| Previous changeset 29:3a2aab18a217 (2014-09-16) Next changeset 31:7889d260cc37 (2015-10-21) |
|
Commit message:
planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 3bc1d1c6f4e28ac7ff8df79fe4e3f00a195938e6-dirty |
|
modified:
bamCompare.xml bamCorrelate.xml bamCoverage.xml bamFingerprint.xml bamPEFragmentSize.xml bigwigCompare.xml computeGCBias.xml computeMatrix.xml correctGCBias.xml deepTools_macros.xml heatmapper.xml profiler.xml tool_data_table_conf.xml.sample tool_dependencies.xml |
|
added:
bigwigCorrelate.xml datatypes_conf.xml repository_dependencies.xml test-data/bamCompare_result1.bg test-data/bamCorrelate_result1.png test-data/bamCoverage_result1.bw test-data/bamCoverage_result2.bw test-data/bamCoverage_result3.bg test-data/bamCoverage_result4.bg test-data/bamCoverage_result4.bw test-data/bamFingerprint_result1.png test-data/bamPEFragmentSize_histogram_result1.png test-data/bamPEFragmentSize_result1.txt test-data/bigwigCompare_result1.bw test-data/bigwigCompare_result2.bg test-data/bigwigCorrelate_result1.png test-data/bowtie2-test1.bam test-data/computeGCBias_result1.tabular test-data/computeMatrix1.bed test-data/computeMatrix2.bed test-data/computeMatrix2.bw test-data/computeMatrix_result1.gz test-data/computeMatrix_result2.gz test-data/correctGCBias_result1.bam test-data/heatmapper_result1.png test-data/paired_chr2L.bam test-data/phiX.2bit test-data/phiX.bam test-data/phiX.bam.bai test-data/phiX.fasta test-data/profiler_result1.png test-data/sequence.2bit tool-data/lastz_seqs.loc.sample |
|
removed:
test-data/master.mat.gz test-data/master.png test-data/test2.bed tool-data/deepTools_seqs.loc.sample |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 bamCompare.xml --- a/bamCompare.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/bamCompare.xml Tue Oct 20 14:43:12 2015 -0400 |
| [ |
| b'@@ -1,59 +1,59 @@\n <tool id="deeptools_bamCompare" name="bamCompare" version="@WRAPPER_VERSION@.0">\n <description>normalizes and compares two BAM files to obtain the ratio, log2ratio or difference. (bam2bigwig)</description>\n- <expand macro="requirements" />\n- <expand macro="stdio" />\n <macros>\n <token name="@BINARY@">bamCompare</token>\n <import>deepTools_macros.xml</import>\n </macros>\n+ <expand macro="requirements" />\n <command>\n+<![CDATA[\n bamCompare\n \n @THREADS@\n \n- --bamfile1 \'$bamFile1\'\n- -bai1 \'${bamFile1.metadata.bam_index}\'\n- --bamfile2 \'$bamFile2\'\n- -bai2 \'${bamFile2.metadata.bam_index}\'\n+ --bamfile1 \'$bamFile1\'\n+ -bai1 \'${bamFile1.metadata.bam_index}\'\n+ --bamfile2 \'$bamFile2\'\n+ -bai2 \'${bamFile2.metadata.bam_index}\'\n \n- --outFileName \'$outFileName\'\n- --outFileFormat \'$outFileFormat\'\n+ --outFileName \'$outFileName\'\n+ --outFileFormat \'$outFileFormat\'\n \n- --fragmentLength $fragmentLength\n- --binSize $binSize\n+ --fragmentLength $fragmentLength\n+ --binSize $binSize\n \n- #if $scaling.method == \'SES\':\n- --scaleFactorsMethod SES\n- --sampleLength $scaling.sampleLength\n- #elif $scaling.method == \'readCount\':\n- --scaleFactorsMethod readCount\n- #elif $scaling.method == \'own\':\n- --scaleFactors \'$scaling.scaleFactor1:$scaling.scaleFactor2\'\n- #end if\n+ #if $scaling.method == \'SES\':\n+ --scaleFactorsMethod SES\n+ --sampleLength $scaling.sampleLength\n+ #elif $scaling.method == \'readCount\':\n+ --scaleFactorsMethod readCount\n+ #elif $scaling.method == \'own\':\n+ --scaleFactors \'$scaling.scaleFactor1:$scaling.scaleFactor2\'\n+ #end if\n \n- --ratio $comparison.type\n+ --ratio $comparison.type\n \n- #if $comparison.type==\'subtract\':\n- #if $comparison.normalization.type==\'rpkm\':\n- --normalizeUsingRPKM\n- #elif $comparison.normalization.type==\'1x\':\n+ #if $comparison.type==\'subtract\':\n+ #if $comparison.normalization.type==\'rpkm\':\n+ --normalizeUsingRPKM\n+ #elif $comparison.normalization.type==\'1x\':\n \n- #if $comparison.normalization.effectiveGenomeSize.effectiveGenomeSize_opt == "specific":\n- --normalizeTo1x $comparison.normalization.effectiveGenomeSize.effectiveGenomeSize\n- #else:\n- --normalizeTo1x $comparison.normalization.effectiveGenomeSize.effectiveGenomeSize_opt\n- #end if\n+ #if $comparison.normalization.effectiveGenomeSize.effectiveGenomeSize_opt == "specific":\n+ --normalizeTo1x $comparison.normalization.effectiveGenomeSize.effectiveGenomeSize\n+ #else:\n+ --normalizeTo1x $comparison.normalization.effectiveGenomeSize.effectiveGenomeSize_opt\n+ #end if\n \n- #end if\n- #elif $comparison.type in [\'ratio\',\'log2\']:\n- --pseudocount $comparison.pseudocount\n- #end if\n+ #end if\n+ #elif $comparison.type in [\'ratio\',\'log2\']:\n+ --pseudocount $comparison.pseudocount\n+ #end if\n \n- #if str($region).strip() != \'\':\n- --region \'$region\'\n- #end if\n+ #if str($region).strip() != \'\':\n+ --region \'$region\'\n+ #end if\n \n- #if $advancedOpt.showAdvancedOpt == "yes":\n+ #if $advancedOpt.showAdvancedOpt == "yes":\n #if $advancedOpt.smoothLength:\n --smoothLength \'$advancedOpt.smoothLength\'\n #end if\n@@ -68,27 +68,26 @@\n --missingDataAsZero $advancedOpt.missingDataAsZero\n \n #if str($advancedOpt.ignoreForNormalization).strip() != \'\':\n- --ignoreForNormalization $advancedOpt.ignoreForNormalization\n+ --ignoreForNormalization \'$advancedOpt.ignoreForNormalization\'\n #end if\n-\n- '..b'ads. For example, if the bin size is set to 20 bp and the smooth length is set to 60 bp, then, for each bin size the average of it and its left and right neighbors is considered. Any value smaller than the bin size will be ignored and no smoothing will be applied."/>\n-\n- <param name="doNotExtendPairedEnds" type="boolean" truevalue="--doNotExtendPairedEnds" falsevalue=""\n- label="Do not extend paired ends"\n- help="If set, reads are not extended to match the fragment length reported in the BAM file, instead they will be extended to match the fragment length. Default is to extend the reads if paired end information is available."/>\n-\n- <param name="ignoreDuplicates" type="boolean" truevalue="--ignoreDuplicates" falsevalue=""\n- label="Ignore duplicates"\n- help="If set, reads that have the same orientation and start position will be considered only once. If reads are paired, the mate position also has to coincide to ignore a read." /> \n-\n- <param name="minMappingQuality" type="integer" optional="true" value="1" min="1"\n- label="Minimum mapping quality (e.g. BOWTIE2 measures)"\n- help= "If set, only reads that have a mapping quality score higher than the given value are considered. *Note* Bowtie\'s Mapping quality is related to uniqueness: the higher the score, the more unique is a read. A mapping quality defined by Bowtie of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere."/>\n-\n+ help ="The smooth length defines a window, larger than the bin size, to average the number of reads. For example, if the bin size is set to 20 bp and the smooth length is set to 60 bp, then, for each bin size the average of it and its left and right neighbors is considered. Any value smaller than the bin size will be ignored and no smoothing will be applied. (--smoothLength)"/>\n+ <expand macro="doNotExtendPairedEnds" />\n+ <expand macro="ignoreDuplicates" />\n+ <expand macro="minMappingQuality" />\n <expand macro="missingDataAsZero" />\n-\n <param name="ignoreForNormalization" type="text" value="" size="50"\n label="regions that should be excluded for calculating the scaling factor"\n help="Sometimes it makes sense to exclude certain regions when calculating the scaling factor. For example, if you know some regions that you suspect to be present more often in your sample\'s genome than in the reference genome that will therefore accumulate reads (CNV). Another typical example is the single X chromosome in male samples that should be scaled separately from the diploid autosomes. For example chrX,chrY,chr3. or chr10:12220-128932" />\n-\n+ <expand macro="samFlag" />\n </when>\n </conditional>\n-\n </inputs>\n <outputs>\n <data format="bigwig" name="outFileName">\n@@ -190,8 +179,21 @@\n </change_format>\n </data>\n </outputs>\n+ <tests>\n+ <test>\n+ <param name="bamFile1" value="bowtie2-test1.bam" ftype="bam" />\n+ <param name="bamFile2" value="bowtie2-test1.bam" ftype="bam" />\n+ <param name="showAdvancedOpt" value="no" />\n+ <param name="outFileFormat" value="bigwig" />\n+ <param name="fragmentLength" value="100" />\n+ <param name="outFileFormat" value="bedgraph" />\n+ <param name="binSize" value="5" />\n+ <param name="type" value="ratio" />\n+ <output name="outFileName" file="bamCompare_result1.bg" ftype="bedgraph" />\n+ </test>\n+ </tests>\n <help>\n-\n+<![CDATA[\n **What it does**\n \n This tool compares two BAM files based on the number of mapped reads. To\n@@ -224,7 +226,7 @@\n -----\n \n @REFERENCES@\n-\n+]]>\n </help>\n <expand macro="citations" />\n </tool>\n' |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 bamCorrelate.xml --- a/bamCorrelate.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/bamCorrelate.xml Tue Oct 20 14:43:12 2015 -0400 |
| [ |
| @@ -1,12 +1,12 @@ <tool id="deeptools_bamCorrelate" name="bamCorrelate" version="@WRAPPER_VERSION@.0"> <description>correlates pairs of BAM files</description> - <expand macro="requirements" /> - <expand macro="stdio" /> <macros> <token name="@BINARY@">bamCorrelate</token> <import>deepTools_macros.xml</import> </macros> + <expand macro="requirements" /> <command> +<![CDATA[ #set files=[] #set labels=[] @@ -18,8 +18,8 @@ @THREADS@ - --bamfiles #echo " ".join($files) - --labels #echo " ".join($labels) + --bamfiles '#echo "' '".join($files)#' + --labels '#echo "' '".join($labels)#' --fragmentLength $fragmentLength --corMethod $corMethod @@ -28,7 +28,7 @@ #if $output.showOutputSettings == "yes" --outRawCounts '$outFileRawCounts' --outFileCorMatrix '$outFileCorMatrix' - --plotFileFormat $output.outFileFormat + --plotFileFormat '$output.outFileFormat' #else: --plotFileFormat 'png' #end if @@ -37,7 +37,6 @@ --binSize '$mode.binSize' --distanceBetweenBins '$mode.distanceBetweenBins' $mode.doNotRemoveOutliers - #else: --BED $mode.region_file #end if @@ -47,6 +46,10 @@ --region '$mode.region' #end if + #if $plotTitle and str($plotTitle).strip() != "": + --plotTitle '$plotTitle' + #end if + $plotNumbers #if $mode.advancedOpt.showAdvancedOpt == "yes": $mode.advancedOpt.doNotExtendPairedEnds @@ -66,14 +69,18 @@ --colorMap '$mode.advancedOpt.colorMap' #end if +]]> </command> <inputs> <expand macro="multiple_input_bams" /> - <param name="fragmentLength" type="integer" value="300" min="1" + <param name="fragmentLength" type="integer" value="200" min="1" label="Length of the average fragment size" - help ="Reads will be extended to match this length unless they are paired-end, in which case they will be extended to match the fragment length. *NOTE*: If the BAM files contain mated and unmated paired-end reads, unmated reads will be extended to match the fragment length."