</tool> |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/kinfold_input.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/kinfold_input.txt Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,1 @@ +ACUGAUCGUAGUCAC |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rna2dfold_input1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rna2dfold_input1.txt Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. +.((((((..(((..........))).(((((.......))))).....(((((.......))))))))))).. |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rna2dfold_result1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rna2dfold_result1.txt Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,6 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) <ref 1> +.((((((..(((..........))).(((((.......))))).....(((((.......))))))))))).. (-17.30) <ref 2> +k l en structure |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnaaliduplex_input1.clustal --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaaliduplex_input1.clustal Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,7 @@ +CLUSTAL 2.1 multiple sequence alignment + + +Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA + ************************************** ************** ******* ********* + |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnaaliduplex_result1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaaliduplex_result1.txt Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,1 @@ +(((((((..(.......((((..(..((((((..((((((.......((((((..(..(((((..(((((((.&)))))))..).......))))..)..))))))..)))))).......))))))..)..)))))..))))))). 1,73 : 1,73 (-40.30) |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnaalifold_input1.clustal --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaalifold_input1.clustal Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,7 @@ +CLUSTAL 2.1 multiple sequence alignment + + +Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA + ************************************** ************** ******* ********* + |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnaalifold_result1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaalifold_result1.txt Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,2 @@ +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 + -0.25) |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnacofold_input1.fas --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnacofold_input1.fas Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,2 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnacofold_result1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnacofold_result1.txt Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-A +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((((((((.(((((((((((..&.))))))..((((........)))).(((((.......))))).....))))))))))).))))))))))).. (-55.90) |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnadistance_input1.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnadistance_input1.dbn Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,2 @@ +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnadistance_result1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnadistance_result1.txt Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,1 @@ +f: 4 |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnaduplex_input1.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaduplex_input1.fa Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnaduplex_result1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaduplex_result1.txt Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC +.((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))). 