| Next changeset 1:3d8eb2c065c7 (2016-04-11) |
|
Commit message:
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit f6fa4bd2f176e3f4ae4b9c887113557d3c4ff209 |
|
added:
Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-1.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-2.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-3.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-4.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_2-1.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_2-2.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-1.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-2.ga Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-3.ga Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_1-1,2,3.ga Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_2-1,2.ga repository_dependencies.xml |
| b |
| diff -r 000000000000 -r 4a47903bb4df Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-1.ga --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-1.ga Tue Apr 05 06:42:47 2016 -0400 |
| [ |
| b'@@ -0,0 +1,786 @@\n+{\n+ "a_galaxy_workflow": "true", \n+ "annotation": "", \n+ "format-version": "0.1", \n+ "name": "Metavisitor: Workflow for Use Case 1-1", \n+ "steps": {\n+ "0": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 0, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "Input Dataset Collection"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset collection", \n+ "outputs": [], \n+ "position": {\n+ "left": 211.9375, \n+ "top": 200\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"collection_type\\": \\"list\\", \\"name\\": \\"Input Dataset Collection\\"}", \n+ "tool_version": null, \n+ "type": "data_collection_input", \n+ "uuid": "e60ca12e-15cc-4a01-a912-945af21a5e8e", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "a0c5d574-7761-452f-b8ac-5e789bfdced8"\n+ }\n+ ]\n+ }, \n+ "1": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 1, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "viral nucleotide BLAST database (NCBI 19-10-2015)"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset", \n+ "outputs": [], \n+ "position": {\n+ "left": 1024.96875, \n+ "top": 963.984375\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"name\\": \\"viral nucleotide BLAST database (NCBI 19-10-2015)\\"}", \n+ "tool_version": null, \n+ "type": "data_input", \n+ "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "6bd2d24e-e12f-41fe-9308-631cc6718143"\n+ }\n+ ]\n+ }, \n+ "2": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", \n+ "id": 2, \n+ "input_connections": {}, \n+ "inputs": [], \n+ "label": null, \n+ "name": "Retrieve FASTA from NCBI", \n+ "outputs": [\n+ {\n+ "name": "outfilename", \n+ "type": "fasta"\n+ }, \n+ {\n+ "name": "logfile", \n+ "type": "txt"\n+ }\n+ ], \n+ "position": {\n+ "left": 1643.5, \n+ "top": 945.484375\n+ }, \n+ "post_job_actions": {\n+ "HideDatasetActionlogfile": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "logfile"\n+ }, \n+ "RenameDatasetActionoutfilename": {\n+ "action_arguments": {\n+ "newname": "${ncbi_guide_ID}"\n+ }, \n+ "action_type": "RenameDatasetAction", \n+ "output_name": "outfilename"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", \n+ "tool_state": "{\\"__page__\\": 0, \\"__rerun_remap_job_id__\\": null, \\"queryString\\": \\"\\\\\\"${ncbi_guide_ID}\\\\\\"\\", \\"dbname\\": \\"\\'..b't_type\\": \\"\\\\\\"blastn\\\\\\"\\", \\"query\\": \\"null\\", \\"chromInfo\\": \\"\\\\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\\\\"\\"}", \n+ "tool_version": "0.1.06", \n+ "type": "tool", \n+ "uuid": "c9f9c58a-f21d-46d2-a952-9e7b7d5bf939", \n+ "workflow_outputs": []\n+ }, \n+ "14": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", \n+ "id": 14, \n+ "input_connections": {\n+ "blast_tab": {\n+ "id": 13, \n+ "output_name": "output1"\n+ }, \n+ "guideSequence": {\n+ "id": 2, \n+ "output_name": "outfilename"\n+ }, \n+ "sequences": {\n+ "id": 12, \n+ "output_name": "contigsandsinglets"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "blast_to_scaffold", \n+ "outputs": [\n+ {\n+ "name": "output", \n+ "type": "fasta"\n+ }\n+ ], \n+ "position": {\n+ "left": 2547, \n+ "top": 838.5\n+ }, \n+ "post_job_actions": {\n+ "HideDatasetActionoutput": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "output"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", \n+ "tool_state": "{\\"__page__\\": 0, \\"guideSequence\\": \\"null\\", \\"blast_tab\\": \\"null\\", \\"__rerun_remap_job_id__\\": null, \\"sequences\\": \\"null\\"}", \n+ "tool_version": "0.9.0", \n+ "type": "tool", \n+ "uuid": "4e68c3e8-b825-40bd-ae22-a74ca7048737", \n+ "workflow_outputs": []\n+ }, \n+ "15": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", \n+ "id": 15, \n+ "input_connections": {\n+ "input": {\n+ "id": 14, \n+ "output_name": "output"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "Regex Find And Replace", \n+ "outputs": [\n+ {\n+ "name": "out_file1", \n+ "type": "input"\n+ }\n+ ], \n+ "position": {\n+ "left": 2726.984375, \n+ "top": 1140\n+ }, \n+ "post_job_actions": {\n+ "RenameDatasetActionout_file1": {\n+ "action_arguments": {\n+ "newname": "Nora_MV_${ncbi_guide_ID}_guided"\n+ }, \n+ "action_type": "RenameDatasetAction", \n+ "output_name": "out_file1"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", \n+ "tool_state": "{\\"input\\": \\"null\\", \\"__rerun_remap_job_id__\\": null, \\"checks\\": \\"[{\\\\\\"__index__\\\\\\": 0, \\\\\\"replacement\\\\\\": \\\\\\">Nora_MV\\\\\\", \\\\\\"pattern\\\\\\": \\\\\\">.+\\\\\\"}]\\", \\"__page__\\": 0}", \n+ "tool_version": "0.1.0", \n+ "type": "tool", \n+ "uuid": "d804abd4-ad4e-4382-a81d-b592bec797cf", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "out_file1", \n+ "uuid": "d180a0a7-c5ff-4ab4-99ef-9bd8589dd378"\n+ }\n+ ]\n+ }\n+ }, \n+ "uuid": "6d905af0-243a-42b9-8951-a5477cfa6d88"\n+}\n\\ No newline at end of file\n' |
| b |
| diff -r 000000000000 -r 4a47903bb4df Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-2.ga --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-2.ga Tue Apr 05 06:42:47 2016 -0400 |
| [ |
| b'@@ -0,0 +1,709 @@\n+{\n+ "a_galaxy_workflow": "true", \n+ "annotation": "", \n+ "format-version": "0.1", \n+ "name": "Metavisitor: Workflow for Use Case 1-2", \n+ "steps": {\n+ "0": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 0, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "Input Dataset Collection"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset collection", \n+ "outputs": [], \n+ "position": {\n+ "left": 211.9375, \n+ "top": 200\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"collection_type\\": \\"list\\", \\"name\\": \\"Input Dataset Collection\\"}", \n+ "tool_version": null, \n+ "type": "data_collection_input", \n+ "uuid": "e60ca12e-15cc-4a01-a912-945af21a5e8e", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "940fadea-7557-4c56-a6df-c58db232b6f0"\n+ }\n+ ]\n+ }, \n+ "1": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 1, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "viral nucleotide BLAST database (NCBI 19-10-2015)"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset", \n+ "outputs": [], \n+ "position": {\n+ "left": 1024.9375, \n+ "top": 963.984375\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"name\\": \\"viral nucleotide BLAST database (NCBI 19-10-2015)\\"}", \n+ "tool_version": null, \n+ "type": "data_input", \n+ "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "9a03415f-fd4b-43ea-ae2d-c9004b97d703"\n+ }\n+ ]\n+ }, \n+ "2": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", \n+ "id": 2, \n+ "input_connections": {}, \n+ "inputs": [], \n+ "label": null, \n+ "name": "Retrieve FASTA from NCBI", \n+ "outputs": [\n+ {\n+ "name": "outfilename", \n+ "type": "fasta"\n+ }, \n+ {\n+ "name": "logfile", \n+ "type": "txt"\n+ }\n+ ], \n+ "position": {\n+ "left": 1587.5, \n+ "top": 994.484375\n+ }, \n+ "post_job_actions": {\n+ "HideDatasetActionlogfile": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "logfile"\n+ }, \n+ "RenameDatasetActionoutfilename": {\n+ "action_arguments": {\n+ "newname": "${ncbi_guide_ID}"\n+ }, \n+ "action_type": "RenameDatasetAction", \n+ "output_name": "outfilename"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", \n+ "tool_state": "{\\"__page__\\": 0, \\"__rerun_remap_job_id__\\": null, \\"queryString\\": \\"\\\\\\"${ncbi_guide_ID}\\\\\\"\\", \\"dbname\\": \\"\\\\'..b'\n+ }, \n+ "12": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", \n+ "id": 12, \n+ "input_connections": {\n+ "blast_tab": {\n+ "id": 11, \n+ "output_name": "output1"\n+ }, \n+ "guideSequence": {\n+ "id": 2, \n+ "output_name": "outfilename"\n+ }, \n+ "sequences": {\n+ "id": 10, \n+ "output_name": "contigsandsinglets"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "blast_to_scaffold", \n+ "outputs": [\n+ {\n+ "name": "output", \n+ "type": "fasta"\n+ }\n+ ], \n+ "position": {\n+ "left": 2535, \n+ "top": 774.5\n+ }, \n+ "post_job_actions": {\n+ "HideDatasetActionoutput": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "output"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", \n+ "tool_state": "{\\"__page__\\": 0, \\"guideSequence\\": \\"null\\", \\"blast_tab\\": \\"null\\", \\"__rerun_remap_job_id__\\": null, \\"sequences\\": \\"null\\"}", \n+ "tool_version": "0.9.0", \n+ "type": "tool", \n+ "uuid": "ca2b5401-fc07-4d46-8d5e-3a77a3e3b174", \n+ "workflow_outputs": []\n+ }, \n+ "13": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", \n+ "id": 13, \n+ "input_connections": {\n+ "input": {\n+ "id": 12, \n+ "output_name": "output"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "Regex Find And Replace", \n+ "outputs": [\n+ {\n+ "name": "out_file1", \n+ "type": "input"\n+ }\n+ ], \n+ "position": {\n+ "left": 2726.984375, \n+ "top": 1140\n+ }, \n+ "post_job_actions": {\n+ "ChangeDatatypeActionout_file1": {\n+ "action_arguments": {\n+ "newtype": "fasta"\n+ }, \n+ "action_type": "ChangeDatatypeAction", \n+ "output_name": "out_file1"\n+ }, \n+ "RenameDatasetActionout_file1": {\n+ "action_arguments": {\n+ "newname": "Nora_raw_reads_${ncbi_guide_ID}_guided"\n+ }, \n+ "action_type": "RenameDatasetAction", \n+ "output_name": "out_file1"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", \n+ "tool_state": "{\\"input\\": \\"null\\", \\"__rerun_remap_job_id__\\": null, \\"checks\\": \\"[{\\\\\\"__index__\\\\\\": 0, \\\\\\"replacement\\\\\\": \\\\\\">Nora_raw_reads\\\\\\", \\\\\\"pattern\\\\\\": \\\\\\">.+\\\\\\"}]\\", \\"__page__\\": 0}", \n+ "tool_version": "0.1.0", \n+ "type": "tool", \n+ "uuid": "d804abd4-ad4e-4382-a81d-b592bec797cf", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "out_file1", \n+ "uuid": "b5cf0dd9-bfe3-4021-99fe-12faf47d29e0"\n+ }\n+ ]\n+ }\n+ }, \n+ "uuid": "52976d74-fcd5-4e3c-a474-cd7aaf6e1047"\n+}\n\\ No newline at end of file\n' |
| b |
| diff -r 000000000000 -r 4a47903bb4df Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-3.ga --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-3.ga Tue Apr 05 06:42:47 2016 -0400 |
| [ |
| b'@@ -0,0 +1,819 @@\n+{\n+ "a_galaxy_workflow": "true", \n+ "annotation": "", \n+ "format-version": "0.1", \n+ "name": "Metavisitor: Workflow for Use Case 1-3", \n+ "steps": {\n+ "0": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 0, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "Input Dataset Collection"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset collection", \n+ "outputs": [], \n+ "position": {\n+ "left": 211.9271240234375, \n+ "top": 200\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"collection_type\\": \\"list\\", \\"name\\": \\"Input Dataset Collection\\"}", \n+ "tool_version": null, \n+ "type": "data_collection_input", \n+ "uuid": "e60ca12e-15cc-4a01-a912-945af21a5e8e", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "af22e150-8299-44ee-be79-a749377663ce"\n+ }\n+ ]\n+ }, \n+ "1": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 1, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "viral nucleotide BLAST database (NCBI 19-10-2015)"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset", \n+ "outputs": [], \n+ "position": {\n+ "left": 1024.9827423095703, \n+ "top": 963.9930725097656\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"name\\": \\"viral nucleotide BLAST database (NCBI 19-10-2015)\\"}", \n+ "tool_version": null, \n+ "type": "data_input", \n+ "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "71520953-6fe2-410d-a217-556ea72142e7"\n+ }\n+ ]\n+ }, \n+ "2": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", \n+ "id": 2, \n+ "input_connections": {}, \n+ "inputs": [], \n+ "label": null, \n+ "name": "Retrieve FASTA from NCBI", \n+ "outputs": [\n+ {\n+ "name": "outfilename", \n+ "type": "fasta"\n+ }, \n+ {\n+ "name": "logfile", \n+ "type": "txt"\n+ }\n+ ], \n+ "position": {\n+ "left": 1587.5001220703125, \n+ "top": 994.4965515136719\n+ }, \n+ "post_job_actions": {\n+ "HideDatasetActionlogfile": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "logfile"\n+ }, \n+ "RenameDatasetActionoutfilename": {\n+ "action_arguments": {\n+ "newname": "${ncbi_guide_ID}"\n+ }, \n+ "action_type": "RenameDatasetAction", \n+ "output_name": "outfilename"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", \n+ "tool_state": "{\\"__page__\\": 0, \\"__rerun_remap_job_id__\\": null, \\"queryString\\": \\"'..b'+ "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", \n+ "id": 14, \n+ "input_connections": {\n+ "blast_tab": {\n+ "id": 13, \n+ "output_name": "output1"\n+ }, \n+ "guideSequence": {\n+ "id": 2, \n+ "output_name": "outfilename"\n+ }, \n+ "sequences": {\n+ "id": 12, \n+ "output_name": "contigsandsinglets"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "blast_to_scaffold", \n+ "outputs": [\n+ {\n+ "name": "output", \n+ "type": "fasta"\n+ }\n+ ], \n+ "position": {\n+ "left": 2553.0731201171875, \n+ "top": 876.5625305175781\n+ }, \n+ "post_job_actions": {\n+ "HideDatasetActionoutput": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "output"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", \n+ "tool_state": "{\\"__page__\\": 0, \\"guideSequence\\": \\"null\\", \\"blast_tab\\": \\"null\\", \\"__rerun_remap_job_id__\\": null, \\"sequences\\": \\"null\\"}", \n+ "tool_version": "0.9.0", \n+ "type": "tool", \n+ "uuid": "031fbacb-303d-421d-84ee-24c9474c26d2", \n+ "workflow_outputs": []\n+ }, \n+ "15": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", \n+ "id": 15, \n+ "input_connections": {\n+ "input": {\n+ "id": 14, \n+ "output_name": "output"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "Regex Find And Replace", \n+ "outputs": [\n+ {\n+ "name": "out_file1", \n+ "type": "input"\n+ }\n+ ], \n+ "position": {\n+ "left": 2726.9967041015625, \n+ "top": 1140.0000305175781\n+ }, \n+ "post_job_actions": {\n+ "ChangeDatatypeActionout_file1": {\n+ "action_arguments": {\n+ "newtype": "fasta"\n+ }, \n+ "action_type": "ChangeDatatypeAction", \n+ "output_name": "out_file1"\n+ }, \n+ "RenameDatasetActionout_file1": {\n+ "action_arguments": {\n+ "newname": "Nora_Median-Norm-reads_${ncbi_guide_ID}_guided"\n+ }, \n+ "action_type": "RenameDatasetAction", \n+ "output_name": "out_file1"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", \n+ "tool_state": "{\\"input\\": \\"null\\", \\"__rerun_remap_job_id__\\": null, \\"checks\\": \\"[{\\\\\\"__index__\\\\\\": 0, \\\\\\"replacement\\\\\\": \\\\\\">Nora_Median-Norm-reads\\\\\\", \\\\\\"pattern\\\\\\": \\\\\\">.+\\\\\\"}]\\", \\"__page__\\": 0}", \n+ "tool_version": "0.1.0", \n+ "type": "tool", \n+ "uuid": "d804abd4-ad4e-4382-a81d-b592bec797cf", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "out_file1", \n+ "uuid": "dc8227de-395d-4410-98ec-b176432b5ee8"\n+ }\n+ ]\n+ }\n+ }, \n+ "uuid": "dab2601e-a95f-4f94-accc-28d265c7001e"\n+}\n\\ No newline at end of file\n' |