/> + help ="Reads will be extended to match this length unless they are paired-end, + in which case they will be extended to match the fragment length. + *NOTE*: If the BAM files contain mated and unmated paired-end reads, unmated reads will + be extended to match the fragment length. (--fragmentLength)"/> <param name="corMethod" type="select" label="Correlation method"> <option value="spearman" selected="True">Spearman</option> @@ -82,14 +89,18 @@ <conditional name="mode"> <param name="modeOpt" type="select" label="Choose computation mode" - help="In the bins mode, the correlation is computed based on equal length bins. In the BED file mode, as list of genomic regions in BED format has to be given. For each region in the BED file the number of overlapping reads is counted in each of the BAM files. Then the correlation is computed."> + help="In the bins mode, the correlation is computed based on equal + length bins. In the BED file mode, as list of genomic regions in BED + format has to be given. For each region in the BED file the number of + overlapping reads is counted in each of the BAM files. + Then the correlation is computed."> <option value="bins" selected="true">Bins</option> <option value="BED-file">Limit correlation to certain regions (BED file)</option> </param> <when value="bins"> <param name="binSize" type="integer" value="10000" min="1" label="Bin size in bp" - help="Length in base pairs for a window used to sample the genome."/> + help="Length in base pairs for a window used to sample the genome. (--binSize)"/> <param name="distanceBetweenBins" type="integer" value="0" min="0" label="Distance between bins" @@ -97,7 +108,7 @@ the specified 'Bin size'. However, to reduce the computation time, a larger distance between bins can by given. Larger distances result in less bins being - considered"/> + considered. (--distanceBetweenBins)"/> <param name="doNotRemoveOutliers" type="boolean" truevalue="--doNotRemoveOutliers" falsevalue="" label="Do not filter outliers" @@ -111,17 +122,19 @@ bamCorrelate tries to remove outliers using the median absolute deviation (MAD) method applying a threshold of 200 to only consider extremely large - deviations from the median."/> + deviations from the median. (--doNotRemoveOutliers)"/> <expand macro="bamCorrelate_mode_actions" /> </when> <when value="BED-file"> - <param name="region_file" type="data" format="bed" label="Region file in BED format" help="Correlation is computed for the number of reads that overlap such regions."/> + <param name="region_file" type="data" format="bed" + label="Region file in BED format" + help="Correlation is computed for the number of reads that overlap such regions."/> <expand macro="bamCorrelate_mode_actions" /> </when> - </conditional> - + <expand macro="plotTitle" /> + <expand macro="plotNumbers" /> <conditional name="output"> <param name="showOutputSettings" type="select" label="Show advanced output settings" > <option value="no" selected="true">no</option> @@ -155,8 +168,24 @@ </filter> </data> </outputs> + <tests> + <test> + <repeat name="input_files"> + <param name="bamfile" value="bowtie2-test1.bam" ftype="bam" /> + <param name="label" value="first BAM file" /> + </repeat> + <repeat name="input_files"> + <param name="bamfile" value="bowtie2-test1.bam" ftype="bam" /> + <param name="label" value="second BAM file" /> + </repeat> + <param name="modeOpt" value="bins" /> + <param name="binSize" value="10" /> + <param name="showOutputSettings" value="no" /> + <output name="outFileName" file="bamCorrelate_result1.png" ftype="png" compare="sim_size" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** This tool is useful to assess the overall similarity of different BAM files. A typical application @@ -183,7 +212,7 @@ ----- @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool> |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 bamCoverage.xml --- a/bamCoverage.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/bamCoverage.xml Tue Oct 20 14:43:12 2015 -0400 |
| [ |
| b'@@ -1,68 +1,71 @@\n <tool id="deeptools_bamCoverage" name="bamCoverage" version="@WRAPPER_VERSION@.0">\n <description> generates a coverage bigWig file from a given BAM file. Multiple options are available to count reads and normalize coverage. (bam2bigwig)</description>\n- <expand macro="requirements" />\n- <expand macro="stdio" />\n <macros>\n <token name="@BINARY@">bamCoverage</token>\n <import>deepTools_macros.xml</import>\n </macros>\n+ <expand macro="requirements" />\n <command>\n+<![CDATA[\n bamCoverage\n \n- @THREADS@\n+ @THREADS@\n \n- --bam \'$bamInput\'\n- --bamIndex ${bamInput.metadata.bam_index}\n- --outFileName \'$outFileName\'\n- --outFileFormat \'$outFileFormat\'\n+ --bam \'$bamInput\'\n+ --bamIndex ${bamInput.metadata.bam_index}\n+ --outFileName \'$outFileName\'\n+ --outFileFormat \'$outFileFormat\'\n \n- --fragmentLength $fragmentLength\n- --binSize $binSize\n+ --fragmentLength $fragmentLength\n+ --binSize $binSize\n \n- #if $scaling.type==\'rpkm\':\n- --normalizeUsingRPKM\n- #elif $scaling.type==\'1x\':\n- #if $scaling.effectiveGenomeSize.effectiveGenomeSize_opt == "specific":\n- --normalizeTo1x $scaling.effectiveGenomeSize.effectiveGenomeSize\n- #else:\n- --normalizeTo1x $scaling.effectiveGenomeSize.effectiveGenomeSize_opt\n- #end if\n- #elif $scaling.type==\'own\':\n- --scaleFactor $scaling.scaleFactor\n- #end if\n-\n- #if str($region).strip() != \'\':\n- --region \'$region\'\n- #end if\n-\n- #if $advancedOpt.showAdvancedOpt == "yes":\n- #if $advancedOpt.smoothLength:\n- --smoothLength \'$advancedOpt.smoothLength\'\n+ #if $scaling.type==\'rpkm\':\n+ --normalizeUsingRPKM\n+ #elif $scaling.type==\'1x\':\n+ #if $scaling.effectiveGenomeSize.effectiveGenomeSize_opt == "specific":\n+ --normalizeTo1x $scaling.effectiveGenomeSize.effectiveGenomeSize\n+ #else:\n+ --normalizeTo1x $scaling.effectiveGenomeSize.effectiveGenomeSize_opt\n+ #end if\n+ #elif $scaling.type==\'own\':\n+ --scaleFactor $scaling.scaleFactor\n #end if\n \n- $advancedOpt.doNotExtendPairedEnds\n- $advancedOpt.ignoreDuplicates\n-\n- #if $advancedOpt.minMappingQuality:\n- --minMappingQuality \'$advancedOpt.minMappingQuality\'\n+ #if str($region).strip() != \'\':\n+ --region \'$region\'\n #end if\n \n- --missingDataAsZero $advancedOpt.missingDataAsZero\n+ #if $advancedOpt.showAdvancedOpt == "yes":\n+ #if $advancedOpt.smoothLength:\n+ --smoothLength \'$advancedOpt.smoothLength\'\n+ #end if\n+\n+ $advancedOpt.doNotExtendPairedEnds\n+ $advancedOpt.ignoreDuplicates\n \n- ##if str($advancedOpt.ignoreForNormalization).strip() != \'\':\n- ## --ignoreForNormalization $advancedOpt.ignoreForNormalization\n- ##end if\n+ #if $advancedOpt.minMappingQuality:\n+ --minMappingQuality \'$advancedOpt.minMappingQuality\'\n+ #end if\n+\n+ --missingDataAsZero $advancedOpt.missingDataAsZero\n \n- #end if\n+ ##if str($advancedOpt.ignoreForNormalization).strip() != \'\':\n+ ## --ignoreForNormalization $advancedOpt.ignoreForNormalization\n+ ##end if\n+ #if $samFlag:\n+ --samFlag $samFlag\n+ #end if\n+ #end if\n+]]>\n </command>\n \n <inputs>\n <param name="bamInput" format="bam" type="data" label="BAM file"\n help="The BAM file must be sorted."/>\n \n- <param name="fragmentLength" type="integer" '..b' <param name="ignoreDuplicates" type="boolean" truevalue="--ignoreDuplicates" falsevalue=""\n- label="Ignore duplicates"\n- help="If set, reads that have the same orientation and start position will be considered only once. If reads are paired, the mate position also has to coincide to ignore a read." /> \n-\n- <param name="minMappingQuality" type="integer" optional="true" value="1" min="1"\n- label="Minimum mapping quality"\n- help= "If set, only reads that have a mapping quality score higher than the given value are considered. *Note* Bowtie\'s Mapping quality is related to uniqueness: the higher the score, the more unique is a read. A mapping quality defined by Bowtie of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere."/>\n-\n+ <expand macro="doNotExtendPairedEnds" />\n+ <expand macro="ignoreDuplicates" />\n+ <expand macro="minMappingQuality" />\n <expand macro="missingDataAsZero" />\n-\n+ <expand macro="samFlag" />\n <!-- <param name="ignoreForNormalization" type="text" value="" size="50"\n label="regions that should be excluded for calculating the scaling factor"\n help="Sometimes it makes sense to exclude certain regions when calculating the scaling factor. For example, if you know some regions that you suspect to be present more often in your sample\'s genome than in the reference genome that will therefore accumulate reads (CNV). Another typical example is the single X chromosome in male samples that should be scaled separately from the diploid autosomes. For example chrX,chrY,chr3. or chr10:12220-128932" />\n@@ -133,8 +127,46 @@\n </change_format>\n </data>\n </outputs>\n+ <tests>\n+ <test>\n+ <param name="bamInput" value="bowtie2-test1.bam" ftype="bam" />\n+ <param name="outFileFormat" value="bigwig" />\n+ <param name="showAdvancedOpt" value="no" />\n+ <param name="binSize" value="10" />\n+ <param name="type" value="no" />\n+ <output name="outFileName" file="bamCoverage_result1.bw" ftype="bigwig" />\n+ </test>\n+ <test>\n+ <param name="bamInput" value="bowtie2-test1.bam" ftype="bam" />\n+ <param name="outFileFormat" value="bigwig" />\n+ <param name="showAdvancedOpt" value="no" />\n+ <param name="binSize" value="10" />\n+ <output name="outFileName" file="bamCoverage_result2.bw" ftype="bigwig" />\n+ </test>\n+ <test>\n+ <param name="bamInput" value="bowtie2-test1.bam" ftype="bam" />\n+ <param name="outFileFormat" value="bedgraph" />\n+ <param name="showAdvancedOpt" value="no" />\n+ <param name="binSize" value="10" />\n+ <output name="outFileName" file="bamCoverage_result3.bg" ftype="bedgraph" />\n+ </test>\n+ <test>\n+ <param name="bamInput" value="phiX.bam" ftype="bam" />\n+ <param name="outFileFormat" value="bigwig" />\n+ <param name="showAdvancedOpt" value="no" />\n+ <param name="binSize" value="10" />\n+ <output name="outFileName" file="bamCoverage_result4.bw" ftype="bigwig" />\n+ </test>\n+ <test>\n+ <param name="bamInput" value="phiX.bam" ftype="bam" />\n+ <param name="outFileFormat" value="bedgraph" />\n+ <param name="showAdvancedOpt" value="no" />\n+ <param name="binSize" value="10" />\n+ <output name="outFileName" file="bamCoverage_result4.bg" ftype="bedgraph" />\n+ </test>\n+ </tests>\n <help>\n-\n+<![CDATA[\n **What it does**\n \n Given a BAM file, this tool generates a bigWig or bedGraph file of fragment or\n@@ -160,7 +192,7 @@\n -----\n \n @REFERENCES@\n-\n+]]>\n </help>\n <expand macro="citations" />\n </tool>\n' |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 bamFingerprint.xml --- a/bamFingerprint.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/bamFingerprint.xml Tue Oct 20 14:43:12 2015 -0400 |
| [ |