1,73 : 1,72 (-40.70) |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnaeval_input1.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaeval_input1.dbn Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnaeval_result1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaeval_result1.txt Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnafold_input1.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_input1.fa Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnafold_input2.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_input2.fa Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnafold_result1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_result1.txt Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,6 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-A +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) +>Anolis_carolinensis_chrUn_GL343207.trna3-A +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60) |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnafold_result2.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_result2.txt Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,6 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-A +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +..(((.....((((....((..(((....)))..))...)))).....(((((.......)))))....))). ( -3.37) +>Anolis_carolinensis_chrUn_GL343207.trna3-A +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA +(((((..((.(((.....((..(((....)))..))......))).))(((((.......)))))..))))). ( -5.02) |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnafold_result3.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_result3.txt Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,3 @@ +>Sequence +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnaheat_input1.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaheat_input1.fa Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,2 @@ +> comment 1 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnaheat_result1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaheat_result1.txt Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,102 @@ +> comment 1 +0 0.0407267 +1 0.0435052 +2 0.0470227 +3 0.0505646 +4 0.0553391 +5 0.0603894 +6 0.0662047 +7 0.0718158 +8 0.0782007 +9 0.0863514 +10 0.0950516 +11 0.10505 +12 0.115613 +13 0.128245 +14 0.141712 +15 0.157281 +16 0.17497 +17 0.195056 +18 0.216799 +19 0.241743 +20 0.270432 +21 0.302132 +22 0.337644 +23 0.377263 +24 0.421546 +25 0.470799 +26 0.525589 +27 0.587016 +28 0.653829 +29 0.726606 +30 0.806458 +31 0.892656 +32 0.984857 +33 1.08272 +34 1.18601 +35 1.29332 +36 1.40305 +37 1.51467 +38 1.62618 +39 1.73524 +40 1.84032 +41 1.9407 +42 2.03385 +43 2.11859 +44 2.19443 +45 2.26182 +46 2.31999 +47 2.36969 +48 2.41182 +49 2.44826 +50 2.47967 +51 2.50769 +52 2.534 +53 2.55942 +54 2.5851 +55 2.61217 +56 2.64151 +57 2.67329 +58 2.70759 +59 2.74465 +60 2.78458 +61 2.8279 +62 2.8742 +63 2.92425 +64 2.97698 +65 3.03283 +66 3.09163 +67 3.15591 +68 3.23033 +69 3.3067 +70 3.38122 +71 3.45791 +72 3.54606 +73 3.63843 +74 3.73392 +75 3.83847 +76 3.94646 +77 4.05462 +78 4.16571 +79 4.28366 +80 4.39944 +81 4.50863 +82 4.61035 +83 4.70186 +84 4.78345 +85 4.85204 +86 4.90509 +87 4.9392 +88 4.95425 +89 4.95214 +90 4.93688 +91 4.91166 +92 4.87691 +93 4.8314 +94 4.78561 +95 4.75271 +96 4.71866 +97 4.66056 +98 4.57671 +99 4.48395 +100 4.39006 |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnainverse_input1.clu --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnainverse_input1.clu Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,2 @@ +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). +gggccccnnaauunnnnnnnnaauunGGGGcnnnnnnnAAAAAnnnnnuuuuannnnnnnuaaaaggggcccn |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnalalifold_input1.clustal --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnalalifold_input1.clustal Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,7 @@ +CLUSTAL 2.1 multiple sequence alignment + + +Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA + ************************************** ************** ******* ********* + |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnalalifold_result1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnalalifold_result1.txt Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,4 @@ +(((.(((((.(((((.......)))))..)).(((((.......)))))..)))))) (-19.05) 17 - 73 +((((........)))). ( -5.10) 10 - 26 +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA + |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnalfold_input1.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnalfold_input1.fa Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnalfold_result1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnalfold_result1.txt Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,28 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +.((((....)))). ( -0.10) 56 +.(((..((((....)))).))). ( -3.40) 51 +.(((((.......))))). ( -7.70) 48 +.((((..(((((.......)))))..)))). (-10.30) 42 +.(((((...(((((.......))))).))))). (-11.50) 40 +.((.(((((...(((((.......))))).))))))) (-12.10) 37 +.(((((.......))))). ( -5.80) 26 +.((.(((((.......)))))..)). ( -6.70) 23 +.((((....)))). ( -3.20) 21 +.((.((((....)))).)). ( -4.70) 18 +.((((........)))). ( -5.30) 9 +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))). (-22.00) 1 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA + (-22.00) +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +.(((..((((....)))).))). ( -3.40) 51 +.(((((.......))))). ( -9.20) 48 +.((((..(((((.......)))))..)))). (-11.80) 42 +.(((((...(((((.......))))).))))). (-13.30) 40 +.((.(((((...(((((.......))))).))))))) (-13.60) 37 +.(((((.......))))). ( -7.70) 26 +.((.(((((.......)))))..)). ( -8.60) 23 +.(((.(((((.(((((.......)))))..)).(((((.......)))))..)))))) (-20.00) 16 +.((((........)))). ( -5.30) 9 +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60) 1 +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA + (-29.60) |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnapaln_input1.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapaln_input1.fa Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnapaln_input1.fas --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapaln_input1.fas Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,1 @@ +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnapaln_result1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapaln_result1.txt Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,7 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +68.8844 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnapdist_input1.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapdist_input1.fa Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnapdist_result1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapdist_result1.txt Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +8.66253 |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnapkplex_input1.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapkplex_input1.fa Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnapkplex_result1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapkplex_result1.txt Tue Dec 06 12:35:35 2016 -0500 |
| [ |