| b |
| diff -r 000000000000 -r 4a47903bb4df Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-4.ga --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-4.ga Tue Apr 05 06:42:47 2016 -0400 |
| [ |
| b'@@ -0,0 +1,462 @@\n+{\n+ "a_galaxy_workflow": "true", \n+ "annotation": "", \n+ "format-version": "0.1", \n+ "name": "Metavisitor: Workflow for Use Case 1-4", \n+ "steps": {\n+ "0": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 0, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "Input Dataset Collection"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset collection", \n+ "outputs": [], \n+ "position": {\n+ "left": 211.94445514678955, \n+ "top": 200.00001525878906\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"collection_type\\": \\"list\\", \\"name\\": \\"Input Dataset Collection\\"}", \n+ "tool_version": null, \n+ "type": "data_collection_input", \n+ "uuid": "e60ca12e-15cc-4a01-a912-945af21a5e8e", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "f9af6731-280d-4606-b7c3-ff6e5bc0870e"\n+ }\n+ ]\n+ }, \n+ "1": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 1, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "viral nucleotide BLAST database (NCBI 19-10-2015)"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset", \n+ "outputs": [], \n+ "position": {\n+ "left": 1024.9826965332031, \n+ "top": 963.9931259155273\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"name\\": \\"viral nucleotide BLAST database (NCBI 19-10-2015)\\"}", \n+ "tool_version": null, \n+ "type": "data_input", \n+ "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "89f3e51c-db84-4ff4-85f3-d3030a160685"\n+ }\n+ ]\n+ }, \n+ "2": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", \n+ "id": 2, \n+ "input_connections": {\n+ "input": {\n+ "id": 0, \n+ "output_name": "output"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "Clip adapter", \n+ "outputs": [\n+ {\n+ "name": "output", \n+ "type": "fasta"\n+ }\n+ ], \n+ "position": {\n+ "left": 420.4861297607422, \n+ "top": 292.5000228881836\n+ }, \n+ "post_job_actions": {}, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", \n+ "tool_state": "{\\"out_format\\": \\"\\\\\\"fasta\\\\\\"\\", \\"__page__\\": 0, \\"min\\": \\"\\\\\\"18\\\\\\"\\", \\"max\\": \\"\\\\\\"30\\\\\\"\\", \\"__rerun_remap_job_id__\\": null, \\"__workflow_invocation_uuid__\\": \\"\\\\\\"459d9188801e11e5ae6af01fafdfc061\\\\\\"\\", \\"clip_source\\": \\"{\\\\\\"clip_source_list\\\\\\": \\\\\\"prebuilt\\\\\\", \\\\\\"clip_sequence\\\\\\": \\\\\\"CTGTAGGCACCATCAATCGT\\\\\\", \\\\\\"__current_case__\\\\\\": 0}\\", \\"input\\": \\"null\\", \\"chromInfo\\": \\"\\\\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\\\\"\\", \\"Nmode\\": \\"\\\\\\"reject\\\\\\"\\"}", \n+ "tool_version": "1.3.6", \n+ "type": "tool", \n+ "uuid": "69611c78-3f25-4471-abf7-426ec35fd2db", \n+ '..b'filter_query\\\\\\": \\\\\\"True\\\\\\", \\\\\\"word_size\\\\\\": \\\\\\"0\\\\\\", \\\\\\"__current_case__\\\\\\": 1, \\\\\\"parse_deflines\\\\\\": \\\\\\"False\\\\\\", \\\\\\"qcov_hsp_perc\\\\\\": \\\\\\"0.0\\\\\\", \\\\\\"strand\\\\\\": \\\\\\"-strand both\\\\\\", \\\\\\"max_hits\\\\\\": \\\\\\"5\\\\\\"}\\", \\"__page__\\": 0, \\"__rerun_remap_job_id__\\": null, \\"__workflow_invocation_uuid__\\": \\"\\\\\\"4dd2fde8802311e5bcddf01fafdfc061\\\\\\"\\", \\"db_opts\\": \\"{\\\\\\"db_opts_selector\\\\\\": \\\\\\"histdb\\\\\\", \\\\\\"subject\\\\\\": \\\\\\"\\\\\\", \\\\\\"histdb\\\\\\": null, \\\\\\"__current_case__\\\\\\": 1, \\\\\\"database\\\\\\": \\\\\\"\\\\\\"}\\", \\"blast_type\\": \\"\\\\\\"blastn\\\\\\"\\", \\"query\\": \\"null\\", \\"chromInfo\\": \\"\\\\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\\\\"\\"}", \n+ "tool_version": "0.1.06", \n+ "type": "tool", \n+ "uuid": "bf30a0ad-4ef9-49f0-b4c7-4aae52017748", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output1", \n+ "uuid": "c53ba510-461f-4f0d-a075-d8c97924beab"\n+ }\n+ ]\n+ }, \n+ "9": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", \n+ "id": 9, \n+ "input_connections": {\n+ "blast": {\n+ "id": 8, \n+ "output_name": "output1"\n+ }, \n+ "sequences": {\n+ "id": 7, \n+ "output_name": "transcripts"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "Parse blast output and compile hits", \n+ "outputs": [\n+ {\n+ "name": "tabularOutput", \n+ "type": "tabular"\n+ }, \n+ {\n+ "name": "fastaOutput", \n+ "type": "fasta"\n+ }, \n+ {\n+ "name": "al_sequences", \n+ "type": "fasta"\n+ }, \n+ {\n+ "name": "un_sequences", \n+ "type": "fasta"\n+ }\n+ ], \n+ "position": {\n+ "left": 1564.9827575683594, \n+ "top": 513.489616394043\n+ }, \n+ "post_job_actions": {\n+ "HideDatasetActional_sequences": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "al_sequences"\n+ }, \n+ "HideDatasetActionfastaOutput": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "fastaOutput"\n+ }, \n+ "HideDatasetActionun_sequences": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "un_sequences"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", \n+ "tool_state": "{\\"__page__\\": 0, \\"flanking\\": \\"\\\\\\"5\\\\\\"\\", \\"additional_filters\\": \\"{\\\\\\"use_filters\\\\\\": \\\\\\"no\\\\\\", \\\\\\"__current_case__\\\\\\": 0}\\", \\"__rerun_remap_job_id__\\": null, \\"mode\\": \\"\\\\\\"short\\\\\\"\\", \\"sequences\\": \\"null\\", \\"blast\\": \\"null\\"}", \n+ "tool_version": "2.4.3", \n+ "type": "tool", \n+ "uuid": "84989771-81db-4d86-bff6-cfda892b1959", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "tabularOutput", \n+ "uuid": "8b327d4e-27c9-4ec3-a4f7-be8f8ea27452"\n+ }\n+ ]\n+ }\n+ }, \n+ "uuid": "50e69b15-e7a2-4e1d-8fc4-47f35223efd4"\n+}\n\\ No newline at end of file\n' |
| b |
| diff -r 000000000000 -r 4a47903bb4df Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_2-1.ga --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_2-1.ga Tue Apr 05 06:42:47 2016 -0400 |
| [ |