| @@ -1,62 +1,61 @@ <tool id="deeptools_bamFingerprint" name="bamFingerprint" version="@WRAPPER_VERSION@.0"> <description>plots profiles of BAM files; useful for assesing ChIP signal strength</description> - <expand macro="requirements" /> - <expand macro="stdio" /> <macros> <token name="@BINARY@">bamFingerprint</token> <import>deepTools_macros.xml</import> </macros> + <expand macro="requirements" /> <command> +<![CDATA[ @multiple_input_bams@ - bamFingerprint + bamFingerprint + + @THREADS@ - @THREADS@ + --bamfiles #echo " ".join($files) + --labels #echo " ".join($labels) + + --fragmentLength $fragmentLength - --bamfiles #echo " ".join($files) - --labels #echo " ".join($labels) + --plotFile $outFileName - --fragmentLength $fragmentLength - - #set newoutFileName=str($outFileName)+".png" - --plotFile $newoutFileName + #if $output.showOutputSettings == "yes" + --plotFileFormat $output.outFileFormat + #if $output.saveRawCounts: + --outRawCounts '$outFileRawCounts' + #end if + #else + --plotFileFormat 'png' + #end if - #if $output.showOutputSettings == "yes" - --plotFileFormat $output.outFileFormat - #if $output.saveRawCounts: - --outRawCounts '$outFileRawCounts' - #end if - #else - --plotFileFormat 'png' - #end if + #if str($region).strip() != '': + --region '$region' + #end if - #if str($region).strip() != '': - --region '$region' - #end if + #if $advancedOpt.showAdvancedOpt == "yes": + --binSize '$advancedOpt.binSize' + --numberOfSamples '$advancedOpt.numberOfSamples' - #if $advancedOpt.showAdvancedOpt == "yes": - --binSize '$advancedOpt.binSize' - --numberOfSamples '$advancedOpt.numberOfSamples' + $advancedOpt.doNotExtendPairedEnds + $advancedOpt.ignoreDuplicates + $advancedOpt.skipZeros - $advancedOpt.doNotExtendPairedEnds - $advancedOpt.ignoreDuplicates - $advancedOpt.skipZeros + #if $advancedOpt.minMappingQuality: + --minMappingQuality '$advancedOpt.minMappingQuality' + #end if - #if $advancedOpt.minMappingQuality: - --minMappingQuality '$advancedOpt.minMappingQuality' - #end if - #end if - ; mv $newoutFileName $outFileName - ; rm $temp_dir -rf + #if $advancedOpt.plotTitle and str($advancedOpt.plotTitle.value) != "": + --plotTitle '$advancedOpt.plotTitle' + #end if + + #end if +]]> </command> <inputs> <expand macro="multiple_input_bams" /> - - - <param name="fragmentLength" type="integer" value="200" min="1" - label="Length of the average fragment size"/> - + <expand macro="fragmentLength" /> <expand macro="region_limit_operation" /> <conditional name="advancedOpt"> @@ -66,32 +65,19 @@ </param> <when value="no" /> <when value="yes"> - <param name="binSize" type="integer" value="10000" min="1" + <param name="binSize" type="integer" value="500" min="1" label="Bin size in bp" help="Length in base pairs for a window used to sample the genome."/> - <param name="numberOfSamples" type="integer" value="100000" min="1" label="Number of samples" - help="Number of samples taken from the genome to compute the scaling factors"/> - - <param name="doNotExtendPairedEnds" type="boolean" truevalue="--doNotExtendPairedEnds" falsevalue="" - label="Do not extend paired ends" - help="If set, reads are not extended to match the fragment length reported in the BAM file, instead they will be extended to match the fragment length. Default is to extend the reads if paired end information is available."/> - - <param name="ignoreDuplicates" type="boolean" truevalue="--ignoreDuplicates" falsevalue="" - label="Ignore duplicates" - help="If set, reads that have the same orientation and start position will be considered only once. If reads are paired, the mate position also has to coincide to ignore a read." /> - - <param name="minMappingQuality" type="integer" optional="true" value="1" min="1" - label="Minimum mapping quality" - help= "If set, only reads that have a mapping quality score higher than the given value are considered. *Note* Bowtie's Mapping quality is related to uniqueness: the higher the score, the more unique is a read. A mapping quality defined by Bowtie of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere."/> - - <param name="skipZeros" type="boolean" truevalue="--skipZeros" falsevalue="" - label ="Include zeros" - help ="If set, then zero counts that happen for *all* BAM files given are ignored. This might have the effect that fewer regions are considered than indicated in the option where the number of samples is defined." /> + help="Number of samples taken from the genome to compute the scaling factors. (--numberOfSamples)"/> + <expand macro="doNotExtendPairedEnds" /> + <expand macro="ignoreDuplicates" /> + <expand macro="minMappingQuality" /> + <expand macro="skipZeros" /> + <expand macro="plotTitle" /> </when> </conditional> - <conditional name="output"> <param name="showOutputSettings" type="select" label="Show advanced output settings"> <option value="no" selected="true">no</option> @@ -100,10 +86,9 @@ <when value="no" /> <when value="yes"> <expand macro="input_image_file_format" /> - <param name="saveRawCounts" type="boolean" label="Save the bin counts"/> + <param name="saveRawCounts" type="boolean" label="Save the bin counts" help="(--outRawCounts)"/> </when> </conditional> - </inputs> <outputs> <expand macro="output_image_file_format" /> @@ -116,8 +101,22 @@ </filter> </data> </outputs> + <tests> + <test> + <repeat name="input_files"> + <param name="bamfile" value="bowtie2-test1.bam" ftype="bam" /> + </repeat> + <repeat name="input_files"> + <param name="bamfile" value="bowtie2-test1.bam" ftype="bam" /> + </repeat> + <param name="fragmentLength" value="200" /> + <param name="showAdvancedOpt" value="no" /> + <param name="showOutputSettings" value="no" /> + <output name="outFileName" file="bamFingerprint_result1.png" ftype="png" compare="sim_size" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** This tool is useful to assess the strength of a ChIP (i.e. how clearly the enrichment signal can be separated from the background signal) @@ -146,7 +145,7 @@ ----- @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool> |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 bamPEFragmentSize.xml --- a/bamPEFragmentSize.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/bamPEFragmentSize.xml Tue Oct 20 14:43:12 2015 -0400 |
| [ |
| @@ -1,27 +1,22 @@ <tool id="deeptools_bamPEFragmentSize" name="bamPEFragmentSize" version="@WRAPPER_VERSION@.0"> - <description>Given a BAM file it samples several regions to estimate the paird-end fragment length</description> - <expand macro="requirements" /> - <expand macro="stdio" /> + <description>Given a BAM file it samples several regions to estimate the paired-end fragment length</description> <macros> <token name="@BINARY@">bamPEFragmentSize</token> <import>deepTools_macros.xml</import> </macros> + <expand macro="requirements" /> <command> <![CDATA[ bamPEFragmentSize - - @THREADS@ - - --bam '$bamInput' - --bamIndex ${bamInput.metadata.bam_index} - #if $histogram: - --histogram $histogram_outfile - #end if - > $outfile - + @THREADS@ + -bai ${bamInput.metadata.bam_index} + #if $histogram: + --histogram ./hist.png + #end if + '$bamInput' + > $outfile ]]> </command> - <inputs> <param name="bamInput" format="bam" type="data" label="BAM file" help="The BAM file must be sorted."/> @@ -30,13 +25,21 @@ help="(--histogram)"/> </inputs> <outputs> - <data format="txt" name="outfile" label="${tool.name} on ${on_string}" /> - <data name="histogram_outfile" format="tabular" from_work_dir="quant_bias_corrected.sf" label="${tool.name} on ${on_string} (Bias corrected Quantification)"> - <filter>histogram == '--histogram'</filter> + <data name="outfile" format="txt"/> + <data name="histogram_outfile" from_work_dir="hist.png" format="png"> + <filter>histogram is True</filter> </data> </outputs> + <tests> + <test> + <param name="bamInput" value="bowtie2-test1.bam" ftype="bam" /> + <param name="histogram" value="True" /> + <output name="outfile" file="bamPEFragmentSize_result1.txt" ftype="txt" /> + <output name="histogram_outfile" file="bamPEFragmentSize_histogram_result1.png" ftype="png" compare="sim_size" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** Given a BAM file it samples several regions to estimate the paird-end fragment length. @@ -44,7 +47,7 @@ ----- @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool> |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 bigwigCompare.xml --- a/bigwigCompare.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/bigwigCompare.xml Tue Oct 20 14:43:12 2015 -0400 |
| [ |
| @@ -1,12 +1,12 @@ <tool id="deeptools_bigwigCompare" name="bigwigCompare" version="@WRAPPER_VERSION@.0"> <description>normalizes and compares two bigWig files to obtain the ratio, log2ratio or difference</description> - <expand macro="requirements"/> - <expand macro="stdio" /> <macros> <token name="@BINARY@">bigwigCompare</token> <import>deepTools_macros.xml</import> </macros> + <expand macro="requirements"/> <command> +<![CDATA[ bigwigCompare @THREADS@ @@ -17,9 +17,9 @@ --outFileName '$outFileName' --outFileFormat '$outFileFormat' - --ratio $comparison.type + --ratio $comparison.comparison_select - #if $comparison.type in ['ratio','log2']: + #if $comparison.comparison_select in ['ratio','log2']: --pseudocount $comparison.pseudocount #end if @@ -33,21 +33,28 @@ --scaleFactors '$advancedOpt.scaleFactor1:$advancedOpt.scaleFactor2' --binSize $advancedOpt.binSize + #if $advancedOpt.plotTitle and str($advancedOpt.plotTitle.value) != "": + --plotTitle '$advancedOpt.plotTitle' + #end if + #end if +]]> </command> <inputs> <param name="bigwigFile1" format="bigwig" type="data" label="Treatment bigwig file" /> <param name="bigwigFile2" format="bigwig" type="data" label="bigWig file" /> - <conditional name="comparison"> - <param name="type" type="select" - label="How to compare the two files"> + <param name="comparison_select" type="select" + label="How to compare the two files" + help="The default is to output the log2ratio between the two samples. + The reciprocal ratio returns the negative of the inverse of the ratio if + the ratio is less than 0. The resulting values are interpreted as negative fold changes. (--ratio)"> <option value="log2" selected="true">compute log2 of the number of reads ratio</option> <option value="ratio">compute the ratio of the number of reads</option> <option value="subtract">compute difference (subtract input from treatment) of the number of reads</option> <option value="add">compute the sum over all reads</option> - <option value="reciprocal_ratio">compute the reciprocal ratio of the number of reads</option> + <option value="reciprocal_ratio">Computes the fold change. If the fold change is less than 1, the negative of the inverse is reported. E.g. A fold change of 10 to 5 would be reported not as 0.5 but as -2</option> </param> <when value="log2"> <expand macro="pseudocount" /> @@ -57,7 +64,9 @@ </when> <when value="subtract" /> <when value="add" /> - <when value="reciprocal_ratio" /> + <when value="reciprocal_ratio"> + <expand macro="pseudocount" /> + </when> </conditional> <param name="outFileFormat" type="select" label="Coverage file format"> @@ -75,29 +84,54 @@ <when value="no" /> <when value="yes"> <param name="binSize" type="integer" value="50" min="1" - label="Bin size in bp" - help="Size of the bins in bp for the output of the bigwig/bedgraph file "/> - + label="Length, in base pairs, of the non-overlapping bin for averaging the score over the regions length" + help="Size of the bins in bp for the output of the bigwig/bedgraph file. (--binSize)"/> <param name="missingDataAsZero" type="boolean" truevalue="yes" falsevalue="no" checked="True" label ="Treat