| @@ -0,0 +1,6 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).[[[.(((((]]]....))))))))))).. (-31.90) +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA +(((((((..((((..[[[.[[)))).(((((.]].]]]))))).....(((((.......)))))))))))). (-38.54) |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnaplex_input1.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplex_input1.fa Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnaplex_result1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplex_result1.txt Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +.((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))). 1,73 : 1,72 (-40.70) i:72,j:1 <-41.26> + |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnaplfold_input1.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplfold_input1.fa Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnaplfold_result1.ps --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplfold_result1.ps Tue Dec 06 12:35:35 2016 -0500 |
| [ |
| @@ -0,0 +1,242 @@ +%!PS-Adobe-3.0 EPSF-3.0 +%%Title: RNA Dot Plot +%%Creator: ViennaRNA-2.2.10 +%%CreationDate: Tue Oct 4 14:45:55 2016 +%%BoundingBox: 66 530 520 650 +%%DocumentFonts: Helvetica +%%Pages: 1 +%%EndComments + +%Options: +%This file contains the square roots of the base pair probabilities in the form +% i j sqrt(p(i,j)) ubox + +%%BeginProlog +/DPdict 100 dict def +DPdict begin +/logscale false def +/lpmin 1e-05 log def + +/box { %size x y box - draws box centered on x,y + 2 index 0.5 mul sub % x -= 0.5 + exch 2 index 0.5 mul sub exch % y -= 0.5 + 3 -1 roll dup rectfill +} bind def + +/ubox { + logscale { + log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if + } if + 3 1 roll + exch len exch sub 1 add box +} bind def + +/lbox { + 3 1 roll + len exch sub 1 add box +} bind def + +/drawseq { +% print sequence along all 4 sides +[ [0.7 -0.3 0 ] + [0.7 0.7 len add 0] + [-0.3 len sub -0.4 -90] + [-0.3 len sub 0.7 len add -90] +] { + gsave + aload pop rotate translate + 0 1 len 1 sub { + dup 0 moveto + sequence exch 1 getinterval + show + } for + grestore + } forall +} bind def + +/drawgrid{ + 0.01 setlinewidth + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { + dup dup + 0 moveto + len lineto + dup + len exch sub 0 exch moveto + len exch len exch sub lineto + stroke + } for + [] 0 setdash + 0.04 setlinewidth + currentdict /cutpoint known { + cutpoint 1 sub + dup dup -1 moveto len 1 add lineto + len exch sub dup + -1 exch moveto len 1 add exch lineto + stroke + } if + 0.5 neg dup translate +} bind def + +end +%%EndProlog +DPdict begin +%delete next line to get rid of title +270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343590.trna2-A) show + +/sequence { (\ +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\ +) } def +/winSize 70 def +/len { sequence length } bind def + +292 416 translate +72 6 mul len 1 add winSize add 2 sqrt mul div dup scale +/Helvetica findfont 0.95 scalefont setfont + +/drawseq_turn {% print sequence at bottom + gsave + len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate + 0 1 len 1 sub { + dup dup 2 sqrt mul 0 moveto + sequence exch 1 getinterval + show + } for + grestore +} bind def +/drawgrid_turn{ + 0.01 setlinewidth + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { %for (0, gridspacing, len) + dup dup %duplicate what - gridspacing?? + dup len exch sub moveto %moveto diagonal? + dup winSize gt + {dup dup len exch sub winSize add lineto} + {dup len lineto}ifelse + dup len exch sub moveto %moveto diagonal? + dup len winSize sub le + {dup dup len exch sub dup winSize exch sub len add exch lineto} + {dup dup len exch sub len exch lineto}ifelse stroke pop pop + } for + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { %for (0, gridspacing, len) + dup dup %duplicate what - gridspacing?? + dup len exch sub moveto %moveto diagonal? + len exch sub 0.7 sub exch 0.7 sub exch lineto + stroke + }for + winSize len moveto len winSize lineto stroke + [] 0 setdash + 0.04 setlinewidth + currentdict /cutpoint known { + cutpoint 1 sub + dup dup -1 moveto len 1 add lineto + len exch sub dup + -1 exch moveto len 1 add exch lineto + stroke + } if + 0.5 neg dup translate +} bind def + +0.5 dup translate +drawseq_turn +45 rotate + + +%draw the grid +drawgrid_turn + +%start of base pair probability data +2 70 0.1568 ubox +2 71 0.9619 ubox +3 69 0.1395 ubox +3 70 0.7414 ubox +3 72 0.8060 ubox +4 68 0.1157 ubox +4 69 0.6748 ubox +4 71 0.4682 ubox +5 67 0.1065 ubox +5 68 0.6724 ubox +5 70 0.3765 ubox +6 47 0.1250 ubox +6 67 0.6497 ubox +7 46 0.1273 ubox +7 66 0.6008 ubox +8 45 0.1294 ubox +8 48 0.2252 ubox +9 47 0.2335 ubox +10 25 0.7863 ubox +11 24 0.7884 ubox +11 43 0.5215 ubox +11 45 0.2330 ubox +12 23 0.7883 ubox +12 42 0.5493 ubox +12 44 0.2317 ubox +13 22 0.7882 ubox +13 41 0.5528 ubox +13 43 0.2306 ubox +14 40 0.5338 ubox +15 20 0.1027 ubox +16 38 0.5325 ubox +16 40 0.1646 ubox +17 37 0.5639 ubox +17 39 0.1633 ubox +18 36 0.5591 ubox +18 38 0.1125 ubox +19 36 0.2406 ubox +20 34 0.5341 ubox +20 35 0.2514 ubox +21 33 0.4064 ubox +22 32 0.2491 ubox +22 33 0.4413 ubox +23 32 0.5541 ubox +24 31 0.6100 ubox +25 30 0.6092 ubox +26 36 0.2144 ubox +27 35 0.2146 ubox +27 43 0.7269 ubox +28 34 0.2043 ubox +28 42 0.7445 ubox +29 41 0.7467 ubox +30 40 0.7468 ubox +31 39 0.7470 ubox +38 73 0.3242 ubox +39 72 0.3055 ubox +40 73 0.1211 ubox +41 71 0.2953 ubox +41 72 0.1146 ubox +42 70 0.2588 ubox +43 69 0.2613 ubox +43 71 0.2848 ubox +44 68 0.2587 ubox +44 70 0.3418 ubox +45 67 0.2339 ubox +45 68 0.1772 ubox +45 69 0.3617 ubox +45 70 0.1014 ubox +45 72 0.3111 ubox +46 67 0.2550 ubox +46 68 0.3039 ubox +46 69 0.1150 ubox +46 71 0.2540 ubox +47 66 0.2925 ubox +48 67 0.1378 ubox +49 65 0.9938 ubox +50 64 0.9971 ubox +51 63 0.9980 ubox +52 62 0.9980 ubox +53 61 0.9963 ubox +54 59 0.1628 ubox +55 60 0.1625 ubox +showpage +end +%%EOF |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnaplfold_result2.ps --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplfold_result2.ps Tue Dec 06 12:35:35 2016 -0500 |
| [ |
| @@ -0,0 +1,212 @@ +%!PS-Adobe-3.0 EPSF-3.0 +%%Title: RNA Dot Plot +%%Creator: ViennaRNA-2.2.10 +%%CreationDate: Tue Oct 4 14:45:55 2016 +%%BoundingBox: 66 530 520 650 +%%DocumentFonts: Helvetica +%%Pages: 1 +%%EndComments + +%Options: +%This file contains the square roots of the base pair probabilities in the form +% i j sqrt(p(i,j)) ubox + +%%BeginProlog +/DPdict 100 dict def +DPdict begin +/logscale false def +/lpmin 1e-05 log def + +/box { %size x y box - draws box centered on x,y + 2 index 0.5 mul sub % x -= 0.5 + exch 2 index 0.5 mul sub exch % y -= 0.5 + 3 -1 roll dup rectfill +} bind def + +/ubox { + logscale { + log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if + } if + 3 1 roll + exch len exch sub 1 add box +} bind def + +/lbox { + 3 1 roll + len exch sub 1 add box +} bind def + +/drawseq { +% print sequence along all 4 sides +[ [0.7 -0.3 0 ] + [0.7 0.7 len add 0] + [-0.3 len sub -0.4 -90] + [-0.3 len sub 0.7 len add -90] +] { + gsave + aload pop rotate translate + 0 1 len 1 sub { + dup 0 moveto + sequence exch 1 getinterval + show + } for + grestore + } forall +} bind def + +/drawgrid{ + 0.01 setlinewidth + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { + dup dup + 0 moveto + len lineto + dup + len exch sub 0 exch moveto + len exch len exch sub