| b'@@ -0,0 +1,1006 @@\n+{\n+ "a_galaxy_workflow": "true", \n+ "annotation": "", \n+ "format-version": "0.1", \n+ "name": "Metavisitor: Workflow for Use Case 2-1", \n+ "steps": {\n+ "0": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 0, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "Input Dataset Collection"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset collection", \n+ "outputs": [], \n+ "position": {\n+ "left": 110.9375, \n+ "top": 269.37501525878906\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"collection_type\\": \\"list\\", \\"name\\": \\"Input Dataset Collection\\"}", \n+ "tool_version": null, \n+ "type": "data_collection_input", \n+ "uuid": "None", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "4e1d736b-a314-441c-95ef-c4e7fbde52e6"\n+ }\n+ ]\n+ }, \n+ "1": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 1, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "Blast Protein database"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset", \n+ "outputs": [], \n+ "position": {\n+ "left": 1088.5938110351562, \n+ "top": 839.96533203125\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"name\\": \\"Blast Protein database\\"}", \n+ "tool_version": null, \n+ "type": "data_input", \n+ "uuid": "ee9f8f76-6682-4688-88ad-8263109cf051", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "18d27e4d-ada8-48e3-b69a-ce878a19d260"\n+ }\n+ ]\n+ }, \n+ "2": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.3", \n+ "id": 2, \n+ "input_connections": {}, \n+ "inputs": [], \n+ "label": null, \n+ "name": "Retrieve FASTA from NCBI", \n+ "outputs": [\n+ {\n+ "name": "outfilename", \n+ "type": "fasta"\n+ }, \n+ {\n+ "name": "logfile", \n+ "type": "txt"\n+ }\n+ ], \n+ "position": {\n+ "left": 1736.5973052978516, \n+ "top": 1034.4966125488281\n+ }, \n+ "post_job_actions": {\n+ "HideDatasetActionlogfile": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "logfile"\n+ }, \n+ "HideDatasetActionoutfilename": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "outfilename"\n+ }, \n+ "RenameDatasetActionoutfilename": {\n+ "action_arguments": {\n+ "newname": "DCV NC_001834.1 Guide"\n+ }, \n+ "action_type": "RenameDatasetAction", \n+ "output_name": "outfilename"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetc'..b'": "contigsandsinglets"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "NCBI BLAST+ tblastx", \n+ "outputs": [\n+ {\n+ "name": "output1", \n+ "type": "tabular"\n+ }\n+ ], \n+ "position": {\n+ "left": 2424.0973510742188, \n+ "top": 837.5000305175781\n+ }, \n+ "post_job_actions": {}, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_tblastx_wrapper/0.1.06", \n+ "tool_state": "{\\"evalue_cutoff\\": \\"\\\\\\"0.001\\\\\\"\\", \\"__page__\\": 0, \\"adv_opts\\": \\"{\\\\\\"adv_opts_selector\\\\\\": \\\\\\"basic\\\\\\", \\\\\\"__current_case__\\\\\\": 0}\\", \\"__rerun_remap_job_id__\\": null, \\"db_opts\\": \\"{\\\\\\"db_opts_selector\\\\\\": \\\\\\"histdb\\\\\\", \\\\\\"subject\\\\\\": \\\\\\"\\\\\\", \\\\\\"histdb\\\\\\": null, \\\\\\"__current_case__\\\\\\": 1, \\\\\\"database\\\\\\": \\\\\\"\\\\\\"}\\", \\"query_gencode\\": \\"\\\\\\"1\\\\\\"\\", \\"output\\": \\"{\\\\\\"out_format\\\\\\": \\\\\\"cols\\\\\\", \\\\\\"std_cols\\\\\\": [\\\\\\"qseqid\\\\\\", \\\\\\"sseqid\\\\\\", \\\\\\"pident\\\\\\", \\\\\\"length\\\\\\", \\\\\\"mismatch\\\\\\", \\\\\\"gapopen\\\\\\", \\\\\\"qstart\\\\\\", \\\\\\"qend\\\\\\", \\\\\\"sstart\\\\\\", \\\\\\"send\\\\\\", \\\\\\"evalue\\\\\\", \\\\\\"bitscore\\\\\\"], \\\\\\"ids_cols\\\\\\": null, \\\\\\"tax_cols\\\\\\": null, \\\\\\"__current_case__\\\\\\": 2, \\\\\\"misc_cols\\\\\\": null, \\\\\\"ext_cols\\\\\\": [\\\\\\"slen\\\\\\"]}\\", \\"query\\": \\"null\\"}", \n+ "tool_version": "0.1.06", \n+ "type": "tool", \n+ "uuid": "None", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output1", \n+ "uuid": "7ad377ba-ad8f-421f-af4c-6835a1994f46"\n+ }\n+ ]\n+ }, \n+ "19": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", \n+ "id": 19, \n+ "input_connections": {\n+ "blast_tab": {\n+ "id": 18, \n+ "output_name": "output1"\n+ }, \n+ "guideSequence": {\n+ "id": 2, \n+ "output_name": "outfilename"\n+ }, \n+ "sequences": {\n+ "id": 17, \n+ "output_name": "contigsandsinglets"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "blast_to_scaffold", \n+ "outputs": [\n+ {\n+ "name": "output", \n+ "type": "fasta"\n+ }\n+ ], \n+ "position": {\n+ "left": 2718.003662109375, \n+ "top": 597.9167022705078\n+ }, \n+ "post_job_actions": {\n+ "RenameDatasetActionoutput": {\n+ "action_arguments": {\n+ "newname": "New AnCV sequences in DCV scaffold"\n+ }, \n+ "action_type": "RenameDatasetAction", \n+ "output_name": "output"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", \n+ "tool_state": "{\\"__page__\\": 0, \\"guideSequence\\": \\"null\\", \\"blast_tab\\": \\"null\\", \\"__rerun_remap_job_id__\\": null, \\"sequences\\": \\"null\\"}", \n+ "tool_version": "0.9.0", \n+ "type": "tool", \n+ "uuid": "d6fcfcf9-1b9b-4ac3-8217-f7ddbc84be91", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "c052be17-d78e-4a17-891c-7154936c7935"\n+ }\n+ ]\n+ }\n+ }, \n+ "uuid": "ac35209c-d243-403c-95c7-5500b022ae10"\n+}\n\\ No newline at end of file\n' |
| b |
| diff -r 000000000000 -r 4a47903bb4df Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_2-2.ga --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_2-2.ga Tue Apr 05 06:42:47 2016 -0400 |
| [ |
| b'@@ -0,0 +1,517 @@\n+{\n+ "a_galaxy_workflow": "true", \n+ "annotation": "", \n+ "format-version": "0.1", \n+ "name": "Metavisitor: Workflow for Use Case 2-2", \n+ "steps": {\n+ "0": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 0, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "Input Dataset Collection"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset collection", \n+ "outputs": [], \n+ "position": {\n+ "left": 199.91314697265625, \n+ "top": 183.5937557220459\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"collection_type\\": \\"list\\", \\"name\\": \\"Input Dataset Collection\\"}", \n+ "tool_version": null, \n+ "type": "data_collection_input", \n+ "uuid": "3b7db228-7d72-4b8a-9296-5e51ceda8cdd", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "dd803215-4fa9-4444-83df-06e42912b545"\n+ }\n+ ]\n+ }, \n+ "1": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 1, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "Protein Blast database"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset", \n+ "outputs": [], \n+ "position": {\n+ "left": 1887.9861450195312, \n+ "top": 619.5659847259521\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"name\\": \\"Protein Blast database\\"}", \n+ "tool_version": null, \n+ "type": "data_input", \n+ "uuid": "9f28fc2b-f552-4021-b6fc-ba95f6f3e8dd", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "8d19a7b0-6b52-46ee-be47-cce18eca9453"\n+ }\n+ ]\n+ }, \n+ "2": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.2.6.2", \n+ "id": 2, \n+ "input_connections": {\n+ "library|input_1": {\n+ "id": 0, \n+ "output_name": "output"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "Bowtie2", \n+ "outputs": [\n+ {\n+ "name": "output_unaligned_reads_l", \n+ "type": "fastqsanger"\n+ }, \n+ {\n+ "name": "output_aligned_reads_l", \n+ "type": "fastqsanger"\n+ }, \n+ {\n+ "name": "output_aligned_reads_r", \n+ "type": "fastqsanger"\n+ }, \n+ {\n+ "name": "output_unaligned_reads_r", \n+ "type": "fastqsanger"\n+ }, \n+ {\n+ "name": "output", \n+ "type": "bam"\n+ }, \n+ {\n+ "name": "output_sam", \n+ "type": "sam"\n+ }, \n+ {\n+ "name": "mapping_stats", \n+ "type": "txt"\n+ }\n+ ], \n+ "position": {\n+ "left": 433.48956298828125, \n+ "top": 367.6389217376709\n+ }, \n+ "post_job_actions": {\n+ "DeleteIntermediatesActionoutput_unal'..b'\\", \\\\\\"qend\\\\\\", \\\\\\"sstart\\\\\\", \\\\\\"send\\\\\\", \\\\\\"evalue\\\\\\", \\\\\\"bitscore\\\\\\"], \\\\\\"ids_cols\\\\\\": null, \\\\\\"tax_cols\\\\\\": null, \\\\\\"__current_case__\\\\\\": 2, \\\\\\"misc_cols\\\\\\": null, \\\\\\"ext_cols\\\\\\": [\\\\\\"slen\\\\\\"]}\\", \\"adv_opts\\": \\"{\\\\\\"adv_opts_selector\\\\\\": \\\\\\"basic\\\\\\", \\\\\\"__current_case__\\\\\\": 0}\\", \\"__page__\\": 0, \\"__rerun_remap_job_id__\\": null, \\"db_opts\\": \\"{\\\\\\"db_opts_selector\\\\\\": \\\\\\"histdb\\\\\\", \\\\\\"subject\\\\\\": \\\\\\"\\\\\\", \\\\\\"histdb\\\\\\": null, \\\\\\"__current_case__\\\\\\": 1, \\\\\\"database\\\\\\": \\\\\\"\\\\\\"}\\", \\"query_gencode\\": \\"\\\\\\"1\\\\\\"\\", \\"blast_type\\": \\"\\\\\\"blastx\\\\\\"\\", \\"query\\": \\"null\\", \\"chromInfo\\": \\"\\\\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\\\\"\\"}", \n+ "tool_version": "0.1.06", \n+ "type": "tool", \n+ "uuid": "None", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output1", \n+ "uuid": "65223b13-b6fa-45ae-a927-bb96b184bb75"\n+ }\n+ ]\n+ }, \n+ "10": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", \n+ "id": 10, \n+ "input_connections": {\n+ "blast": {\n+ "id": 9, \n+ "output_name": "output1"\n+ }, \n+ "sequences": {\n+ "id": 8, \n+ "output_name": "output"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "Parse blast output and compile hits", \n+ "outputs": [\n+ {\n+ "name": "tabularOutput", \n+ "type": "tabular"\n+ }, \n+ {\n+ "name": "fastaOutput", \n+ "type": "fasta"\n+ }, \n+ {\n+ "name": "al_sequences", \n+ "type": "fasta"\n+ }, \n+ {\n+ "name": "un_sequences", \n+ "type": "fasta"\n+ }\n+ ], \n+ "position": {\n+ "left": 2559.5313720703125, \n+ "top": 128.57639122009277\n+ }, \n+ "post_job_actions": {\n+ "HideDatasetActional_sequences": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "al_sequences"\n+ }, \n+ "HideDatasetActionfastaOutput": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "fastaOutput"\n+ }, \n+ "HideDatasetActionun_sequences": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "un_sequences"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", \n+ "tool_state": "{\\"__page__\\": 0, \\"flanking\\": \\"\\\\\\"5\\\\\\"\\", \\"additional_filters\\": \\"{\\\\\\"use_filters\\\\\\": \\\\\\"no\\\\\\", \\\\\\"__current_case__\\\\\\": 0}\\", \\"__rerun_remap_job_id__\\": null, \\"mode\\": \\"\\\\\\"verbose\\\\\\"\\", \\"sequences\\": \\"null\\", \\"blast\\": \\"null\\"}", \n+ "tool_version": "2.4.3", \n+ "type": "tool", \n+ "uuid": "30288e33-ff64-4089-9b45-428027744176", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "tabularOutput", \n+ "uuid": "6b25acfc-474c-4852-b196-a14a4cf619e3"\n+ }\n+ ]\n+ }\n+ }, \n+ "uuid": "ea5b1974-4efa-4a30-a29c-4cfa9fd7da83"\n+}\n\\ No newline at end of file\n' |
| b |
| diff -r 000000000000 -r 4a47903bb4df Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-1.ga --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-1.ga Tue Apr 05 06:42:47 2016 -0400 |
| [ |
| b'@@ -0,0 +1,579 @@\n+{\n+ "a_galaxy_workflow": "true", \n+ "annotation": "", \n+ "format-version": "0.1", \n+ "name": "Metavisitor: Workflow for Use Case 3-1", \n+ "steps": {\n+ "0": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 0, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "Fever Patient Sequences collection"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset collection", \n+ "outputs": [], \n+ "position": {\n+ "left": 207.96875, \n+ "top": 199.90625\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"collection_type\\": \\"list\\", \\"name\\": \\"Fever Patient Sequences collection\\"}", \n+ "tool_version": null, \n+ "type": "data_collection_input", \n+ "uuid": "21bdc466-e175-4b9c-aacc-9ba72a877535", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "0abd6e13-fa30-4dd4-ad60-90b7fef1a8bf"\n+ }\n+ ]\n+ }, \n+ "1": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 1, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "Nucleotide Viral Blast Database"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset", \n+ "outputs": [], \n+ "position": {\n+ "left": 876.109375, \n+ "top": 1158.046875\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"name\\": \\"Nucleotide Viral Blast Database\\"}", \n+ "tool_version": null, \n+ "type": "data_input", \n+ "uuid": "8a789998-8ad6-495f-b923-d7bfd02896f4", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "05aef397-b0f5-4556-adb5-be963df7d67f"\n+ }\n+ ]\n+ }, \n+ "2": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastq_to_fasta/cshl_fastq_to_fasta/1.0.0", \n+ "id": 2, \n+ "input_connections": {\n+ "input": {\n+ "id": 0, \n+ "output_name": "output"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "FASTQ to FASTA", \n+ "outputs": [\n+ {\n+ "name": "output", \n+ "type": "fasta"\n+ }\n+ ], \n+ "position": {\n+ "left": 256.5625, \n+ "top": 327.625\n+ }, \n+ "post_job_actions": {\n+ "HideDatasetActionoutput": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "output"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastq_to_fasta/cshl_fastq_to_fasta/1.0.0", \n+ "tool_state": "{\\"input\\": \\"null\\", \\"RENAMESEQ\\": \\"\\\\\\"-r\\\\\\"\\", \\"SKIPN\\": \\"\\\\\\"-n\\\\\\"\\", \\"__rerun_remap_job_id__\\": null, \\"__page__\\": 0}", \n+ "tool_version": "1.0.0", \n+ "type": "tool", \n+ "uuid": "c7160a54-8152-41b9-870e-89ecbcbcb7dc", \n+ "workflow_outputs": []\n+ }, \n+ "3": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastx_trimmer/cshl_fastx_'..b'fasta"\n+ }\n+ ], \n+ "position": {\n+ "left": 1837.1875, \n+ "top": 854.625\n+ }, \n+ "post_job_actions": {\n+ "DeleteIntermediatesActiontabularOutput": {\n+ "action_arguments": {}, \n+ "action_type": "DeleteIntermediatesAction", \n+ "output_name": "tabularOutput"\n+ }, \n+ "HideDatasetActional_sequences": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "al_sequences"\n+ }, \n+ "HideDatasetActionfastaOutput": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "fastaOutput"\n+ }, \n+ "HideDatasetActionun_sequences": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "un_sequences"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", \n+ "tool_state": "{\\"__page__\\": 0, \\"flanking\\": \\"\\\\\\"5\\\\\\"\\", \\"additional_filters\\": \\"{\\\\\\"filter_term_out\\\\\\": \\\\\\"Patent\\\\\\", \\\\\\"filter_relativeCov\\\\\\": \\\\\\"0.0\\\\\\", \\\\\\"filter_meanScore\\\\\\": \\\\\\"0.0\\\\\\", \\\\\\"use_filters\\\\\\": \\\\\\"yes\\\\\\", \\\\\\"__current_case__\\\\\\": 1, \\\\\\"filter_term_in\\\\\\": \\\\\\"\\\\\\", \\\\\\"filter_maxScore\\\\\\": \\\\\\"0.0\\\\\\"}\\", \\"__rerun_remap_job_id__\\": null, \\"mode\\": \\"\\\\\\"short\\\\\\"\\", \\"sequences\\": \\"null\\", \\"blast\\": \\"null\\"}", \n+ "tool_version": "2.4.3", \n+ "type": "tool", \n+ "uuid": "4acd0e30-b867-43e3-99e9-88d0c602c8f3", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "tabularOutput", \n+ "uuid": "2ee6f85d-cc71-4ed1-8a40-16e98ff3d27a"\n+ }\n+ ]\n+ }, \n+ "11": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", \n+ "id": 11, \n+ "input_connections": {\n+ "input": {\n+ "id": 10, \n+ "output_name": "tabularOutput"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "Concatenate multiple datasets", \n+ "outputs": [\n+ {\n+ "name": "out_file1", \n+ "type": "input"\n+ }\n+ ], \n+ "position": {\n+ "left": 2180.5, \n+ "top": 1016.5\n+ }, \n+ "post_job_actions": {\n+ "RenameDatasetActionout_file1": {\n+ "action_arguments": {\n+ "newname": "Virus identification by patient"\n+ }, \n+ "action_type": "RenameDatasetAction", \n+ "output_name": "out_file1"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", \n+ "tool_state": "{\\"input\\": \\"null\\", \\"__rerun_remap_job_id__\\": null, \\"__page__\\": 0}", \n+ "tool_version": "0.2", \n+ "type": "tool", \n+ "uuid": "b4a09441-4f8f-46ec-81ff-c2a87928d1d6", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "out_file1", \n+ "uuid": "12afc0c5-36d1-4876-bd60-3b61e5c278f6"\n+ }\n+ ]\n+ }\n+ }, \n+ "uuid": "2757d825-19dc-4e6d-964d-724eef88b5b7"\n+}\n\\ No newline at end of file\n' |