missing data as zero" - help ="This parameter determines if missing data should be replaced with a zero. If set to "no", missing data will be ignored and will not be included in the output file at all. Missing data is defined as those regions for which no value exists in *any* of the bigwig files. The decision to include or exclude missing data depends on the interpretation of the data. Missing data in a bigwig file may mean that there is no information available for certain regions, for example a repetitive region that is not being considered. In the same file regions with low coverage may get zero read counts. If missing data is replaced by zero, this would convert the excluded repetitive regions into regions of low coverage." /> - - <param name="scaleFactor1" type="float" value="1" label="Scale factor for treatment"/> - <param name="scaleFactor2" type="float" value="1" label="Scale factor for input"/> + help ="This parameter determines if missing data should be replaced with a zero. + If set to "no", missing data will be ignored and will not be included in the + output file at all. Missing data is defined as those regions for which no value exists in + *any* of the bigwig files. The decision to include or exclude missing data depends on + the interpretation of the data. Missing data in a bigwig file may mean that there is no + information available for certain regions, for example a repetitive region that is not + being considered. In the same file regions with low coverage may get zero read counts. + If missing data is replaced by zero, this would convert the excluded repetitive regions + into regions of low coverage. (--missingDataAsZero)" /> + <expand macro="scaleFactor" /> + <expand macro="plotTitle" /> </when> </conditional> </inputs> <outputs> <data format="bigwig" name="outFileName"> - <change_format> - <when input="outFileFormat" value="bigwig" format="bigwig" /> - <when input="outFileFormat" value="bedgraph" format="bedgraph" /> - </change_format> + <change_format> + <when input="outFileFormat" value="bigwig" format="bigwig" /> + <when input="outFileFormat" value="bedgraph" format="bedgraph" /> + </change_format> </data> </outputs> - - <help> - + <tests> + <test> + <param name="bigwigFile1" value="test.bw" ftype="bigwig" /> + <param name="bigwigFile2" value="test.bw" ftype="bigwig" /> + <param name="showAdvancedOpt" value="no" /> + <param name="outFileFormat" value="bigwig" /> + <param name="binSize" value="5" /> + <param name="comparison_select" value="ratio" /> + <output name="outFileName" file="bigwigCompare_result1.bw" ftype="bigwig" /> + </test> + <test> + <param name="bigwigFile1" value="test.bw" ftype="bigwig" /> + <param name="bigwigFile2" value="test.bw" ftype="bigwig" /> + <param name="showAdvancedOpt" value="no" /> + <param name="outFileFormat" value="bedgraph" /> + <param name="binSize" value="10" /> + <param name="comparison_select" value="ratio" /> + <output name="outFileName" file="bigwigCompare_result2.bg" ftype="bedgraph" /> + </test> + </tests> + <help> +<![CDATA[ **What it does** This tool compares two bigwig files based on the number of mapped reads. To @@ -110,7 +144,7 @@ ----- @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool> |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 bigwigCorrelate.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bigwigCorrelate.xml Tue Oct 20 14:43:12 2015 -0400 |
| [ |
| @@ -0,0 +1,184 @@ +<tool id="deeptools_bigwigCorrelate" name="bigwigCorrelate" version="@WRAPPER_VERSION@.0"> + <description>correlates pairs of BigWig files</description> + <macros> + <token name="@BINARY@">bigwigCorrelate</token> + <import>deepTools_macros.xml</import> + </macros> + <expand macro="requirements" /> + <command> +<![CDATA[ + #set files=[] + #set labels=[] + + @multiple_input_bigwigs@ + + bigwigCorrelate + + $mode.modeOpt + + @THREADS@ + + --bwfiles '#echo "' '".join($files)#' + --labels '#echo "' '".join($labels)#' + #if $filterPercentile: + --filterPercentile $filterPercentile + #end if + --corMethod $corMethod + + --plotFile $outFileName + + #if $output.showOutputSettings == "yes" + --outRawCounts '$outFileRawCounts' + --outFileCorMatrix '$outFileCorMatrix' + --plotFileFormat '$output.outFileFormat' + #else: + --plotFileFormat 'png' + #end if + + #if $mode.modeOpt == "bins": + --binSize '$mode.binSize' + #else: + --BED $mode.region_file + #end if + + #### options available in both modes + #if str($region.value) != '': + --region '$region' + #end if + + #if $advancedOpt.showAdvancedOpt == "yes": + + $advancedOpt.includeZeros + + #if $advancedOpt.zMin: + --zMin $advancedOpt.zMin + #end if + #if $advancedOpt.zMax: + --zMax $advancedOpt.zMax + #end if + --colorMap '$advancedOpt.colorMap' + + #if $plotTitle and str($plotTitle).strip() != "": + --plotTitle '$plotTitle' + #end if + $plotNumbers + + #end if +]]> + </command> + + <inputs> + <expand macro="multiple_input_bigwigs" /> + + <param name="filterPercentile" type="float" optional="True" value="" min="0.0" max="100.0" + label="Percentile used to filter out extreme outliers" + help ="If not specified, it is automatically set to 99.9 in analyses + using Pearson correlation! This means that values + above that threshold, which consistently occur in all + datasets, will not be taken into account for the + correlation analysis. This behavior can be overridden + by a user specified value from within the 0.0 to 100.0 + range. (--filterPercentile)"/> + + <param name="corMethod" type="select" label="Correlation method" help="(--corMethod)"> + <option value="spearman" selected="True">Spearman</option> + <option value="pearson">Pearson</option> + </param> + + <conditional name="mode"> + <param name="modeOpt" type="select" label="Choose computation mode" + help="In the bins mode, the correlation is computed based on equal length bins. + In the BED file mode, as list of genomic regions in BED format has to be given. + For each region in the BED file the number of overlapping reads is counted in + each of the BAM files. Then the correlation is computed."> + <option value="bins" selected="true">Bins</option> + <option value="BED-file">Limit correlation to certain regions (BED file)</option> + </param> + <when value="bins"> + <param name="binSize" type="integer" value="10000" min="1" + label="Bin size in bp" + help="Length in base pairs for a window used to sample the genome. (--binSize)"/> + </when> + <when value="BED-file"> + <param name="region_file" type="data" format="bed" + label="Region file in BED format" + help="Correlation is computed for the number of reads that overlap such regions."/> + </when> + </conditional> + + <expand macro="bigwigCorrelate_mode_actions" /> + <conditional name="output"> + <param name="showOutputSettings" type="select" label="Show advanced output settings" > + <option value="no" selected="true">no</option> + <option value="yes">yes</option> + </param> + <when value="no" /> + <when value="yes"> + <expand macro="input_image_file_format"/> + <param name="saveRawCounts" type="boolean" label="Save the bin counts"/> + <param name="saveCorMatrix" type="boolean" label="Save the correlation matrix"/> + </when> + </conditional> + + </inputs> + <outputs> + <expand macro="output_image_file_format" /> + <data format="tabular" name="outFileRawCounts" label="${tool.name} on ${on_string}: bin counts"> + <filter> + (( + output['showOutputSettings'] == 'yes' and + output['saveRawCounts'] is True + )) + </filter> + </data> + <data format="tabular" name="outFileCorMatrix" label="${tool.name} on ${on_string}: correlation matrix"> + <filter> + (( + output['showOutputSettings'] == 'yes' and + output['saveCorMatrix'] is True + )) + </filter> + </data> + </outputs> + <tests> + <test> + <repeat name="input_files"> + <param name="bigwigfile" value="test.bw" ftype="bigwig" /> + <param name="label" value="first bigwig file" /> + </repeat> + <repeat name="input_files"> + <param name="bigwigfile" value="test.bw" ftype="bigwig" /> + <param name="label" value="second bigwig file" /> + </repeat> + <param name="modeOpt" value="bins" /> + <param name="binSize" value="10" /> + <param name="showOutputSettings" value="no" /> + <param name="corMethod" value="spearman" /> + <output name="outFileName" file="bigwigCorrelate_result1.png" ftype="png" compare="sim_size" /> + </test> + </tests> + <help> +<![CDATA[ +**What it does** + +bigwigCorrelate computes the overall similarity between two or more bigWig +files based on coverage means of genomic regions. The correlation analysis +is performed for the entire genome by running the program in 'bins' mode, +or for certain regions only in 'BED-file' mode. Pearson or Spearman analyses +are available to compute correlation coefficients. Results are saved to a +heat map file. Further output files are optional. + + +**Output files**: + +- **diagnostic plot**: clustered heatmap displaying the values for each pair-wise correlation +- data matrix (optional): if you want to plot the correlation values using a different program, e.g. R, this matrix can be used + + +----- + +@REFERENCES@ +]]> + </help> + <expand macro="citations" /> +</tool> |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 computeGCBias.xml --- a/computeGCBias.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/computeGCBias.xml Tue Oct 20 14:43:12 2015 -0400 |
| [ |
| @@ -1,12 +1,12 @@ <tool id="deeptools_computeGCBias" name="computeGCBias" version="@WRAPPER_VERSION@.0"> <description>to see whether your samples should be normalized for GC bias</description> - <expand macro="requirements" /> - <expand macro="stdio" /> <macros> <token name="@BINARY@">computeGCBias</token> <import>deepTools_macros.xml</import> </macros> + <expand macro="requirements" /> <command> +<![CDATA[ ln -s $bamInput local_bamInput.bam; ln -s $bamInput.metadata.bam_index local_bamInput.bam.bai; @@ -30,7 +30,6 @@ #end if #if $advancedOpt.showAdvancedOpt == "yes": - --sampleSize '$advancedOpt.sampleSize' --regionSize '$advancedOpt.regionSize' @@ -47,6 +46,7 @@ --biasPlot $outImageName --plotFileFormat $image_format #end if +]]> </command> <inputs> <param name="bamInput" format="bam" type="data" label="BAM file" @@ -54,11 +54,7 @@ <expand macro="reference_genome_source" /> <expand macro="effectiveGenomeSize" /> - - <param name="fragmentLength" type="integer" value="300" min="1" - label="Fragment length used for the sequencing" - help ="If paired-end reads are used, the fragment length is computed from the BAM file."/> - + <expand macro="fragmentLength" /> <expand macro="region_limit_operation" /> <conditional name="advancedOpt"> @@ -69,21 +65,28 @@ <when value="no" /> <when value="yes"> <param name="sampleSize" type="integer" value="50000000" min="1" - label="Number of sampling points to be considered" /> - + label="Number of sampling points to be considered" help="(--sampleSize)" /> <param name="regionSize" type="integer" value="300" min="1" label="Region size" - help ="To plot the reads per GC over a region, the size of the region is required (see below for more details of the mthod). By default, the bin size is set to 300 bp, which is close to the standard fragment size many sequencing applications. However, if the depth of sequencing is low, a larger bin size will be required, otherwise many bins will not overlap with any read."