lineto + stroke + } for + [] 0 setdash + 0.04 setlinewidth + currentdict /cutpoint known { + cutpoint 1 sub + dup dup -1 moveto len 1 add lineto + len exch sub dup + -1 exch moveto len 1 add exch lineto + stroke + } if + 0.5 neg dup translate +} bind def + +end +%%EndProlog +DPdict begin +%delete next line to get rid of title +270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343207.trna3-A) show + +/sequence { (\ +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\ +) } def +/winSize 70 def +/len { sequence length } bind def + +292 416 translate +72 6 mul len 1 add winSize add 2 sqrt mul div dup scale +/Helvetica findfont 0.95 scalefont setfont + +/drawseq_turn {% print sequence at bottom + gsave + len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate + 0 1 len 1 sub { + dup dup 2 sqrt mul 0 moveto + sequence exch 1 getinterval + show + } for + grestore +} bind def +/drawgrid_turn{ + 0.01 setlinewidth + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { %for (0, gridspacing, len) + dup dup %duplicate what - gridspacing?? + dup len exch sub moveto %moveto diagonal? + dup winSize gt + {dup dup len exch sub winSize add lineto} + {dup len lineto}ifelse + dup len exch sub moveto %moveto diagonal? + dup len winSize sub le + {dup dup len exch sub dup winSize exch sub len add exch lineto} + {dup dup len exch sub len exch lineto}ifelse stroke pop pop + } for + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { %for (0, gridspacing, len) + dup dup %duplicate what - gridspacing?? + dup len exch sub moveto %moveto diagonal? + len exch sub 0.7 sub exch 0.7 sub exch lineto + stroke + }for + winSize len moveto len winSize lineto stroke + [] 0 setdash + 0.04 setlinewidth + currentdict /cutpoint known { + cutpoint 1 sub + dup dup -1 moveto len 1 add lineto + len exch sub dup + -1 exch moveto len 1 add exch lineto + stroke + } if + 0.5 neg dup translate +} bind def + +0.5 dup translate +drawseq_turn +45 rotate + + +%draw the grid +drawgrid_turn + +%start of base pair probability data +2 70 0.1914 ubox +2 71 0.9787 ubox +3 69 0.1660 ubox +3 70 0.7676 ubox +3 72 0.8449 ubox +4 68 0.1377 ubox +4 69 0.7113 ubox +4 71 0.4928 ubox +5 67 0.1266 ubox +5 68 0.7090 ubox +5 70 0.3955 ubox +6 67 0.6860 ubox +7 66 0.6345 ubox +10 25 0.9888 ubox +11 24 0.9915 ubox +12 23 0.9914 ubox +13 22 0.9913 ubox +15 20 0.1291 ubox +17 73 0.1217 ubox +18 72 0.1091 ubox +27 43 0.9522 ubox +28 42 0.9836 ubox +29 41 0.9874 ubox +30 40 0.9886 ubox +31 39 0.9883 ubox +33 37 0.1014 ubox +38 73 0.1170 ubox +39 72 0.1080 ubox +41 71 0.1523 ubox +42 70 0.1341 ubox +43 69 0.1387 ubox +43 71 0.2800 ubox +44 68 0.1392 ubox +44 70 0.3364 ubox +45 67 0.1266 ubox +45 68 0.1838 ubox +45 69 0.3586 ubox +45 72 0.3252 ubox +46 67 0.2524 ubox +46 68 0.3007 ubox +46 69 0.1142 ubox +46 71 0.2655 ubox +47 66 0.2807 ubox +48 67 0.1394 ubox +49 65 0.9981 ubox +50 64 0.9997 ubox +51 63 0.9997 ubox +52 62 0.9997 ubox +53 61 0.9981 ubox +54 59 0.1565 ubox +55 60 0.3242 ubox +showpage +end +%%EOF |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnaplot_input1.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplot_input1.dbn Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-21.90) |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnaplot_input1.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplot_input1.fa Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnasnoop_input1a.