| b |
| diff -r 000000000000 -r 4a47903bb4df Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-2.ga --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-2.ga Tue Apr 05 06:42:47 2016 -0400 |
| [ |
| b'@@ -0,0 +1,503 @@\n+{\n+ "a_galaxy_workflow": "true", \n+ "annotation": "", \n+ "format-version": "0.1", \n+ "name": "Metavisitor: Workflow for Use Case 3-2", \n+ "steps": {\n+ "0": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 0, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "Patient sequences collection"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset collection", \n+ "outputs": [], \n+ "position": {\n+ "left": 116.09375, \n+ "top": 130.59375\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"collection_type\\": \\"list\\", \\"name\\": \\"Patient sequences collection\\"}", \n+ "tool_version": null, \n+ "type": "data_collection_input", \n+ "uuid": "4c996dac-b8a2-4b4c-bb98-ab708c076e4e", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "13712bd9-2bed-4542-8137-737866b8537a"\n+ }\n+ ]\n+ }, \n+ "1": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 1, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "Nucleotide Viral BLAST database"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset", \n+ "outputs": [], \n+ "position": {\n+ "left": 1352.578125, \n+ "top": 992.578125\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"name\\": \\"Nucleotide Viral BLAST database\\"}", \n+ "tool_version": null, \n+ "type": "data_input", \n+ "uuid": "39d691fe-ba93-4eb1-a714-4133f03728b1", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "d92490ff-273f-4145-bc3d-ade5fca45255"\n+ }\n+ ]\n+ }, \n+ "2": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.2.6.2", \n+ "id": 2, \n+ "input_connections": {\n+ "library|input_1": {\n+ "id": 0, \n+ "output_name": "output"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "Bowtie2", \n+ "outputs": [\n+ {\n+ "name": "output_unaligned_reads_l", \n+ "type": "fastqsanger"\n+ }, \n+ {\n+ "name": "output_aligned_reads_l", \n+ "type": "fastqsanger"\n+ }, \n+ {\n+ "name": "output_aligned_reads_r", \n+ "type": "fastqsanger"\n+ }, \n+ {\n+ "name": "output_unaligned_reads_r", \n+ "type": "fastqsanger"\n+ }, \n+ {\n+ "name": "output", \n+ "type": "bam"\n+ }, \n+ {\n+ "name": "output_sam", \n+ "type": "sam"\n+ }, \n+ {\n+ "name": "mapping_stats", \n+ "type": "txt"\n+ }\n+ ], \n+ "position": {\n+ "left": 426.5625, \n+ "top": 258.609375\n+ }, \n+ "post_job_actions": {\n+ "DeleteIntermediatesActionoutput_unaligned_reads_l": {\n+ '..b' "fasta"\n+ }, \n+ {\n+ "name": "al_sequences", \n+ "type": "fasta"\n+ }, \n+ {\n+ "name": "un_sequences", \n+ "type": "fasta"\n+ }\n+ ], \n+ "position": {\n+ "left": 1893.5625, \n+ "top": 649.59375\n+ }, \n+ "post_job_actions": {\n+ "HideDatasetActional_sequences": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "al_sequences"\n+ }, \n+ "HideDatasetActionfastaOutput": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "fastaOutput"\n+ }, \n+ "HideDatasetActionun_sequences": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "un_sequences"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", \n+ "tool_state": "{\\"__page__\\": 0, \\"flanking\\": \\"\\\\\\"5\\\\\\"\\", \\"additional_filters\\": \\"{\\\\\\"filter_term_out\\\\\\": \\\\\\"Patent\\\\\\", \\\\\\"filter_relativeCov\\\\\\": \\\\\\"0.0\\\\\\", \\\\\\"filter_meanScore\\\\\\": \\\\\\"0.0\\\\\\", \\\\\\"use_filters\\\\\\": \\\\\\"yes\\\\\\", \\\\\\"__current_case__\\\\\\": 1, \\\\\\"filter_term_in\\\\\\": \\\\\\"\\\\\\", \\\\\\"filter_maxScore\\\\\\": \\\\\\"0.0\\\\\\"}\\", \\"__rerun_remap_job_id__\\": null, \\"mode\\": \\"\\\\\\"short\\\\\\"\\", \\"sequences\\": \\"null\\", \\"blast\\": \\"null\\"}", \n+ "tool_version": "2.4.3", \n+ "type": "tool", \n+ "uuid": "a2b3cb8f-ce9e-4a65-913c-44adbb1f2b41", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "tabularOutput", \n+ "uuid": "beee945b-3fb7-4340-a727-06c3146717bf"\n+ }\n+ ]\n+ }, \n+ "8": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", \n+ "id": 8, \n+ "input_connections": {\n+ "input": {\n+ "id": 7, \n+ "output_name": "tabularOutput"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "Concatenate multiple datasets", \n+ "outputs": [\n+ {\n+ "name": "out_file1", \n+ "type": "input"\n+ }\n+ ], \n+ "position": {\n+ "left": 2231.5, \n+ "top": 744.5\n+ }, \n+ "post_job_actions": {\n+ "RenameDatasetActionout_file1": {\n+ "action_arguments": {\n+ "newname": "Virus identification by patient"\n+ }, \n+ "action_type": "RenameDatasetAction", \n+ "output_name": "out_file1"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", \n+ "tool_state": "{\\"input\\": \\"null\\", \\"__rerun_remap_job_id__\\": null, \\"__page__\\": 0}", \n+ "tool_version": "0.2", \n+ "type": "tool", \n+ "uuid": "9a01734f-c0e7-42c2-b7d6-6ed69bcf728e", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "out_file1", \n+ "uuid": "a177238a-37d7-469b-a243-1330acc04024"\n+ }\n+ ]\n+ }\n+ }, \n+ "uuid": "c56c85ae-7cca-44ff-b732-50f75db00d0b"\n+}\n\\ No newline at end of file\n' |
| b |
| diff -r 000000000000 -r 4a47903bb4df Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-3.ga --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_3-3.ga Tue Apr 05 06:42:47 2016 -0400 |
| [ |
| b'@@ -0,0 +1,647 @@\n+{\n+ "a_galaxy_workflow": "true", \n+ "annotation": "", \n+ "format-version": "0.1", \n+ "name": "Metavisitor: Workflow for Use Case 3-3", \n+ "steps": {\n+ "0": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 0, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "Patient sequence collection"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset collection", \n+ "outputs": [], \n+ "position": {\n+ "left": 199.84375, \n+ "top": 200\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"collection_type\\": \\"list\\", \\"name\\": \\"Patient sequence collection\\"}", \n+ "tool_version": null, \n+ "type": "data_collection_input", \n+ "uuid": "21bdc466-e175-4b9c-aacc-9ba72a877535", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "0abd6e13-fa30-4dd4-ad60-90b7fef1a8bf"\n+ }\n+ ]\n+ }, \n+ "1": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 1, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "Nucleotide Viral Blast Database"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset", \n+ "outputs": [], \n+ "position": {\n+ "left": 929.90625, \n+ "top": 1307.984375\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"name\\": \\"Nucleotide Viral Blast Database\\"}", \n+ "tool_version": null, \n+ "type": "data_input", \n+ "uuid": "8a789998-8ad6-495f-b923-d7bfd02896f4", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "05aef397-b0f5-4556-adb5-be963df7d67f"\n+ }\n+ ]\n+ }, \n+ "2": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", \n+ "id": 