/> - + help ="To plot the reads per GC over a region, the size of the region is + required (see below for more details of the mthod). By default, the bin size + is set to 300 bp, which is close to the standard fragment size many sequencing + applications. However, if the depth of sequencing is low, a larger bin size will + be required, otherwise many bins will not overlap with any read. (--regionSize)"/> <param name="filterOut" type="data" format="bed" optional="true" label="BED file containing genomic regions to be excluded from the estimation of the correction" - help="Such regions usually contain repetitive regions and peaks that if included will bias the correction. It is recommended to filter out known repetitive regions if multi-reads (reads that map to more than one genomic position) were excluded. In the case of ChIP-seq data, it is recommended to first use a peak caller to identify and filter out the identified peaks." /> + help="Such regions usually contain repetitive regions and peaks that if included will + bias the correction. It is recommended to filter out known repetitive regions if multi-reads + (reads that map to more than one genomic position) were excluded. In the case of ChIP-seq data, + it is recommended to first use a peak caller to identify and filter out the identified peaks. (--filterOut)" /> <param name="extraSampling" type="data" format="bed" optional="true" label="BED file containing genomic regions for which extra sampling is required because they are underrepresented in the genome" - help="" /> + help="(--extraSampling)" /> </when> </conditional> - <param name="image_format" type="select" label="GC bias plot" help="If given, a diagnostic image summarizing the GC bias found on the sample will be created."> + <param name="image_format" type="select" + label="GC bias plot" + help="If given, a diagnostic image summarizing the GC bias found on the sample will be created. (--plotFileFormat)"> <option value="none">No image</option> <option value="png" selected="true">Image in png format</option> <option value="pdf">Image in pdf format</option> @@ -93,8 +96,8 @@ </param> </inputs> <outputs> - <data format="tabular" name="outFileName" /> - <data format="png" name="outImageName" label="${tool.name} GC-bias Plot"> + <data name="outFileName" format="tabular" /> + <data name="outImageName" format="png" label="${tool.name} GC-bias Plot"> <filter> (( image_format != 'none' @@ -108,8 +111,25 @@ </change_format> </data> </outputs> + <tests> + <test> + <param name="bamInput" value="paired_chr2L.bam" ftype="bam" /> + <param name="image_format" value="png" /> + <param name="showAdvancedOpt" value="yes" /> + <param name="regionSize" value="1" /> + <param name="fragmentLength" value="100" /> + <param name="ref_source" value="history" /> + <param name="input1" value="sequence.2bit" /> + <param name="sampleSize" value="10" /> + <param name="effectiveGenomeSize_opt" value="specific" /> + <param name="effectiveGenomeSize" value="23011544" /> + <param name="region" value="chr2L" /> + <param name="image_format" value="none" /> + <output name="outFileName" file="computeGCBias_result1.tabular" ftype="tabular" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** This tool computes the GC bias using the method proposed by Benjamini and Speed (2012) Nucleic Acids Res. (see below for more explanations) @@ -150,7 +170,7 @@ ----- @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool> |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 computeMatrix.xml --- a/computeMatrix.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/computeMatrix.xml Tue Oct 20 14:43:12 2015 -0400 |
| [ |
| b'@@ -1,197 +1,262 @@\n <tool id="deeptools_computeMatrix" name="computeMatrix" version="@WRAPPER_VERSION@.0">\n- <description>summarizes and prepares an intermediary file containing scores associated with genomic regions that can be used afterwards to plot a heatmap or a profile</description>\n- <expand macro="requirements" />\n- <expand macro="stdio" />\n+ <description>preparation step to plot a heatmap or a profile</description>\n <macros>\n <token name="@BINARY@">computeMatrix</token>\n <import>deepTools_macros.xml</import>\n </macros>\n+ <expand macro="requirements" />\n <command>\n+<![CDATA[\n #import tempfile\n \n- #set $temp_input_handle = tempfile.NamedTemporaryFile()\n- #set $temp_input_path = $temp_input_handle.name\n- #silent $temp_input_handle.close()\n+ #for $rf in $regionsFiles:\n+ cat "$rf.regionsFile" >> ./temp_input_path;\n+ #if str($rf.label.value).strip():\n+ echo "\\#$rf.label.value" >> ./temp_input_path;\n+ #else:\n+ echo "\\#$rf.regionsFile.name" >> ./temp_input_path;\n+ #end if\n+ #end for\n \n- #for $rf in $regionsFiles:\n- cat "$rf.regionsFile" >> $temp_input_path;\n- #if str($rf.label.value).strip():\n- echo "\\#$rf.label.value" >> $temp_input_path;\n- #else:\n- echo "\\#$rf.regionsFile.name" >> $temp_input_path;\n- #end if\n- #end for\n+ computeMatrix\n \n+ $mode.mode_select\n+ --regionsFileName ./temp_input_path\n+ --scoreFileName \'$scoreFile\'\n+ --outFileName \'$outFileName\'\n \n- computeMatrix\n+ @THREADS@\n \n- $mode.mode_select\n- --regionsFileName \'$temp_input_path\'\n- --scoreFileName \'$scoreFile\'\n- --outFileName \'$outFileName\'\n+ #if $output.showOutputSettings == "yes"\n+ #if $output.saveData:\n+ --outFileNameData \'$outFileNameData\' \n+ #end if\n+ #if $output.saveMatrix:\n+ --outFileNameMatrix \'$outFileNameMatrix\'\n+ #end if\n \n- @THREADS@\n+ #if $output.saveSortedRegions:\n+ --outFileSortedRegions \'$outFileSortedRegions\'\n+ #end if\n+ #end if\n \n- #if $output.showOutputSettings == "yes"\n- #if $output.saveData:\n- --outFileNameData \'$outFileNameData\' \n- #end if\n- #if $output.saveMatrix:\n- --outFileNameMatrix \'$outFileNameMatrix\'\n- #end if\n-\n- #if $output.saveSortedRegions:\n- --outFileSortedRegions \'$outFileSortedRegions\'\n- #end if\n- #end if\n+ #if $mode.mode_select == "reference-point":\n+ --referencePoint $mode.referencePoint\n+ $mode.nanAfterEnd\n+ --beforeRegionStartLength $mode.beforeRegionStartLength\n+ --afterRegionStartLength $mode.afterRegionStartLength\n+ #else\n+ --regionBodyLength $mode.regionBodyLength\n+ --startLabel "$mode.startLabel"\n+ --endLabel "$mode.endLabel"\n+ #if $mode.regionStartLength.regionStartLength_select == "yes":\n+ --beforeRegionStartLength $mode.regionStartLength.beforeRegionStartLength\n+ --afterRegionStartLength $mode.regionStartLength.afterRegionStartLength\n+ #end if\n+ #end if\n \n- #if $mode.mode_select == "reference-point":\n- --referencePoint $mode.referencePoint\n- $mode.nanAfterEnd\n- --beforeRegionStartLength $mode.beforeRegionStartLength\n- --afterRegionStartLength $mode.afterRegionStartLength\n- #else\n- --regionBodyLength $mode.regionBodyLength\n- --startLabel "$mode.startLabel"\n- --endLabel "$mode.endLabel"\n- #if $mode.regionStartLength.regionStartLength_select == "yes":\n- --beforeRegionStartLength $mode.regionStartLength.beforeRegionStartLength\n- --afterRegionStartLength $mode.regionStartLength.afterRegionStartLeng'..b's of zero should be included or not.\n+ Default is to include them. (--skipZeros)"/>\n+ <param name="minThreshold" type="float" optional="True"\n+ label="Minimum threshold"\n+ help="Any region containing a value that is equal or less than this numeric\n+ value will be skipped. This is useful to skip, for example, genes where the\n+ read count is zero for any of the bins. This could be the result of\n+ unmappable areas and can bias the overall results. (--minThreshold)"/>\n+ <param name="maxThreshold" type="float" optional="True"\n+ label="Maximum threshold"\n+ help="Any region containing a value that is equal or higher that this\n+ numeric value will be skipped. The max threshold is useful to skip those\n+ few regions with very high read counts (e.g. major satellites) that may\n+ bias the average values. (--maxThreshold)"/>\n+ <param name="scale" type="float" optional="True" label="Scaling factor"\n+ help="If set, all values are multiplied by this number. (--scale)"/>\n+ </when>\n+ </conditional>\n </inputs>\n- <outputs>\n- <data format="bgzip" name="outFileName" label="${tool.name} on ${on_string}: Matrix" />\n- <expand macro="output_graphic_outputs" />\n- <expand macro="output_save_matrix_values" />\n- </outputs>\n+ <outputs>\n+ <data format="deeptools_compute_matrix_archive" name="outFileName" label="${tool.name} on ${on_string}: Matrix" />\n+ <expand macro="output_graphic_outputs" />\n+ <expand macro="output_save_matrix_values" />\n+ </outputs>\n <!--\n computeMatrix -S test.bw -R test2.bed -a 100 -b 100 -bs 1 \n -->\n <tests>\n <test>\n- <param name="regionsFile" value="test2.bed" ftype="bed" />\n- <param name="scoreFile" value="test.bw" ftype="bigwig" />\n- <param name="advancedOpt.binSize" value="1" />\n- <param name="mode.beforeRegionStartLength" value="100" />\n- <param name="mode.afterRegionStartLength" value="100" />\n- <output name="outFileName" file="master.mat.gz" ftype="bgzip" compare="sim_size" delta="100" />\n+ <param name="regionsFile" value="computeMatrix1.bed" ftype="bed" />\n+ <param name="scoreFile" value="bamCoverage_result4.bw" ftype="bigwig" />\n+ <param name="showAdvancedOpt" value="yes" />\n+ <param name="mode_select" value="reference-point" />\n+ <param name="binSize" value="10" />\n+ <param name="sortUsing" value="sum" />\n+ <param name="averageTypeBins" value="sum" />\n+ <param name="missingDataAsZero" value="True" />\n+ <param name="beforeRegionStartLength" value="10" />\n+ <param name="afterRegionStartLength" value="10" />\n+ <output name="outFileName" file="computeMatrix_result1.gz" ftype="deeptools_compute_matrix_archive" compare="sim_size" />\n+ </test>\n+ <test>\n+ <param name="regionsFile" value="computeMatrix2.bed" ftype="bed" />\n+ <param name="scoreFile" value="computeMatrix2.bw" ftype="bigwig" />\n+ <param name="showAdvancedOpt" value="yes" />\n+ <param name="mode_select" value="reference-point" />\n+ <param name="binSize" value="10" />\n+ <param name="beforeRegionStartLength" value="10" />\n+ <param name="afterRegionStartLength" value="10" />\n+ <output name="outFileName" file="computeMatrix_result2.gz" ftype="deeptools_compute_matrix_archive" compare="sim_size" />\n </test>\n </tests>\n <help>\n-\n+<![CDATA[\n **What it does**\n \n This tool prepares an intermediary file (a gzipped table of values)\n@@ -217,7 +282,7 @@\n -----\n \n @REFERENCES@\n-\n+]]>\n </help>\n <expand macro="citations" />\n </tool>\n' |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 correctGCBias.xml --- a/correctGCBias.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/correctGCBias.xml Tue Oct 20 14:43:12 2015 -0400 |
| [ |
