| Next changeset 1:dddde948c3e5 (2013-12-11) |
|
Commit message:
Uploaded tool tarball. |
|
added:
samtools_mpileup.xml samtools_wrapper.py test-data/gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam test-data/phiX.fasta test-data/samtools/mpileup/samtools_mpileup_out_1.log test-data/samtools/mpileup/samtools_mpileup_out_1.pileup test-data/samtools/mpileup/samtools_mpileup_out_2.bcf tool-data/sam_fa_indices.loc.sample tool-data/tool_data_table_conf.xml.sample tool_dependencies.xml |
| b |
| diff -r 000000000000 -r 44a18a94d7a9 samtools_mpileup.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samtools_mpileup.xml Mon Aug 26 14:23:36 2013 -0400 |
| [ |
| b'@@ -0,0 +1,213 @@\n+<tool id="samtools_mpileup" name="MPileup" version="0.0.1">\n+ <description>SNP and indel caller</description>\n+ <requirements>\n+ <requirement type="package" version="0.1.18">samtools</requirement>\n+ </requirements>\n+ <command interpreter="python">samtools_wrapper.py\n+ -p \'samtools mpileup\'\n+ --stdout "${output_log}"\n+ #if $reference_source.reference_source_selector != "history":\n+ -p \'-f "${reference_source.ref_file.fields.path}"\'\n+ #else:\n+ -d "-f" "${reference_source.ref_file}" "fa" "reference_input"\n+ #end if\n+ #for $i, $input_bam in enumerate( $reference_source.input_bams ):\n+ -d " " "${input_bam.input_bam}" "${input_bam.input_bam.ext}" "bam_input_${i}"\n+ -d "" "${input_bam.input_bam.metadata.bam_index}" "bam_index" "bam_input_${i}" ##hardcode galaxy ext type as bam_index\n+ #end for\n+ -p \'\n+ #if str( $advanced_options.advanced_options_selector ) == "advanced":\n+ ${advanced_options.skip_anomalous_read_pairs}\n+ ${advanced_options.disable_probabilistic_realignment}\n+ -C "${advanced_options.coefficient_for_downgrading}"\n+ -d "${advanced_options.max_reads_per_bam}"\n+ ${advanced_options.extended_BAQ_computation}\n+ #if str( $advanced_options.position_list ) != \'None\':\n+ -l "${advanced_options.position_list}"\n+ #end if\n+ -q "${advanced_options.minimum_mapping_quality}"\n+ -Q "${advanced_options.minimum_base_quality}"\n+ #if str( $advanced_options.region_string ):\n+ -r "${advanced_options.region_string}"\n+ #end if\n+ ${advanced_options.output_per_sample_read_depth}\n+ ${advanced_options.output_per_sample_strand_bias_p_value}\n+ #end if\n+ #if str( $genotype_likelihood_computation_type.genotype_likelihood_computation_type_selector ) == \'perform_genotype_likelihood_computation\':\n+ ##-g or -u\n+ -g\n+ -e "${genotype_likelihood_computation_type.gap_extension_sequencing_error_probability}"\n+ -h "${genotype_likelihood_computation_type.coefficient_for_modeling_homopolymer_errors}"\n+ #if str( $genotype_likelihood_computation_type.perform_indel_calling.perform_indel_calling_selector ) == \'perform_indel_calling\':\n+ -L "${genotype_likelihood_computation_type.perform_indel_calling.skip_indel_calling_above_sample_depth}"\n+ #else:\n+ -I\n+ #end if\n+ -o "${genotype_likelihood_computation_type.gap_open_sequencing_error_probability}"\n+ #if len( $genotype_likelihood_computation_type.platform_list_repeat ):\n+ -P "${ ",".join( [ str( platform.platform_entry ) for platform in $genotype_likelihood_computation_type.platform_list_repeat ] ) }"\n+ #end if\n+ #end if\n+ > "${output_mpileup}"\n+ \'\n+ </command>\n+ <inputs>\n+ <conditional name="reference_source">\n+ <param name="reference_source_selector" type="select" label="Choose the source for the reference list">\n+ <option value="cached">Locally cached</option>\n+ <option value="history">History</option>\n+ </param>\n+ <when value="cached">\n+ <repeat name="input_bams" title="BAM file" min="1">\n+ <param name="input_bam" type="data" format="bam" label="BAM file">\n+ <validator type="unspecified_build" />\n+ <validator type="dataset_metadata_in_data_table" table_name="sam_fa_indexes" metadata_name="dbkey" metadata_column="value" message="Sequences are not currently available for the specified build." /> <!-- fixme!!! this needs to be a select -->\n+ </param>\n+ </repeat>\n+ <param name="ref_file" type="select" label="Using reference genome">\n+ <options from_data_table="sam_fa_indexes">\n+ <!-- <filter type="data_meta" key="dbkey" ref="input_bam" column="value"/> does not yet work in a repeat...--> \n+ </options>\n+ </param>\n+ </when>\n+ <when value="history"> <!