2, \n+ "input_connections": {}, \n+ "inputs": [], \n+ "label": null, \n+ "name": "Retrieve FASTA from NCBI", \n+ "outputs": [\n+ {\n+ "name": "outfilename", \n+ "type": "fasta"\n+ }, \n+ {\n+ "name": "logfile", \n+ "type": "txt"\n+ }\n+ ], \n+ "position": {\n+ "left": 1234.46875, \n+ "top": 1247.96875\n+ }, \n+ "post_job_actions": {\n+ "HideDatasetActionlogfile": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "logfile"\n+ }, \n+ "HideDatasetActionoutfilename": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "outfilename"\n+ }, \n+ "RenameDatasetActionoutfilename": {\n+ "action_arguments": {\n+ "newname": "${reference_virus}"\n+ }, \n+ "action_type": "RenameDatasetAction", \n+ "output_name": "outfilename"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/dros'..b'tart\\\\\\", \\\\\\"send\\\\\\", \\\\\\"evalue\\\\\\", \\\\\\"bitscore\\\\\\"], \\\\\\"ids_cols\\\\\\": null, \\\\\\"tax_cols\\\\\\": null, \\\\\\"__current_case__\\\\\\": 2, \\\\\\"misc_cols\\\\\\": null, \\\\\\"ext_cols\\\\\\": [\\\\\\"slen\\\\\\"]}\\", \\"query\\": \\"null\\"}", \n+ "tool_version": "0.1.07", \n+ "type": "tool", \n+ "uuid": "6aad301d-b295-43af-ae9b-a1ec6f41da49", \n+ "workflow_outputs": []\n+ }, \n+ "11": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", \n+ "id": 11, \n+ "input_connections": {\n+ "blast_tab": {\n+ "id": 10, \n+ "output_name": "output1"\n+ }, \n+ "guideSequence": {\n+ "id": 2, \n+ "output_name": "outfilename"\n+ }, \n+ "sequences": {\n+ "id": 8, \n+ "output_name": "fastaOutput"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "blast_to_scaffold", \n+ "outputs": [\n+ {\n+ "name": "output", \n+ "type": "fasta"\n+ }\n+ ], \n+ "position": {\n+ "left": 2062.984375, \n+ "top": 1042.984375\n+ }, \n+ "post_job_actions": {}, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", \n+ "tool_state": "{\\"__page__\\": 0, \\"guideSequence\\": \\"null\\", \\"blast_tab\\": \\"null\\", \\"__rerun_remap_job_id__\\": null, \\"sequences\\": \\"null\\"}", \n+ "tool_version": "0.9.0", \n+ "type": "tool", \n+ "uuid": "3aea0893-96a6-427e-806b-4de7f6a3b656", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "352aeee8-286a-475d-b043-02c1e09d6a0f"\n+ }\n+ ]\n+ }, \n+ "12": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", \n+ "id": 12, \n+ "input_connections": {\n+ "input": {\n+ "id": 11, \n+ "output_name": "output"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "Concatenate multiple datasets", \n+ "outputs": [\n+ {\n+ "name": "out_file1", \n+ "type": "input"\n+ }\n+ ], \n+ "position": {\n+ "left": 2401.5, \n+ "top": 1165.5\n+ }, \n+ "post_job_actions": {\n+ "RenameDatasetActionout_file1": {\n+ "action_arguments": {\n+ "newname": "Genome Reconstruction guided by ${reference_virus}"\n+ }, \n+ "action_type": "RenameDatasetAction", \n+ "output_name": "out_file1"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", \n+ "tool_state": "{\\"input\\": \\"null\\", \\"__rerun_remap_job_id__\\": null, \\"__page__\\": 0}", \n+ "tool_version": "0.2", \n+ "type": "tool", \n+ "uuid": "ec943b0c-8635-4f10-80fe-7b71d478d555", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "out_file1", \n+ "uuid": "7e1c1f24-f29e-4ff1-8fd1-68dc82adb020"\n+ }\n+ ]\n+ }\n+ }, \n+ "uuid": "5d79fdae-33a6-4dd2-b0d8-eb57f2d11d32"\n+}\n\\ No newline at end of file\n' |
| b |
| diff -r 000000000000 -r 4a47903bb4df Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_1-1,2,3.ga --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_1-1,2,3.ga Tue Apr 05 06:42:47 2016 -0400 |
| [ |
| b'@@ -0,0 +1,445 @@\n+{\n+ "a_galaxy_workflow": "true", \n+ "annotation": "", \n+ "format-version": "0.1", \n+ "name": "Metavisitor: Workflow for remapping in Use Cases 1-1,2,3", \n+ "steps": {\n+ "0": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 0, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "Read fastq files"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset collection", \n+ "outputs": [], \n+ "position": {\n+ "left": 199.53128051757812, \n+ "top": 207.51737213134766\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"collection_type\\": \\"list\\", \\"name\\": \\"Read fastq files\\"}", \n+ "tool_version": null, \n+ "type": "data_collection_input", \n+ "uuid": "None", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "19eaa717-5b9a-4b27-a1c4-a895fc673970"\n+ }\n+ ]\n+ }, \n+ "1": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 1, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "Nora Virus Genomes"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset collection", \n+ "outputs": [], \n+ "position": {\n+ "left": 661.5451812744141, \n+ "top": 554.5312805175781\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"collection_type\\": \\"list\\", \\"name\\": \\"Nora Virus Genomes\\"}", \n+ "tool_version": null, \n+ "type": "data_collection_input", \n+ "uuid": "None", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "46b1caea-3a7c-4663-b2e1-6536a346567a"\n+ }\n+ ]\n+ }, \n+ "2": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", \n+ "id": 2, \n+ "input_connections": {\n+ "input": {\n+ "id": 0, \n+ "output_name": "output"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "Clip adapter", \n+ "outputs": [\n+ {\n+ "name": "output", \n+ "type": "fasta"\n+ }\n+ ], \n+ "position": {\n+ "left": 387.51739501953125, \n+ "top": 324.53126525878906\n+ }, \n+ "post_job_actions": {\n+ "HideDatasetActionoutput": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "output"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", \n+ "tool_state": "{\\"out_format\\": \\"\\\\\\"fasta\\\\\\"\\", \\"__page__\\": 0, \\"min\\": \\"\\\\\\"18\\\\\\"\\", \\"max\\": \\"\\\\\\"30\\\\\\"\\", \\"__rerun_remap_job_id__\\": null, \\"clip_source\\": \\"{\\\\\\"clip_source_list\\\\\\": \\\\\\"prebuilt\\\\\\", \\\\\\"clip_sequence\\\\\\": \\\\\\"CTGTAGGCACCATCAATCGT\\\\\\", \\\\\\"__current_case__\\\\\\": 0}\\", \\"input\\": \\"null\\", \\"Nmode\\": \\"\\\\\\"reject\\\\\\"\\"}", \n+ "tool_version": "1.3.6", \n+ "type": "tool", \n+ "uuid": "None", \n+ "workflow_outputs": []\n+ }, \n+ '..b'_rerun_remap_job_id__\\": null}", \n+ "tool_version": "1.0.0", \n+ "type": "tool", \n+ "uuid": "None", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "out_file1", \n+ "uuid": "cdd91e78-45f2-4ec2-b426-93e20d238c4b"\n+ }\n+ ]\n+ }, \n+ "8": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5", \n+ "id": 8, \n+ "input_connections": {\n+ "refGenomeSource|ownFile": {\n+ "id": 3, \n+ "output_name": "out_file1"\n+ }, \n+ "refGenomeSource|series_0|input": {\n+ "id": 6, \n+ "output_name": "out_file1"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "Generate readmap and histograms from alignment files", \n+ "outputs": [\n+ {\n+ "name": "readmap_dataframe", \n+ "type": "tabular"\n+ }, \n+ {\n+ "name": "size_distribution_dataframe", \n+ "type": "tabular"\n+ }, \n+ {\n+ "name": "readmap_PDF", \n+ "type": "pdf"\n+ }, \n+ {\n+ "name": "size_PDF", \n+ "type": "pdf"\n+ }, \n+ {\n+ "name": "combi_PDF", \n+ "type": "pdf"\n+ }\n+ ], \n+ "position": {\n+ "left": 1562.4827270507812, \n+ "top": 554.982666015625\n+ }, \n+ "post_job_actions": {\n+ "HideDatasetActionreadmap_dataframe": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "readmap_dataframe"\n+ }, \n+ "HideDatasetActionsize_distribution_dataframe": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "size_distribution_dataframe"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5", \n+ "tool_state": "{\\"minquery\\": \\"\\\\\\"18\\\\\\"\\", \\"__page__\\": 0, \\"rows_per_page\\": \\"\\\\\\"8\\\\\\"\\", \\"yrange\\": \\"\\\\\\"0\\\\\\"\\", \\"title\\": \\"\\\\\\"Readmaps and size distributions\\\\\\"\\", \\"refGenomeSource\\": \\"{\\\\\\"genomeSource\\\\\\": \\\\\\"history\\\\\\", \\\\\\"series\\\\\\": [{\\\\\\"__index__\\\\\\": 0, \\\\\\"norm\\\\\\": \\\\\\"1.0\\\\\\", \\\\\\"input\\\\\\": null}], \\\\\\"ownFile\\\\\\": null, \\\\\\"__current_case__\\\\\\": 1}\\", \\"__rerun_remap_job_id__\\": null, \\"maxquery\\": \\"\\\\\\"30\\\\\\"\\", \\"xlabel\\": \\"\\\\\\"Coordinates/read size\\\\\\"\\", \\"ylabel\\": \\"\\\\\\"Number of reads\\\\\\"\\", \\"gff\\": \\"null\\"}", \n+ "tool_version": "1.1.5", \n+ "type": "tool", \n+ "uuid": "ebaf90ab-b8ea-428f-876c-8f9fabd1fbf9", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "size_PDF", \n+ "uuid": "51ecda12-a282-4c56-8bd9-66f22742b301"\n+ }, \n+ {\n+ "label": null, \n+ "output_name": "combi_PDF", \n+ "uuid": "f9345f64-7f9b-440a-b12a-6d123a46800f"\n+ }, \n+ {\n+ "label": null, \n+ "output_name": "readmap_PDF", \n+ "uuid": "eb151acd-9d6d-4c30-8bc5-9124a9a3d815"\n+ }\n+ ]\n+ }\n+ }, \n+ "uuid": "35f7ef15-bb91-4eca-b8a7-345dc5cb3136"\n+}\n\\ No newline at end of file\n' |
| b |
| diff -r 000000000000 -r 4a47903bb4df Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_2-1,2.ga --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_2-1,2.ga Tue Apr 05 06:42:47 2016 -0400 |
| [ |
| b'@@ -0,0 +1,348 @@\n+{\n+ "a_galaxy_workflow": "true", \n+ "annotation": "", \n+ "format-version": "0.1", \n+ "name": "Metavisitor: Workflow for remapping in Use Cases 2-1,2", \n+ "steps": {\n+ "0": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 0, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "Small Read fastq files"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset collection", \n+ "outputs": [], \n+ "position": {\n+ "left": 199.53128051757812, \n+ "top": 207.51737785339355\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"collection_type\\": \\"list\\", \\"name\\": \\"Small Read fastq files\\"}", \n+ "tool_version": null, \n+ "type": "data_collection_input", \n+ "uuid": "None", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "bb3f50ae-6b7e-413f-bc2f-e86b8df2296b"\n+ }\n+ ]\n+ }, \n+ "1": {\n+ "annotation": "", \n+ "content_id": null, \n+ "id": 1, \n+ "input_connections": {}, \n+ "inputs": [\n+ {\n+ "description": "", \n+ "name": "AnCV genome"\n+ }\n+ ], \n+ "label": null, \n+ "name": "Input dataset", \n+ "outputs": [], \n+ "position": {\n+ "left": 639.982666015625, \n+ "top": 510.98963737487793\n+ }, \n+ "tool_errors": null, \n+ "tool_id": null, \n+ "tool_state": "{\\"name\\": \\"AnCV genome\\"}", \n+ "tool_version": null, \n+ "type": "data_input", \n+ "uuid": "5551b3da-5866-4474-8bc2-0f8dfea29902", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "output", \n+ "uuid": "b0f79ec9-f874-48d0-b665-2867dfbf76ac"\n+ }\n+ ]\n+ }, \n+ "2": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", \n+ "id": 2, \n+ "input_connections": {\n+ "input": {\n+ "id": 0, \n+ "output_name": "output"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "Clip adapter", \n+ "outputs": [\n+ {\n+ "name": "output", \n+ "type": "fasta"\n+ }\n+ ], \n+ "position": {\n+ "left": 387.51739501953125, \n+ "top": 324.53126335144043\n+ }, \n+ "post_job_actions": {\n+ "HideDatasetActionoutput": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "output"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", \n+ "tool_state": "{\\"out_format\\": \\"\\\\\\"fasta\\\\\\"\\", \\"__page__\\": 0, \\"min\\": \\"\\\\\\"18\\\\\\"\\", \\"max\\": \\"\\\\\\"30\\\\\\"\\", \\"__rerun_remap_job_id__\\": null, \\"clip_source\\": \\"{\\\\\\"clip_source_list\\\\\\": \\\\\\"prebuilt\\\\\\", \\\\\\"clip_sequence\\\\\\": \\\\\\"TGGAATTCTCGGGTGCCAAG\\\\\\", \\\\\\"__current_case__\\\\\\": 0}\\", \\"input\\": \\"null\\", \\"Nmode\\": \\"\\\\\\"reject\\\\\\"\\"}", \n+ "tool_version": "1.3.6", \n+ "type": "tool", \n+ "uuid": "None", \n+ "workflow_outputs": []\n+ }, \n+ "3": {\n+ '..b'", \\"__rerun_remap_job_id__\\": null}", \n+ "tool_version": "1.0.0", \n+ "type": "tool", \n+ "uuid": "None", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "out_file1", \n+ "uuid": "7545c393-0ac1-4c52-b1ba-b34c2ed5462f"\n+ }\n+ ]\n+ }, \n+ "6": {\n+ "annotation": "", \n+ "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5", \n+ "id": 6, \n+ "input_connections": {\n+ "refGenomeSource|ownFile": {\n+ "id": 1, \n+ "output_name": "output"\n+ }, \n+ "refGenomeSource|series_0|input": {\n+ "id": 4, \n+ "output_name": "output"\n+ }\n+ }, \n+ "inputs": [], \n+ "label": null, \n+ "name": "Generate readmap and histograms from alignment files", \n+ "outputs": [\n+ {\n+ "name": "readmap_dataframe", \n+ "type": "tabular"\n+ }, \n+ {\n+ "name": "size_distribution_dataframe", \n+ "type": "tabular"\n+ }, \n+ {\n+ "name": "readmap_PDF", \n+ "type": "pdf"\n+ }, \n+ {\n+ "name": "size_PDF", \n+ "type": "pdf"\n+ }, \n+ {\n+ "name": "combi_PDF", \n+ "type": "pdf"\n+ }\n+ ], \n+ "position": {\n+ "left": 1204.49658203125, \n+ "top": 412.98612785339355\n+ }, \n+ "post_job_actions": {\n+ "HideDatasetActionreadmap_dataframe": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "readmap_dataframe"\n+ }, \n+ "HideDatasetActionsize_distribution_dataframe": {\n+ "action_arguments": {}, \n+ "action_type": "HideDatasetAction", \n+ "output_name": "size_distribution_dataframe"\n+ }\n+ }, \n+ "tool_errors": null, \n+ "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5", \n+ "tool_state": "{\\"minquery\\": \\"\\\\\\"18\\\\\\"\\", \\"__page__\\": 0, \\"rows_per_page\\": \\"\\\\\\"8\\\\\\"\\", \\"yrange\\": \\"\\\\\\"0\\\\\\"\\", \\"title\\": \\"\\\\\\"Readmaps and size distributions\\\\\\"\\", \\"refGenomeSource\\": \\"{\\\\\\"genomeSource\\\\\\": \\\\\\"history\\\\\\", \\\\\\"series\\\\\\": [{\\\\\\"__index__\\\\\\": 0, \\\\\\"norm\\\\\\": \\\\\\"1.0\\\\\\", \\\\\\"input\\\\\\": null}], \\\\\\"ownFile\\\\\\": null, \\\\\\"__current_case__\\\\\\": 1}\\", \\"__rerun_remap_job_id__\\": null, \\"maxquery\\": \\"\\\\\\"30\\\\\\"\\", \\"xlabel\\": \\"\\\\\\"Coordinates/read size\\\\\\"\\", \\"ylabel\\": \\"\\\\\\"Number of reads\\\\\\"\\", \\"gff\\": \\"null\\"}", \n+ "tool_version": "1.1.5", \n+ "type": "tool", \n+ "uuid": "ebaf90ab-b8ea-428f-876c-8f9fabd1fbf9", \n+ "workflow_outputs": [\n+ {\n+ "label": null, \n+ "output_name": "size_PDF", \n+ "uuid": "28a51c7e-58d9-4728-8ac0-04d252cd5943"\n+ }, \n+ {\n+ "label": null, \n+ "output_name": "combi_PDF", \n+ "uuid": "f9aaace3-8bdb-4b83-a40b-d6d9a26fd345"\n+ }, \n+ {\n+ "label": null, \n+ "output_name": "readmap_PDF", \n+ "uuid": "ad51fc18-9cdf-4068-bbee-269801cdbde3"\n+ }\n+ ]\n+ }\n+ }, \n+ "uuid": "e670f707-78ad-4128-8549-8a210c7dcbf1"\n+}\n\\ No newline at end of file\n' |
| b |
| diff -r 000000000000 -r 4a47903bb4df repository_dependencies.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/repository_dependencies.xml Tue Apr 05 06:42:47 2016 -0400 |
| b |
| @@ -0,0 +1,4 @@ +<?xml version="1.0"?> +<repositories description="These workflows require the repository suite_metavisitor_1_2"> + <repository changeset_revision="e24919521ffb" name="suite_metavisitor_1_2" owner="drosofff" toolshed="http://toolshed.g2.bx.psu.edu" /> +</repositories> |