| @@ -1,92 +1,60 @@ <tool id="deeptools_correctGCBias" name="correctGCBias" version="@WRAPPER_VERSION@.0"> <description>uses the output from computeGCBias to generate corrected BAM files</description> - <expand macro="requirements" /> - <expand macro="stdio" /> <macros> <token name="@BINARY@">correctGCBias</token> <import>deepTools_macros.xml</import> </macros> + <expand macro="requirements" /> <command> - #import tempfile - #set $temp_dir = os.path.abspath(tempfile.mkdtemp()) - - #set $temp_bam_handle = tempfile.NamedTemporaryFile( dir=$temp_dir ) - #set $temp_bam_path = $temp_bam_handle.name + '.bam' - #silent $temp_bam_handle.close() - #silent os.system("ln -s %s %s" % (str($bamInput), $temp_bam_path)) - #silent os.system("ln -s %s %s.bai" % (str($bamInput.metadata.bam_index), $temp_bam_path)) - +<![CDATA[ + ln -s $bamInput local_bamInput.bam; + ln -s $bamInput.metadata.bam_index local_bamInput.bam.bai; correctGCBias - - @THREADS@ - - --bamfile '$temp_bam_path' - --GCbiasFrequenciesFile $GCbiasFrequenciesFile + @THREADS@ + --bamfile local_bamInput.bam + --GCbiasFrequenciesFile $GCbiasFrequenciesFile - @reference_genome_source@ - - - #if $effectiveGenomeSize.effectiveGenomeSize_opt == "specific": - --effectiveGenomeSize $effectiveGenomeSize.effectiveGenomeSize - #else: - --effectiveGenomeSize $effectiveGenomeSize.effectiveGenomeSize_opt - #end if + @reference_genome_source@ - #if str($region).strip() != '': - --region '$region' - #end if + #if $effectiveGenomeSize.effectiveGenomeSize_opt == "specific": + --effectiveGenomeSize $effectiveGenomeSize.effectiveGenomeSize + #else: + --effectiveGenomeSize $effectiveGenomeSize.effectiveGenomeSize_opt + #end if - #if $advancedOpt.showAdvancedOpt == "yes": - --binSize '$advancedOpt.binSize' - #end if + #if str($region).strip() != '': + --region '$region' + #end if + --correctedFile corrected.bam; - ###set newoutFileName="corrected."+str($outFileFormat) - ##--correctedFile $newoutFileName; - --correctedFile "corrected.bam"; - - ##mv $newoutFileName $outFileName - mv "corrected.bam" $outFileName + mv corrected.bam $outFileName; +]]> </command> <inputs> <param name="GCbiasFrequenciesFile" type="data" format="tabular" label="Output of computeGCBias" /> - <param name="bamInput" format="bam" type="data" label="BAM file" help="This should be same file that was used for computeGCbias. The BAM file must be sorted."/> + <param name="bamInput" format="bam" type="data" + label="BAM file" help="This should be same file that was used for computeGCbias. The BAM file must be sorted. (--bamfile)" /> <expand macro="reference_genome_source" /> <expand macro="effectiveGenomeSize" /> - - <!-- - <param name="outFileFormat" type="select" label="File format of the output"> - <option value="bam">bam</option> - <option value="bw">bigwig</option> - <option value="bg">bedgraph</option> - </param> - --> <expand macro="region_limit_operation" /> - - <conditional name="advancedOpt"> - <param name="showAdvancedOpt" type="select" label="Show advanced options" > - <option value="no" selected="true">no</option> - <option value="yes">yes</option> - </param> - <when value="no" /> - <when value="yes"> - <param name="binSize" type="integer" value="50" min="1" - label="Bin size in bp" - help="Size of the bins in bp for the output of the bigwig/bedgraph file."/> - </when> - </conditional> </inputs> <outputs> - <data format="bam" name="outFileName"> - <!--<change_format> - <when input="outFileFormat" value="bw" format="bigwig" /> - <when input="outFileFormat" value="bam" format="bam" /> - <when input="outFileFormat" value="bg" format="bedgraph" /> - </change_format>--> - </data> + <data format="bam" name="outFileName" /> </outputs> + <tests> + <test> + <param name="GCbiasFrequenciesFile" value="computeGCBias_result1.tabular" ftype="tabular" /> + <param name="bamInput" value="paired_chr2L.bam" ftype="bam" /> + <param name="ref_source" value="history" /> + <param name="input1" value="sequence.2bit" /> + <param name="effectiveGenomeSize_opt" value="specific" /> + <param name="effectiveGenomeSize" value="23011544" /> + <output name="outFileName" file="correctGCBias_result1.bam" ftype="bam" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** This tool requires the output from computeGCBias to correct a given BAM file according to the method proposed by @@ -103,7 +71,7 @@ ----- @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool> |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 datatypes_conf.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/datatypes_conf.xml Tue Oct 20 14:43:12 2015 -0400 |
| b |
| @@ -0,0 +1,6 @@ +<?xml version="1.0"?> +<datatypes> + <registration> + <datatype extension="deeptools_compute_matrix_archive" type="galaxy.datatypes.binary:CompressedArchive" subclass="True" display_in_upload="True"/> + </registration> +</datatypes> |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 deepTools_macros.xml --- a/deepTools_macros.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/deepTools_macros.xml Tue Oct 20 14:43:12 2015 -0400 |
| [ |
| b'@@ -10,57 +10,67 @@\n </param>\n <when value="no" />\n <when value="yes">\n- <param name="doNotExtendPairedEnds" type="boolean" truevalue="--doNotExtendPairedEnds" falsevalue=""\n- label="Do not extend paired ends"\n- help="If set, reads are not extended to match the fragment length reported in the BAM file, instead they will be extended to match the fragment length. Default is to extend the reads if paired end information is available."/>\n-\n- <param name="ignoreDuplicates" type="boolean" truevalue="--ignoreDuplicates" falsevalue=""\n- label="Ignore duplicates"\n- help="If set, reads that have the same orientation and start position will be considered only once. If reads are paired, the mate position also has to coincide to ignore a read." /> \n-\n- <param name="minMappingQuality" type="integer" optional="true" value="1" min="1"\n- label="Minimum mapping quality"\n- help= "If set, only reads that have a mapping quality score higher than the given value are considered. *Note* Bowtie\'s Mapping quality is related to uniqueness: the higher the score, the more unique is a read. A mapping quality defined by Bowtie of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere."/>\n-\n- <param name="includeZeros" type="boolean" truevalue="--includeZeros" falsevalue=""\n- label ="Include zeros"\n- help ="If set, then regions with zero counts for *all* BAM files given are included. The default behavior is to ignore those cases." />\n-\n- <param name="zMin" type="integer" value="" optional="true" label="Minimum value for the heatmap intensities"\n- help="If not specified the value is set automatically."/>\n-\n- <param name="zMax" type="integer" value="" optional="true" label="Maximum value for the heatmap intensities"\n- help="If not specified the value is set automatically."/>\n-\n+ <expand macro="doNotExtendPairedEnds" />\n+ <expand macro="ignoreDuplicates" />\n+ <expand macro="minMappingQuality" />\n+ <expand macro="includeZeros" />\n+ <expand macro="zMin_zMax" />\n <expand macro="colormap" />\n </when>\n </conditional>\n </xml>\n \n+\n+ <xml name="bigwigCorrelate_mode_actions">\n+\n+ <expand macro="region_limit_operation" />\n+\n+ <conditional name="advancedOpt">\n+ <param name="showAdvancedOpt" type="select" label="Show advanced options" >\n+ <option value="no" selected="true">no</option>\n+ <option value="yes">yes</option>\n+ </param>\n+ <when value="no" />\n+ <when value="yes">\n+ <expand macro="includeZeros" />\n+ <expand macro="zMin_zMax" />\n+ <expand macro="colormap" />\n+ <expand macro="plotTitle" />\n+ <expand macro="plotNumbers" />\n+ </when>\n+ </conditional>\n+ </xml>\n+\n+\n+ <xml name="includeZeros">\n+ <param name="includeZeros" type="boolean" truevalue="--includeZeros" falsevalue=""\n+ label="Include zeros"\n+ help="If set, then regions with zero counts for *all* BAM files given are included. The default behavior is to ignore those cases. (--includeZeros)" />\n+ </xml>\n+ <xml name="zMin_zMax">\n+ <param name="zMin" type="integer" value="" optional="true" label="Minimum value for the heatmap intensities"\n+ help="If not specified the value is set automatically. (--zMin)"/>\n+ <param name="zMax" type="integer" value="" optional="true" label="Maximum value for the heatmap intensities"\n+ help="If not specified the value is set automatically. (--zMax)"/>\n+ </'..b'\n <param name="pseudocount" type="float" value="1" label="Pseudocount" help="Small number to avoid dividing by zero."/>\n </xml>\n+\n <token name="@REFERENCES@">\n \n .. class:: infomark\n@@ -126,11 +183,6 @@\n .. _Max Planck Institute for Immunobiology and Epigenetics: http://www3.ie-freiburg.mpg.de\n .. _help site: https://github.com/fidelram/deepTools/wiki/\n \n-**References**\n-\n-If you use this Galaxy tool in work leading to a scientific publication please\n-cite the following paper:\n-\n </token>\n <xml name="citations">\n <citations>\n@@ -140,36 +192,46 @@\n </xml>\n \n <xml name="multiple_input_bams">\n- <repeat name="input_files" title="BAM files" min="2">\n- <param name="bamfile" type="data" format="bam" \n- label="Bam file" \n- help="The BAM file must be sorted."/>\n- <param name="label" type="text" size="30" optional="true" value=""\n- label="Label"\n- help="Label to use in the output. If not given the dataset name will be used instead."/>\n- </repeat>\n+ <param name="bamfiles" type="data" format="bam"\n+ label="Bam file" multiple="true"\n+ help="The BAM file must be sorted."/>\n+ </xml>\n+\n+ <xml name="multiple_input_bigwigs">\n+ <param name="bigwigfiles" type="data" format="bigwig" multiple="True"\n+ label="Bigwig file" \n+ help="The Bigwig file must be sorted."/>\n+ </xml>\n+\n+ <xml name="plotTitle">\n+ <param name="plotTitle" type="text" value="" size="30" optional="True"\n+ label="Title of the plot"\n+ help="Title of the plot, to be printed on top of the generated image. (--plotTitle)" />\n </xml>\n \n <token name="@multiple_input_bams@">\n- #import tempfile\n- #set $temp_dir = os.path.abspath(tempfile.mkdtemp())\n+<![CDATA[\n #set files=[]\n #set labels=[]\n- #for $i in $input_files:\n- #set $temp_input_handle = tempfile.NamedTemporaryFile( dir=$temp_dir )\n- #set $temp_input_path = $temp_input_handle.name\n- #silent $temp_input_handle.close()\n- #silent os.system("ln -s %s %s.bam" % (str($i.bamfile), $temp_input_path))\n- #silent os.system("ln -s %s %s.bam.bai" % (str($i.bamfile.metadata.bam_index), $temp_input_path))\n- #silent $files.append(\'%s.bam\' % $temp_input_path)\n+ #for $counter, $bamfile in enumerate($bamfiles):\n+ ln -s "${bamfile}" "./${counter}.bam" &&\n+ ln -s "${bamfile.metadata.bam_index}" "./${counter}.bam.bai" &&\n+ #silent $files.append(\'%s.bam\' % $counter)\n+ #silent $labels.append("\'%s\'" % ($bamfile.display_name))\n+ #end for\n+]]>\n+ </token>\n \n- ##set $files += [str($i.bamfile)]\n- #if str($i.label.value) != "":\n- #set $labels += ["\\"%s\\"" % ($i.label.value)]\n- #else\n- #set $labels += ["\\"%s\\"" % ($i.bamfile.name)]\n- #end if\n+ <token name="@multiple_input_bigwigs@">\n+<![CDATA[\n+ #set files=[]\n+ #set labels=[]\n+ #for $counter, $bigwig in enumerate($bigwigfiles):\n+ ln -s "${bigwig}" "${counter}.bw" &&\n+ #silent $files.append(\'%s.bw\' % $counter)\n+ #silent $labels.append("\'%s\'" % ($bigwig.display_name))\n #end for\n+]]>\n </token>\n \n <xml name="reference_genome_source">\n@@ -180,7 +242,7 @@\n </param>\n <when value="cached">\n <param name="input1_2bit" type="select" label="Using reference genome" help="If your genome of interest is not listed, contact the Galaxy team">\n- <options from_data_table="deepTools_seqs">\n+ <options from_data_table="lastz_seqs">\n <filter type="sort_by" column="1" />\n <validator type="no_options" message="No indexes are available." />\n </options>\n' |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 heatmapper.xml --- a/heatmapper.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/heatmapper.xml Tue Oct 20 14:43:12 2015 -0400 |