-- FIX ME!!!! -->\n'..b'ype_likelihood_computation" />\n+ <param name="gap_extension_sequencing_error_probability" value="20" />\n+ <param name="coefficient_for_modeling_homopolymer_errors" value="100" />\n+ <param name="perform_indel_calling_selector" value="perform_indel_calling" />\n+ <param name="skip_indel_calling_above_sample_depth" value="250" />\n+ <param name="gap_open_sequencing_error_probability" value="40" />\n+ <param name="platform_list_repeat" value="0" />\n+ <param name="advanced_options_selector" value="basic" />\n+ <output name="output_mpileup" file="samtools/mpileup/samtools_mpileup_out_2.bcf" /> \n+ <output name="output_log" file="samtools/mpileup/samtools_mpileup_out_1.log" />\n+ </test>\n+ </tests>\n+ <help>\n+**What it does**\n+\n+ Generate BCF or pileup for one or multiple BAM files. Alignment records are grouped by sample identifiers in @RG header lines. If sample identifiers are absent, each input file is regarded as one sample. \n+\n+------\n+\n+**Settings**::\n+\n+ Input Options:\n+ -6 \tAssume the quality is in the Illumina 1.3+ encoding.\n+ -A Do not skip anomalous read pairs in variant calling.\n+ -B \tDisable probabilistic realignment for the computation of base alignment quality (BAQ). BAQ is the Phred-scaled probability of a read base being misaligned. Applying this option greatly helps to reduce false SNPs caused by misalignments.\n+ -b FILE \tList of input BAM files, one file per line [null]\n+ -C INT \tCoefficient for downgrading mapping quality for reads containing excessive mismatches. Given a read with a phred-scaled probability q of being generated from the mapped position, the new mapping quality is about sqrt((INT-q)/INT)*INT. A zero value disables this functionality; if enabled, the recommended value for BWA is 50. [0]\n+ -d INT \tAt a position, read maximally INT reads per input BAM. [250]\n+ -E \tExtended BAQ computation. This option helps sensitivity especially for MNPs, but may hurt specificity a little bit.\n+ -f FILE \tThe faidx-indexed reference file in the FASTA format. The file can be optionally compressed by razip. [null]\n+ -l FILE \tBED or position list file containing a list of regions or sites where pileup or BCF should be generated [null]\n+ -q INT \tMinimum mapping quality for an alignment to be used [0]\n+ -Q INT \tMinimum base quality for a base to be considered [13]\n+ -r STR \tOnly generate pileup in region STR [all sites]\n+ Output Options:\n+ \t\n+ -D \tOutput per-sample read depth\n+ -g \tCompute genotype likelihoods and output them in the binary call format (BCF).\n+ -S \tOutput per-sample Phred-scaled strand bias P-value\n+ -u \tSimilar to -g except that the output is uncompressed BCF, which is preferred for piping.\n+ \n+ Options for Genotype Likelihood Computation (for -g or -u):\n+ \t\n+ -e INT \tPhred-scaled gap extension sequencing error probability. Reducing INT leads to longer indels. [20]\n+ -h INT \tCoefficient for modeling homopolymer errors. Given an l-long homopolymer run, the sequencing error of an indel of size s is modeled as INT*s/l. [100]\n+ -I \tDo not perform INDEL calling\n+ -L INT \tSkip INDEL calling if the average per-sample depth is above INT. [250]\n+ -o INT \tPhred-scaled gap open sequencing error probability. Reducing INT leads to more indel calls. [40]\n+ -P STR \tComma dilimited list of platforms (determined by @RG-PL) from which indel candidates are obtained. It is recommended to collect indel candidates from sequencing technologies that have low indel error rate such as ILLUMINA. [all]\n+\n+------\n+\n+**Citation**\n+\n+For the underlying tool, please cite `Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R; 1000 Genome Project Data Processing Subgroup. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 2009 Aug 15;25(16):2078-9. <http://www.ncbi.nlm.nih.gov/pubmed/19505943>`_\n+\n+If you use this tool in Galaxy, please cite Blankenberg D, et al. *In preparation.*\n+\n+ </help>\n+</tool>\n' |
| b |
| diff -r 000000000000 -r 44a18a94d7a9 samtools_wrapper.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samtools_wrapper.py Mon Aug 26 14:23:36 2013 -0400 |
| b |