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnasnoop_input1a.fa Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,2 @@ +>homo +CGCGACCUCAGAUCAGACGUGGCGACCCGCUGAAUUUAAGCAUAUUAGUCAGCGGAGGAAAAGAAACUAACCAGGAUUCCCUCAGUAACGGCGAGUGAACAGGGAAGAGCCCAGCGCCGAAUCCCCGCCCCGCGGGGCGCGGGACAUGUGGCGUACGGAAGACCCGCUCCCCGGCGCCGCUCGUGGGGGGCCCAAGUCCUUCUGAUCGAGGCCCAGCCCGUGGACGGUGUGAGGCCGGUAGCGGCCGGCGCGCGCCCGGGUCUUCCCGGAGUCGGGUUGCUUGGGAAUGCAGCCCAAAGCGGGUGGUAAACUCCAUCUAAGGCUAAAUACCGGCACGAGACCGAUAGUCAACAAGUACCGUAAGGGAAAGUUGAAAAGAACUUUGAAGAGAGAGUUCAAGAGGGCGUGAAACCGUUAAGAGGUAAACGGGUGGGGUCCGCGCAGUCCGCCCGGAGGAUUCAACCCGGCGGCGGGUCCGGCCGUGUCGGCGGCCCGGCGGAUCUUUCCCGCCCCCCGUUCCUCCCGACCCCUCCACCCGCCCUCCCUUCCCCCGCCGCCCCUCCUCCUCCUCCCCGGAGGGGGCGGGCUCCGGCGGGUGCGGGGGUGGGCGGGCGGGGCCGGGGGUGGGGUCGGCGGGGGACCGUCCCCCGACCGGCGACCGGCCGCCGCCGGGCGCAUUUCCACCGCGGCGGUGCGCCGCGACCGGCUCCGGGACGGCUGGGAAGGCCCGGCGGGGAAGGUGGCUCGGGGGGCCCCGUCCGUCCGUCCGUCCUCCUCCUCCCCCGUCUCCGCCCCCCGGCCCCGCGUCCUCCCUCGGGAGGGCGCGCGGGUCGGGGCGGCGGCGGCGGCGGCGGUGGCGGCGGCGGCGGGGGCGGCGGGACCGAAACCCCCCCCGAGUGUUACAGCCCCCCCGGCAGCAGCACUCGCCGAAUCCCGGGGCCGAGGGAGCGAGACCCGUCGCCGCGCUCUCCCCCCUCCCGGCGCCCACCCCCGCGGGGAAUCCCCCGCGAGGGGGGUCUCCCCCGCGGGGGCGCGCCGGCGUCUCCUCGUGGGGGGGCCGGGCCACCCCUCCCACGGCGCGACCGCUCUCCCACCCCUCCUCCCCGCGCCCCCGCCCCGGCGACGGGGGGGGUGCCGCGCGCGGGUCGGGGGGCGGGGCGGACUGUCCCCAGUGCGCCCCGGGCGGGUCGCGCCGUCGGGCCCGGGGGAGGUUCUCUCGGGGCCACGCGCGCGUCCCCCGAAGAGGGGGACGGCGGAGCGAGCGCACGGGGUCGGCGGCGACGUCGGCUACCCACCCGACCCGUCUUGAAACACGGACCAAGGAGUCUAACACGUGCGCGAGUCGGGGGCUCGCACGAAAGCCGCCGUGGCGCAAUGAAGGUGAAGGCCGGCGCGCUCGCCGGCCGAGGUGGGAUCCCGAGGCCUCUCCAGUCCGCCGAGGGCGCACCACCGGCCCGUCUCGCCCGCCGCGCCGGGGAGGUGGAGCACGAGCGCACGUGUUAGGACCCGAAAGAUGGUGAACUAUGCCUGGGCAGGGCGAAGCCAGAGGAAACUCUGGUGGAGGUCCGUAGCGGUCCUGACGUGCAAAUCGGUCGUCCGACCUGGGUAUAGGGGCGAAAGACUAAUCGAACCAUCUAGUAGCUGGUUCCCUCCGAAGUUUCCCUCAGGAUAGCUGGCGCUCUCGCAGACCCGACGCACCCCCGCCACGCAGUUUUAUCCGGUAAAGCGAAUGAUUAGAGGUCUUGGGGCCGAAACGAUCUCAACCUAUUCUCAAACUUUAAAUGGGUAAGAAGCCCGGCUCGCUGGCGUGGAGCCGGGCGUGGAAUGCGAGUGCCUAGUGGGCCACUUUUGGUAAGCAGAACUGGCGCUGCGGGAUGAACCGAACGCCGGGUUAAGGCGCCCGAUGCCGACGCUCAUCAGACCCCAGAAAAGGUGUUGGUUGAUAUAGACAGCAGGACGGUGGCCAUGGAAGUCGGAAUCCGCUAAGGAGUGUGUAACAACUCACCUGCCGAAUCAACUAGCCCUGAAAAUGGAUGGCGCUGGAGCGUCGGGCCCAUACCCGGCCGUCGCCGGCAGUCGAGAGUGGACGGGAGCGGCGGGGGCGGCGCGCGCGCGCGCGCGUGUGGUGUGCGUCGGAGGGCGGCGGCGGCGGCGGCGGCGGGGGUGUGGGGUCCUUCCCCCGCCCCCCCCCCCACGCCUCCUCCCCUCCUCCCGCCCACGCCCCGCUCCCCGCCCCCGGAGCCCCGCGGACGCUACGCCGCGACGAGUAGGAGGGCCGCUGCGGUGAGCCUUGAAGCCUAGGGCGCGGGCCCGGGUGGAGCCGCCGCAGGUGCAGAUCUUGGUGGUAGUAGCAAAUAUUCAAACGAGAACUUUGAAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGAACAUGGGUCAGUCGGUCCUGAGAGAUGGGCGAGCGCCGUUCCGAAGGGACGGGCGAUGGCCUCCGUUGCCCUCGGCCGAUCGAAAGGGAGUCGGGUUCAGAUCCCCGAAUCCGGAGUGGCGGAGAUGGGCGCCGCGAGGCGUCCAGUGCGGUAACGCGACCGAUCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGUUCUCUUUUCUUUGUGAAGGGCAGGGCGCCCUGGAAUGGGUUCGCCCCGAGAGAGGGGCCCGUGCCUUGGAAAGCGUCGCGGUUCCGGCGGCGUCCGGUGAGCUCUCGCUGGCCCUUGAAAAUCCGGGGGAGAGGGUGUAAAUCUCGCGCCGGGCCGUACCCAUAUCCGCAGCAGGUCUCCAAGGUGAACAGCCUCUGGCAUGUUGGAACAAUGUAGGUAAGGGAAGUCGGCAAGCCGGAUCCGUAACUUCGGGAUAAGGAUUGGCUCUAAGGGCUGGGUCGGUCGGGCUGGGGCGCGAAGCGGGGCUGGGCGCGCGCCGCGGCUGGACGAGGCGCGCGCCCCCCCCACGCCCGGGGCACCCCCCUCGCGGCCCUCCCCCGCCCCACCCGCGCGCGCCGCUCGCUCCCUCCCCACCCCGCGCCCUCUCUCUCUCUCUCUCCCCCGCUCCCCGUCCUCCCCCCUCCCCGGGGGAGCGCCGCGUGGGGGCGCGGCGGGGGGAGAAGGGUCGGGGCGGCAGGGGCCGCGCGGCGGCCGCCGGGGCGGCCGGCGGGGGCAGGUCCCCGCGAGGGGGGCCCCGGGGACCCGGGGGGCCGGCGGCGGCGCGGACUCUGGACGCGAGCCGGGCCCUUCCCGUGGAUCGCCCCAGCUGCGGCGGGCGUCGCGGCCGCCCCCGGGGAGCCCGGCGGCGGCGCGGCGCGCCCCCCACCCCCACCCCACGUCUCGGUCGCGCGCGCGUCCGCUGGGGGCGGGAGCGGUCGGGCGGCGGCGGUCGGCGGGCGGCGGGGCGGGGCGGUUCGUCCCCCCGCCCUACCCCCCCGGCCCCGUCCGCCCCCCGUUCCCCCCUCCUCCUCGGCGCGCGGCGGCGGCGGCGGCAGGCGGCGGAGGGGCCGCGGGCCGGUCCCCCCCGCCGGGUCCGCCCCCGGGGCCGCGGUUCCGCGCGCGCCUCGCCUCGGCCGGCGCCUAGCAGCCGACUUAGAACUGGUGCGGACCAGGGGAAUCCGACUGUUUAAUUAAAACAAAGCAUCGCGAAGGCCCGCGGCGGGUGUUGACGCGAUGUGAUUUCUGCCCAGUGCUCUGAAUGUCAAAGUGAAGAAAUUCAAUGAAGCGCGGGUAAACGGCGGGAGUAACUAUGACUCUCUUAAGGUAGCCAAAUGCCUCGUCAUCUAAUUAGUGACGCGCAUGAAUGGAUGAACGAGAUUCCCACUGUCCCUACCUACUAUCCAGCGAAACCACAGCCAAGGGAACGGGCUUGGCGGAAUCAGCGGGGAAAGAAGACCCUGUUGAGCUUGACUCUAGUCUGGCACGGUGAAGAGACAUGAGAGGUGUAGAAUAAGUGGGAGGCCCCCGGCGCCCCCCCGGUGUCCCCGCGAGGGGCCCGGGGCGGGGUCCGCGGCCCUGCGGGCCGCCGGUGAAAUACCACUACUCUGAUCGUUUUUUCACUGACCCGGUGAGGCGGGGGGGCGAGCCCGAGGGGCUCUCGCUUCUGGCGCCAAGCGCCCGCCCGGCCGGGCGCGACCCGCUCCGGGGACAGUGCCAGGUGGGGAGUUUGACUGGGGCGGUACACCUGUCAAACGGUAACGCAGGUGUCCUAAGGCGAGCUCAGGGAGGACAGAAACCUCCCGUGGAGCAGAAGGGCAAAAGCUCGCUUGAUCUUGAUUUUCAGUACGAAUACAGACCGUGAAAGCGGGGCCUCACGAUCCUUCUGACCUUUUGGGUUUUAAGCAGGAGGUGUCAGAAAAGUUACCACAGGGAUAACUGGCUUGUGGCGGCCAAGCGUUCAUAGCGACGUCGCUUUUUGAUCCUUCGAUGUCGGCUCUUCCUAUCAUUGUGAAGCAGAAUUCGCCAAGCGUUGGAUUGUUCACCCACUAAUAGGGAACGUGAGCUGGGUUUAGACCGUCGUGAGACAGGUUAGUUUUACCCUACUGAUGAUGUGUUGUUGCCAUGGUAAUCCUGCUCAGUACGAGAGGAACCGCAGGUUCAGACAUUUGGUGUAUGUGCUUGGCUGAGGAGCCAAUGGGGCGAAGCUACCAUCUGUGGGAUUAUGACUGAACGCCUCUAAGUCAGAAUCCCGCCCAGGCGAACGAUACGGCAGCGCCGCGGAGCCUCGGUUGGCCUCGGAUAGCCGGUCCCCCGCCUGUCCCCGCCGGCGGGCCGCCCCCCCCUCCACGCGCCCCGCCGCGGGAGGGCGCGUGCCCCGCCGCGCGCCGGGACCGGGGUCCGGUGCGGAGUGCCCUUCGUCCUGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCUCGCCCGUCACGCACCGCACGUUCGUGGGGAACCUGGCGCUAAACCAUUCGUAGACGACCUGCUUCUGGGUCGGGGUUUCGUACGUAGCAGAGCAGCUCCCUCGCUGCGAUCUAUUGAAAGUCAGCCCUCGACACAAGGGUUUGUC |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnasnoop_input1b.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnasnoop_input1b.fa Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,2 @@ +>ACA51 +AACCTACCCCATATACACCTCAGCTCAGGCCCTGTGCCTGGTCTGTATTGTGAATGGGGGAACATAG |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnasnoop_result1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnasnoop_result1.txt Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,4 @@ +>ACA51 +>homo +<<<<<.<<<<.|.<<.<<<&...(((>>>.>>.((((...............................))))..>>>>.>>>>>))) 4468,4486;4479 : 8,65 (-35.60 = -16.10 + -7.60 + -12.40 + -3.60 + 4.1 ) (-23.60) +UGUUCACCCACUAAUAGGG&AACCUACCCCAUAUACACCUCAGCUCAGGCCCUGUGCCUGGUCUGUAUUGUGAAUGGGGGAACAUAG |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnasubopt_input1.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnasubopt_input1.fa Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnasubopt_result1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnasubopt_result1.txt Tue Dec 06 12:35:35 2016 -0500 |
| [ |
| @@ -0,0 +1,7 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-A [0] +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA -22.00 0.00 +(((((((..((((........)))).(((((.......))))).....(((((.......))))))))).))) -22.00 +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. -22.00 +>Anolis_carolinensis_chrUn_GL343207.trna3-A [0] +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA -29.60 0.00 +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). -29.60 |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnaup_input1.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaup_input1.fa Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 000000000000 -r 4286146cb3aa test-data/rnaup_result1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaup_result1.txt Tue Dec 06 12:35:35 2016 -0500 |
| b |
| @@ -0,0 +1,6 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC + 55, 58 (0.019) for u= 4 +RNAup output in file: Anolis_carolinensis_chrUn_GL343590.trna2-A_u1.out +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC + 16, 19 (0.004) for u= 4 +RNAup output in file: Anolis_carolinensis_chrUn_GL343207.trna3-A_u1.out |
| b |
| diff -r 000000000000 -r 4286146cb3aa vienna_rna.tar.gz |
| b |
| Binary file vienna_rna.tar.gz has changed |