| [ |
| b'@@ -1,12 +1,12 @@\n <tool id="deeptools_heatmapper" name="heatmapper" version="@WRAPPER_VERSION@.0">\r\n <description>creates a heatmap for a score associated to genomic regions</description>\r\n- <expand macro="requirements"/>\r\n- <expand macro="stdio" />\r\n <macros>\r\n <token name="@BINARY@">heatmapper</token>\r\n <import>deepTools_macros.xml</import>\r\n </macros>\r\n+ <expand macro="requirements"/>\r\n <command>\r\n+<![CDATA[\r\n heatmapper\r\n \r\n --matrixFile $matrixFile\r\n@@ -75,18 +75,19 @@\n --refPointLabel \'$advancedOpt.referencePointLabel\'\r\n --regionsLabel \'$advancedOpt.regionsLabel\'\r\n \r\n- #if str($advancedOpt.plotTitle.value) != "None":\r\n+ #if $advancedOpt.plotTitle and str($advancedOpt.plotTitle.value) != "":\r\n --plotTitle \'$advancedOpt.plotTitle\'\r\n #end if\r\n \r\n $advancedOpt.onePlotPerGroup\r\n \r\n- @kmeans_clusterin@\r\n+ @KMEANS_CLUSTERING@\r\n \r\n #end if\r\n+]]>\r\n </command>\r\n <inputs>\r\n- <param name="matrixFile" format="bgzip" type="data" label="Matrix file from the computeMatrix tool"/>\r\n+ <param name="matrixFile" format="deeptools_compute_matrix_archive" type="data" label="Matrix file from the computeMatrix tool"/>\r\n \r\n <expand macro="input_graphic_output_settings">\r\n <expand macro="input_image_file_format" />\r\n@@ -101,13 +102,14 @@\n <when value="no" />\r\n <when value="yes">\r\n <param name="sortRegions" type="select" label="Sort regions"\r\n- help="Whether the heatmap should present the regions sorted. The default is to sort in descending order based on the mean value per region.">\r\n+ help="Whether the heatmap should present the regions sorted. The default is to sort in descending order based on the mean value per region. (--sortRegions)">\r\n <option value="no">no ordering</option>\r\n <option value="descend" selected="true">descending order</option>\r\n <option value="ascend">ascending order</option>\r\n </param>\r\n \r\n- <param name="sortUsing" type="select" label="Method used for sorting" help="For each row the method is computed." >\r\n+ <param name="sortUsing" type="select" label="Method used for sorting"\r\n+ help="For each row the method is computed. (--sortUsing)">\r\n <option value="mean" selected="true">mean</option>\r\n <option value="median">median</option>\r\n <option value="min">min</option>\r\n@@ -116,7 +118,9 @@\n <option value="region_length">region length</option>\r\n </param>\r\n \r\n- <param name="averageTypeSummaryPlot" type="select" label="Type of statistic that should be plotted in the summary image above the heatmap">\r\n+ <param name="averageTypeSummaryPlot" type="select"\r\n+ label="Type of statistic that should be plotted in the summary image above the heatmap"\r\n+ help="(--averageTypeSummaryPlot)">\r\n <option value="mean" selected="true">mean</option>\r\n <option value="median">median</option>\r\n <option value="min">min</option>\r\n@@ -125,22 +129,34 @@\n <option value="std">std</option>\r\n </param>\r\n \r\n- <param name="missingDataColor" type="text" label="Missing data color" value="black" optional="true" help="If \'Represent missing data as zero\' is not set, such cases will be colored in black by default. By using this parameter a different color can be set. A value between 0 and 1 will be used for a gray scale (black is 0). Also color names can be used, see a list here: http://packages.python.org/ete2/reference/reference_svgcolors.html. Alternatively colors can be specified using'..b' is TES (transcription end site)."/>\r\n+ <param name="startLabel" type="text" value="TSS" size="10"\r\n+ label="Label for the region start"\r\n+ help ="Only for scale-regions mode. Label shown in the plot for the start of the region. Default is TSS (transcription start site), but could be changed to anything, e.g. "peak start". (--startLabel)" />\r\n+ <param name="endLabel" type="text" value="TES" size="10"\r\n+ label="Label for the region end"\r\n+ help="Only for scale-regions mode. Label shown in the plot for the region end. Default is TES (transcription end site). (--endLabel)"/>\r\n \r\n- <param name="referencePointLabel" type="text" value="TSS" size="10" label="Reference point label" help ="[only for scale-regions mode] Label shown in the plot for the reference-point. Default is the same as the reference point selected (e.g. TSS), but could be anything, e.g. "peak start" etc." />\r\n+ <param name="referencePointLabel" type="text" value="TSS" size="10"\r\n+ label="Reference point label"\r\n+ help ="Label shown in the plot for the reference-point. Default is the same as the reference point selected (e.g. TSS), but could be anything, e.g. "peak start" etc. (--referencePointLabel)" />\r\n <param name="regionsLabel" type="text" value="genes" size="30" \r\n label="Labels for the regions plotted in the heatmap" \r\n- help="If more than one region is being plotted a list of labels separated by comma and limited by quotes, is required. For example, label1, label2.">\r\n+ help="If more than one region is being plotted a list of labels separated by comma and limited by quotes, is required. For example, label1, label2. (--regionsLabel)">\r\n <sanitizer>\r\n <valid initial="string.printable">\r\n </valid>\r\n </sanitizer>\r\n </param>\r\n- <param name="plotTitle" type="text" value="" size="30" label="Title of the plot" help="Title of the plot, to be printed on top of the generated image. Leave blank for no title." />\r\n+ <expand macro="plotTitle" />\r\n <param name="onePlotPerGroup" type="boolean" truevalue="--onePlotPerGroup" falsevalue="" \r\n label="Do one plot per group" \r\n- help="When computeMatrix was used on more than one group of genes, the average plots for all the groups will be drawn in one panel by default. If this option is set, each group will get its own plot, stacked on top of each other."/>\r\n+ help="When computeMatrix was used on more than one group of genes, the average plots for all the groups will be drawn in one panel by default.\r\n+ If this option is set, each group will get its own plot, stacked on top of each other. (--onePlotPerGroup)"/>\r\n \r\n <expand macro="kmeans_clustering" />\r\n-\r\n </when>\r\n </conditional>\r\n </inputs>\r\n@@ -177,12 +199,12 @@\n </outputs>\r\n <tests>\r\n <test>\r\n- <param name="matrixFile" value="master.mat.gz" ftype="bgzip" />\r\n- <output name="outFileName" file="master.png" ftype="png" compare="sim_size" delta="100" />\r\n+ <param name="matrixFile" value="computeMatrix_result1.gz" ftype="deeptools_compute_matrix_archive" />\r\n+ <output name="outFileName" file="heatmapper_result1.png" ftype="png" compare="sim_size" delta="100" />\r\n </test>\r\n </tests>\r\n <help>\r\n-\r\n+<![CDATA[\r\n **What it does**\r\n \r\n The heatmapper visualizes scores associated with genomic regions, for example ChIP enrichment values around the TSS of genes.\r\n@@ -205,7 +227,7 @@\n -----\r\n \r\n @REFERENCES@\r\n-\r\n+]]>\r\n </help>\r\n <expand macro="citations" />\r\n </tool>\r\n' |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 profiler.xml --- a/profiler.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/profiler.xml Tue Oct 20 14:43:12 2015 -0400 |
| [ |
| b'@@ -2,13 +2,13 @@\n <description>\n creates a profile plot for a score associated to genomic regions\n </description>\n- <expand macro="requirements" />\n- <expand macro="stdio" />\n <macros>\n <token name="@BINARY@">profiler</token>\n <import>deepTools_macros.xml</import>\n </macros>\n+ <expand macro="requirements" />\n <command>\n+<![CDATA[\n profiler\n \n --matrixFile $matrixFile\n@@ -29,8 +29,8 @@\n #end if\n \n #if $scaleRegions.showScaleRegionsOpt == "yes":\n- --startLabel $scaleRegions.startLabel\n- --endLabel $scaleRegions.endLabel\n+ --startLabel \'$scaleRegions.startLabel\'\n+ --endLabel \'$scaleRegions.endLabel\'\n #end if\n \n #if $advancedOpt.showAdvancedOpt == "yes":\n@@ -43,7 +43,7 @@\n \n --regionsLabel \'$advancedOpt.regionsLabel\'\n \n- #if str($advancedOpt.plotTitle).strip() != "":\n+ #if $advancedOpt.plotTitle and str($advancedOpt.plotTitle).strip() != "":\n --plotTitle \'$advancedOpt.plotTitle\'\n #end if\n \n@@ -65,12 +65,13 @@\n --yAxisLabel \'$advancedOpt.yAxisLabel\'\n #end if\n \n- @kmeans_clusterin@\n+ @KMEANS_CLUSTERING@\n \n #end if\n+]]>\n </command>\n <inputs>\n- <param name="matrixFile" format="bgzip" type="data" label="Matrix file from the computeMatrix tool"/>\n+ <param name="matrixFile" format="deeptools_compute_matrix_archive" type="data" label="Matrix file from the computeMatrix tool"/>\n <conditional name="scaleRegions">\n <param name="showScaleRegionsOpt" type="select" label="The input matrix was computed in scale-regions mode">\n <option value="no" selected="true">no</option>\n@@ -78,8 +79,14 @@\n </param>\n <when value="no" />\n <when value="yes">\n- <param name="startLabel" type="text" value="TSS" size="10" label="Label for the region start" help ="[only for scale-regions mode] Label shown in the plot for the start of the region. Default is TSS (transcription start site), but could be changed to anything, e.g. "peak start"." />\n- <param name="endLabel" type="text" value="TES" size="10" label="Label for the region end" help="[only for scale-regions mode] Label shown in the plot for the region end. Default is TES (transcription end site)."/>\n+ <param name="startLabel" type="text" value="TSS" size="10"\n+ label="Label for the region start"\n+ help ="[only for scale-regions mode] Label shown in the plot\n+ for the start of the region. Default is TSS (transcription start site),\n+ but could be changed to anything, e.g. "peak start"." />\n+ <param name="endLabel" type="text" value="TES" size="10"\n+ label="Label for the region end"\n+ help="[only for scale-regions mode] Label shown in the plot for the region end. Default is TES (transcription end site)."/>\n </when>\n </conditional>\n \n@@ -109,23 +116,46 @@\n label="Plot width" \n help="Width in cm. The default value is 8 centimeters. The minimum value is 1 cm." />\n <param name="plotType" type="select" label="Plot type"\n- help="For the summary plot (profile) only. The "lines" option will plot the profile line based on the average type selected. The "fill" option fills the region between zero and the profile curve. The fill in color is semi transparent to distinguish different profiles. The "add standard error" option colors the region between the profile and the standard error of the data. As in the case of fill, a semi-transparent color is used. The option "overlapped_lines" plots each region values, one on top of the other; this option only'..b'parated by spaces. (--colors red blue green)">\n- <validator type="expression" message="Only numbers, digits, \'#\' and spaces are allowed.">all(c in \' #abcdefghijklmnopqrstuvwxyz0123456789\' for c in value)</validator>\n+ <param name="regionsLabel" type="text" value="genes" size="30"\n+ label="Labels for the regions plotted in the heatmap"\n+ help="If more than one region is being plotted a list of labels separated\n+ by comma and limited by quotes, is required. For example, "label1, label2"."