| @@ -0,0 +1,110 @@ +#!/usr/bin/env python +#Dan Blankenberg + +""" +A wrapper script for running SAMTools commands. +""" + +import sys, optparse, os, tempfile, subprocess, shutil +from string import Template + +GALAXY_EXT_TO_SAMTOOLS_EXT = { 'bam_index':'bam.bai', } #items not listed here will use the galaxy extension as-is +GALAXY_EXT_TO_SAMTOOLS_FILE_TYPE = GALAXY_EXT_TO_SAMTOOLS_EXT #for now, these are the same, but could be different if needed +DEFAULT_SAMTOOLS_PREFIX = "SAMTools_file" +CHUNK_SIZE = 2**20 #1mb + + +def cleanup_before_exit( tmp_dir ): + if tmp_dir and os.path.exists( tmp_dir ): + shutil.rmtree( tmp_dir ) + +def SAMTOOLS_filename_from_galaxy( galaxy_filename, galaxy_ext, target_dir = None, prefix = None ): + suffix = GALAXY_EXT_TO_SAMTOOLS_EXT.get( galaxy_ext, galaxy_ext ) + if prefix is None: + prefix = DEFAULT_SAMTOOLS_PREFIX + if target_dir is None: + target_dir = os.getcwd() + SAMTools_filename = os.path.join( target_dir, "%s.%s" % ( prefix, suffix ) ) + os.symlink( galaxy_filename, SAMTools_filename ) + return SAMTools_filename + +def SAMTOOLS_filetype_argument_substitution( argument, galaxy_ext ): + return argument % dict( file_type = GALAXY_EXT_TO_SAMTOOLS_FILE_TYPE.get( galaxy_ext, galaxy_ext ) ) + +def open_file_from_option( filename, mode = 'rb' ): + if filename: + return open( filename, mode = mode ) + return None + +def html_report_from_directory( html_out, dir ): + html_out.write( '<html>\n<head>\n<title>Galaxy - SAMTOOLS Output</title>\n</head>\n<body>\n<p/>\n<ul>\n' ) + for fname in sorted( os.listdir( dir ) ): + html_out.write( '<li><a href="%s">%s</a></li>\n' % ( fname, fname ) ) + html_out.write( '</ul>\n</body>\n</html>\n' ) + +def __main__(): + #Parse Command Line + parser = optparse.OptionParser() + parser.add_option( '-p', '--pass_through', dest='pass_through_options', action='append', type="string", help='These options are passed through directly to SAMTOOLS, without any modification.' ) + parser.add_option( '-d', '--dataset', dest='datasets', action='append', type="string", nargs=4, help='"-argument" "original_filename" "galaxy_filetype" "name_prefix"' ) + parser.add_option( '', '--stdout', dest='stdout', action='store', type="string", default=None, help='If specified, the output of stdout will be written to this file.' ) + parser.add_option( '', '--stderr', dest='stderr', action='store', type="string", default=None, help='If specified, the output of stderr will be written to this file.' ) + parser.add_option( '', '--html_report_from_directory', dest='html_report_from_directory', action='append', type="string", nargs=2, help='"Target HTML File" "Directory"') + (options, args) = parser.parse_args() + + tmp_dir = tempfile.mkdtemp( prefix='tmp-SAMTOOLS-' ) + + #set up stdout and stderr output options + stdout = open_file_from_option( options.stdout, mode = 'wb' ) + stderr = open_file_from_option( options.stderr, mode = 'wb' ) + #if no stderr file is specified, we'll use our own + if stderr is None: + stderr = tempfile.NamedTemporaryFile( prefix="SAMTOOLS-stderr-", dir=tmp_dir ) + + if options.pass_through_options: + cmd = ' '.join( options.pass_through_options ) + else: + cmd = '' + return_code = None + if options.datasets: + for ( dataset_arg, filename, galaxy_ext, prefix ) in options.datasets: + SAMTools_filename = SAMTOOLS_filename_from_galaxy( filename, galaxy_ext, target_dir = tmp_dir, prefix = prefix ) + if dataset_arg: + if '>' in cmd: + cmd = cmd.replace( '>', ' %s "%s" >' % ( SAMTOOLS_filetype_argument_substitution( dataset_arg, galaxy_ext ), SAMTools_filename ), 1 ) + else: + cmd = '%s %s "%s"' % ( cmd, SAMTOOLS_filetype_argument_substitution( dataset_arg, galaxy_ext ), SAMTools_filename ) + #auto index fasta files: + if galaxy_ext == 'fa': + index_cmd = 'samtools faidx %s' % ( SAMTools_filename ) + proc = subprocess.Popen( args=index_cmd, stdout=stdout, stderr=stderr, shell=True, cwd=tmp_dir ) + return_code = proc.wait() + if return_code: + break + if return_code is None or not return_code: + proc = subprocess.Popen( args=cmd, stdout=stdout, stderr=stderr, shell=True, cwd=tmp_dir ) + return_code = proc.wait() + if return_code: + stderr_target = sys.stderr + else: + if stdout: + stderr_target = stdout + else: + stderr_target = sys.stdout + stderr.flush() + stderr.seek(0) + while True: + chunk = stderr.read( CHUNK_SIZE ) + if chunk: + stderr_target.write( chunk ) + else: + break + stderr.close() + #generate html reports + if options.html_report_from_directory: + for ( html_filename, html_dir ) in options.html_report_from_directory: + html_report_from_directory( open( html_filename, 'wb' ), html_dir ) + + cleanup_before_exit( tmp_dir ) + +if __name__=="__main__": __main__() |
| b |
| diff -r 000000000000 -r 44a18a94d7a9 test-data/gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam |
| b |
| Binary file test-data/gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam has changed |
| b |
| diff -r 000000000000 -r 44a18a94d7a9 test-data/phiX.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/phiX.fasta Mon Aug 26 14:23:36 2013 -0400 |
| b |
| @@ -0,0 +1,79 @@ +>phiX174 +GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT +GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA +ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG +TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA +GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC +TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT +TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT +CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT +TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG +TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC +GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA +CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG +TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT +AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC +CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA +TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC +TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA +CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA +GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT +GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA +ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC +TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT +TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC +ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC +CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT +GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC +CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC +TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG +TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT +TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA +AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT +TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT +ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC +GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC +TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT +TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA +TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG +TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC +CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG +AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC +CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT +TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG +CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA +AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT +GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG +GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA +TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT +CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG +TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA +GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC +CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA +TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA +AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC +TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT +CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA +TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG +TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT +CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT +TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC +ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG +TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA +ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG +GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC +CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT +GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG +GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT +ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG +CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC +CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC +GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT +CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG +CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA +TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT +TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG +TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC +AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC +TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA + |
| b |
| diff -r 000000000000 -r 44a18a94d7a9 test-data/samtools/mpileup/samtools_mpileup_out_1.log --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/samtools/mpileup/samtools_mpileup_out_1.log Mon Aug 26 14:23:36 2013 -0400 |
| [ |
| @@ -0,0 +1,2 @@ +[mpileup] 1 samples in 1 input files +<mpileup> Set max per-file depth to 8000 |
| b |
| diff -r 000000000000 -r 44a18a94d7a9 test-data/samtools/mpileup/samtools_mpileup_out_1.pileup --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/samtools/mpileup/samtools_mpileup_out_1.pileup Mon Aug 26 14:23:36 2013 -0400 |
| b |
| @@ -0,0 +1,43 @@ +phiX174 1411 A 1 ^P. $ +phiX174 1412 G 3 .^D.^F. "$$ +phiX174 1413 C 5 ...^D.^F. """$$ +phiX174 1414 G 6 .....^F. #####$ +phiX174 1415 C 7 ......^F. %%%%%%& +phiX174 1416 C 8 .......^F. $$$$$$$$ +phiX174 1417 G 9 ........^F. "#######$ +phiX174 1418 T 10 .........^F. """""""""$ +phiX174 1419 G 10 .......... """""'&'%$ +phiX174 1420 G 10 .......... """""""""" +phiX174 1421 A 10 .......... """""""""" +phiX174 1422 T 10 .......... """""""""" +phiX174 1423 G 10 .......... """""""""# +phiX174 1424 C 10 ..A.AAAAAA %""""""""" +phiX174 1425 C 10 .......... $$$""""""" +phiX174 1426 T 10 .......... #####""""" +phiX174 1427 G 10 .......... ######"""" +phiX174 1428 A 10 .......... """""""""" +phiX174 1429 C 10 .......... ((((((&("" +phiX174 1430 C 10 .......... $$$$$$$$$" +phiX174 1431 G 10 .......... ########## +phiX174 1432 T 10 .......... """""""""" +phiX174 1433 A 10 .......... ########## +phiX174 1434 C 10 .......... ((((((&(%$ +phiX174 1435 C 10 .......... $$$$$$$$$$ +phiX174 1436 G 10 .......... ########## +phiX174 1437 A 10 .......... """""""""! +phiX174 1438 G 10 .......... """""####! +phiX174 1439 G 10 .......... """""""""! +phiX174 1440 C 10 .......... """""""""! +phiX174 1441 T 10 .......... """"""""#! +phiX174 1442 A 10 .......... $$$%%%&&%! +phiX174 1443 A 10 .-1C.-1C..-1C...... """""""""! +phiX174 1444 C 10 **.*...... &%"!"""""! +phiX174 1445 C 10 .......... &%&!%%%&%! +phiX174 1446 C 10 .......... """!"""""! +phiX174 1447 T 10 .$..$....... #"#!"""""! +phiX174 1448 A 8 .$..$..... #!#%%$$! +phiX174 1449 A 6 .$.$.... !""""! +phiX174 1450 T 4 .$... """! +phiX174 1451 G 3 .$.. #"! +phiX174 1452 A 2 .$. "! +phiX174 1453 G 1 .$ ! |
| b |
| diff -r 000000000000 -r 44a18a94d7a9 test-data/samtools/mpileup/samtools_mpileup_out_2.bcf |
| b |
| Binary file test-data/samtools/mpileup/samtools_mpileup_out_2.bcf has changed |
| b |
| diff -r 000000000000 -r 44a18a94d7a9 tool-data/sam_fa_indices.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/sam_fa_indices.loc.sample Mon Aug 26 14:23:36 2013 -0400 |
| b |
| @@ -0,0 +1,28 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Samtools indexed sequences data files. You will need +#to create these data files and then create a sam_fa_indices.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The sam_fa_indices.loc +#file has this format (white space characters are TAB characters): +# +#index <seq> <location> +# +#So, for example, if you had hg18 indexed stored in +#/depot/data2/galaxy/sam/, +#then the sam_fa_indices.loc entry would look like this: +# +#index hg18 /depot/data2/galaxy/sam/hg18.fa +# +#and your /depot/data2/galaxy/sam/ directory +#would contain hg18.fa and hg18.fa.fai files: +# +#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.fa +#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg18.fa.fai +# +#Your sam_fa_indices.loc file should include an entry per line for +#each index set you have stored. The file in the path does actually +#exist, but it should never be directly used. Instead, the name serves +#as a prefix for the index file. For example: +# +#index hg18 /depot/data2/galaxy/sam/hg18.fa +#index hg19 /depot/data2/galaxy/sam/hg19.fa |
| b |
| diff -r 000000000000 -r 44a18a94d7a9 tool-data/tool_data_table_conf.xml.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/tool_data_table_conf.xml.sample Mon Aug 26 14:23:36 2013 -0400 |
| b |
| @@ -0,0 +1,8 @@ +<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> +<tables> + <!-- Location of SAMTools indexes and other files --> + <table name="sam_fa_indexes" comment_char="#"> + <columns>line_type, value, path</columns> + <file path="tool-data/sam_fa_indices.loc" /> + </table> +</tables> \ No newline at end of file |
| b |
| diff -r 000000000000 -r 44a18a94d7a9 tool_dependencies.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Mon Aug 26 14:23:36 2013 -0400 |
| b |
| @@ -0,0 +1,6 @@ +<?xml version="1.0"?> +<tool_dependency> + <package name="samtools" version="0.1.18"> + <repository changeset_revision="a7936f4ea405" name="package_samtools_0_1_18" owner="devteam" toolshed="http://toolshed.g2.bx.psu.edu" /> + </package> +</tool_dependency> |