/>\n+\n+ <expand macro="plotTitle" />\n+ <param name="colors" type="text" value="" size="40"\n+ label="List of colors to use for the plotted lines"\n+ help="Color names and html hex strings (e.g. #eeff22) are accepted.\n+ The color names should be given separated by spaces. (--colors red blue green)">\n+ <validator type="expression"\n+ message="Only numbers, digits, \'#\' and spaces are allowed.">all(c in \' #abcdefghijklmnopqrstuvwxyz0123456789\' for c in value)</validator>\n </param>\n \n- <param name="onePlotPerGroup" type="boolean" truevalue="--onePlotPerGroup" falsevalue="" label="Do one plot per group" help="When the region file contains groups separated by "#", the default is to plot the averages for the distinct plots in one plot. If this option is set, each group will get its own plot, stacked on top of each other."/>\n- <param name="yMin" type="float" value="" size="3" label="Minimum value for the Y-axis of the summary plot. Leave empty for automatic values" optional="true"/>\n- <param name="yMax" type="float" value="" size="3" label="Maximum value for Y-axis of the summary plot. Leave empty for automatic values" optional="true"/>\n- <param name="xAxisLabel" type="text" value="gene distance (bp)" size="50" label="Description for the x-axis label" />\n- <param name="yAxisLabel" type="text" value="" size="50" label="Description for the y-axis label for the top panel" />\n+ <param name="onePlotPerGroup" type="boolean" truevalue="--onePlotPerGroup" falsevalue=""\n+ label="Do one plot per group"\n+ help="When the region file contains groups separated by "#", the default is\n+ to plot the averages for the distinct plots in one plot. If this option is set, each group\n+ will get its own plot, stacked on top of each other."/>\n+ <param name="yMin" type="float" value="" size="3" optional="true"\n+ label="Minimum value for the Y-axis of the summary plot. Leave empty for automatic values"/>\n+ <param name="yMax" type="float" value="" size="3" optional="true"\n+ label="Maximum value for Y-axis of the summary plot. Leave empty for automatic values" />\n+ <param name="xAxisLabel" type="text" value="gene distance (bp)" size="50"\n+ label="Description for the x-axis label" />\n+ <param name="yAxisLabel" type="text" value="" size="50"\n+ label="Description for the y-axis label for the top panel" />\n \n <expand macro="kmeans_clustering" />\n \n@@ -136,7 +166,14 @@\n <expand macro="output_image_file_format" />\n <expand macro="output_graphic_outputs" />\n </outputs>\n+ <tests>\n+ <test>\n+ <param name="matrixFile" value="computeMatrix_result1.gz" ftype="deeptools_compute_matrix_archive" />\n+ <output name="outFileName" file="profiler_result1.png" ftype="png" compare="sim_size" delta="100" />\n+ </test>\n+ </tests>\n <help>\n+<![CDATA[\n \n **What it does**\n \n@@ -158,7 +195,7 @@\n -----\n \n @REFERENCES@\n-\n+]]>\n </help>\n <expand macro="citations" />\n </tool>\n' |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 repository_dependencies.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/repository_dependencies.xml Tue Oct 20 14:43:12 2015 -0400 |
| b |
| @@ -0,0 +1,4 @@ +<?xml version="1.0"?> +<repositories> + <repository changeset_revision="74b09c8e5f6e" name="data_manager_twobit_builder" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" /> +</repositories> |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/bamCompare_result1.bg --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bamCompare_result1.bg Tue Oct 20 14:43:12 2015 -0400 |
| b |
| @@ -0,0 +1,1 @@ +chrM 0 16569 1.0 |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/bamCorrelate_result1.png |
| b |
| Binary file test-data/bamCorrelate_result1.png has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/bamCoverage_result1.bw |
| b |
| Binary file test-data/bamCoverage_result1.bw has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/bamCoverage_result2.bw |
| b |
| Binary file test-data/bamCoverage_result2.bw has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/bamCoverage_result3.bg --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bamCoverage_result3.bg Tue Oct 20 14:43:12 2015 -0400 |
| b |
| @@ -0,0 +1,11 @@ +chrM 0 210 12259800.00 +chrM 210 220 11998953.19 +chrM 220 230 10694719.15 +chrM 230 240 8347097.87 +chrM 240 250 6260323.40 +chrM 250 260 3391008.51 +chrM 260 16310 2608468.09 +chrM 16310 16320 2347621.28 +chrM 16320 16330 1304234.04 +chrM 16330 16340 1043387.23 +chrM 16340 16350 521693.62 |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/bamCoverage_result4.bg --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bamCoverage_result4.bg Tue Oct 20 14:43:12 2015 -0400 |
| b |
| b'@@ -0,0 +1,460 @@\n+phiX174\t0\t10\t5613.46\n+phiX174\t10\t20\t16840.38\n+phiX174\t20\t70\t50521.15\n+phiX174\t70\t90\t67361.54\n+phiX174\t90\t100\t84201.92\n+phiX174\t100\t120\t89815.38\n+phiX174\t120\t140\t101042.31\n+phiX174\t140\t160\t112269.23\n+phiX174\t160\t170\t123496.15\n+phiX174\t170\t180\t145950.00\n+phiX174\t180\t200\t162790.38\n+phiX174\t200\t210\t168403.85\n+phiX174\t210\t240\t179630.77\n+phiX174\t240\t250\t190857.69\n+phiX174\t250\t260\t202084.62\n+phiX174\t260\t270\t235765.38\n+phiX174\t270\t280\t263832.69\n+phiX174\t280\t290\t286286.54\n+phiX174\t290\t300\t314353.85\n+phiX174\t300\t310\t297513.46\n+phiX174\t310\t320\t303126.92\n+phiX174\t320\t330\t342421.15\n+phiX174\t330\t340\t359261.54\n+phiX174\t340\t360\t387328.85\n+phiX174\t360\t370\t404169.23\n+phiX174\t370\t390\t421009.62\n+phiX174\t390\t400\t415396.15\n+phiX174\t400\t410\t426623.08\n+phiX174\t410\t420\t432236.54\n+phiX174\t420\t460\t449076.92\n+phiX174\t460\t470\t465917.31\n+phiX174\t470\t480\t443463.46\n+phiX174\t480\t490\t449076.92\n+phiX174\t490\t500\t471530.77\n+phiX174\t500\t510\t454690.38\n+phiX174\t510\t520\t465917.31\n+phiX174\t520\t530\t471530.77\n+phiX174\t530\t540\t449076.92\n+phiX174\t540\t560\t482757.69\n+phiX174\t560\t570\t499598.08\n+phiX174\t570\t580\t505211.54\n+phiX174\t580\t590\t499598.08\n+phiX174\t590\t600\t488371.15\n+phiX174\t600\t610\t471530.77\n+phiX174\t610\t620\t533278.85\n+phiX174\t620\t630\t572573.08\n+phiX174\t630\t640\t566959.62\n+phiX174\t640\t660\t544505.77\n+phiX174\t660\t670\t538892.31\n+phiX174\t670\t680\t499598.08\n+phiX174\t680\t690\t527665.38\n+phiX174\t690\t700\t533278.85\n+phiX174\t700\t720\t499598.08\n+phiX174\t720\t730\t510825.00\n+phiX174\t730\t740\t516438.46\n+phiX174\t740\t750\t505211.54\n+phiX174\t750\t760\t477144.23\n+phiX174\t760\t770\t471530.77\n+phiX174\t770\t780\t488371.15\n+phiX174\t780\t800\t533278.85\n+phiX174\t800\t820\t522051.92\n+phiX174\t820\t830\t499598.08\n+phiX174\t830\t850\t460303.85\n+phiX174\t850\t860\t454690.38\n+phiX174\t860\t870\t443463.46\n+phiX174\t870\t880\t471530.77\n+phiX174\t880\t890\t499598.08\n+phiX174\t890\t900\t505211.54\n+phiX174\t900\t920\t527665.38\n+phiX174\t920\t930\t544505.77\n+phiX174\t930\t940\t538892.31\n+phiX174\t940\t960\t527665.38\n+phiX174\t960\t970\t510825.00\n+phiX174\t970\t980\t488371.15\n+phiX174\t980\t990\t482757.69\n+phiX174\t990\t1000\t460303.85\n+phiX174\t1000\t1010\t454690.38\n+phiX174\t1010\t1020\t493984.62\n+phiX174\t1020\t1030\t471530.77\n+phiX174\t1030\t1040\t527665.38\n+phiX174\t1040\t1060\t538892.31\n+phiX174\t1060\t1080\t555732.69\n+phiX174\t1080\t1090\t578186.54\n+phiX174\t1090\t1100\t583800.00\n+phiX174\t1100\t1110\t572573.08\n+phiX174\t1110\t1130\t561346.15\n+phiX174\t1130\t1140\t527665.38\n+phiX174\t1140\t1150\t555732.69\n+phiX174\t1150\t1160\t544505.77\n+phiX174\t1160\t1170\t566959.62\n+phiX174\t1170\t1180\t606253.85\n+phiX174\t1180\t1190\t617480.77\n+phiX174\t1190\t1200\t583800.00\n+phiX174\t1200\t1210\t555732.69\n+phiX174\t1210\t1220\t583800.00\n+phiX174\t1220\t1230\t538892.31\n+phiX174\t1230\t1240\t527665.38\n+phiX174\t1240\t1250\t465917.31\n+phiX174\t1250\t1260\t471530.77\n+phiX174\t1260\t1270\t482757.69\n+phiX174\t1270\t1280\t460303.85\n+phiX174\t1280\t1290\t471530.77\n+phiX174\t1290\t1320\t437850.00\n+phiX174\t1320\t1330\t421009.62\n+phiX174\t1330\t1340\t454690.38\n+phiX174\t1340\t1350\t465917.31\n+phiX174\t1350\t1360\t460303.85\n+phiX174\t1360\t1370\t477144.23\n+phiX174\t1370\t1380\t505211.54\n+phiX174\t1380\t1390\t488371.15\n+phiX174\t1390\t1400\t522051.92\n+phiX174\t1400\t1420\t550119.23\n+phiX174\t1420\t1430\t522051.92\n+phiX174\t1430\t1440\t544505.77\n+phiX174\t1440\t1450\t561346.15\n+phiX174\t1450\t1460\t595026.92\n+phiX174\t1460\t1470\t589413.46\n+phiX174\t1470\t1490\t578186.54\n+phiX174\t1490\t1500\t566959.62\n+phiX174\t1500\t1520\t544505.77\n+phiX174\t1520\t1530\t516438.46\n+phiX174\t1530\t1540\t538892.31\n+phiX174\t1540\t1550\t527665.38\n+phiX174\t1550\t1560\t550119.23\n+phiX174\t1560\t1570\t544505.77\n+phiX174\t1570\t1580\t555732.69\n+phiX174\t1580\t1590\t488371.15\n+phiX174\t1590\t1600\t477144.23\n+phiX174\t1600\t1610\t460303.85\n+phiX174\t1610\t1620\t454690.38\n+phiX174\t1620\t1630\t443463.46\n+phiX174\t1630\t1640\t477144.23\n+phiX174\t1640\t1650\t482757.69\n+phiX174\t1650\t1670\t488371.15\n+phiX174\t1670\t1680\t482757.69\n+phiX174\t1680\t1690\t465917.31\n+phiX174\t1690\t1700\t477144.23\n+phiX174\t1700\t1710\t493984.62\n+phiX174\t1710\t1730\t505211.54\n+phiX174\t1730\t1740\t516438.46\n+phiX174\t1740\t1750\t493984.62\n+phiX174\t1750\t1760\t449076.92\n+phiX174\t1760\t1780\t415396.15\n+p'..b'69\n+phiX174\t3750\t3760\t533278.85\n+phiX174\t3760\t3770\t516438.46\n+phiX174\t3770\t3790\t522051.92\n+phiX174\t3790\t3800\t465917.31\n+phiX174\t3800\t3820\t432236.54\n+phiX174\t3820\t3830\t404169.23\n+phiX174\t3830\t3840\t443463.46\n+phiX174\t3840\t3850\t477144.23\n+phiX174\t3850\t3860\t493984.62\n+phiX174\t3860\t3870\t499598.08\n+phiX174\t3870\t3880\t488371.15\n+phiX174\t3880\t3900\t477144.23\n+phiX174\t3900\t3910\t454690.38\n+phiX174\t3910\t3920\t443463.46\n+phiX174\t3920\t3930\t415396.15\n+phiX174\t3930\t3940\t409782.69\n+phiX174\t3940\t3960\t421009.62\n+phiX174\t3960\t3970\t460303.85\n+phiX174\t3970\t3980\t471530.77\n+phiX174\t3980\t3990\t460303.85\n+phiX174\t3990\t4000\t471530.77\n+phiX174\t4000\t4010\t482757.69\n+phiX174\t4010\t4020\t460303.85\n+phiX174\t4020\t4030\t477144.23\n+phiX174\t4030\t4040\t482757.69\n+phiX174\t4040\t4050\t437850.00\n+phiX174\t4050\t4060\t404169.23\n+phiX174\t4060\t4070\t381715.38\n+phiX174\t4070\t4080\t353648.08\n+phiX174\t4080\t4090\t376101.92\n+phiX174\t4090\t4100\t381715.38\n+phiX174\t4100\t4110\t364875.00\n+phiX174\t4110\t4130\t359261.54\n+phiX174\t4130\t4140\t387328.85\n+phiX174\t4140\t4150\t409782.69\n+phiX174\t4150\t4160\t398555.77\n+phiX174\t4160\t4170\t437850.00\n+phiX174\t4170\t4180\t409782.69\n+phiX174\t4180\t4190\t437850.00\n+phiX174\t4190\t4200\t443463.46\n+phiX174\t4200\t4210\t454690.38\n+phiX174\t4210\t4220\t465917.31\n+phiX174\t4220\t4230\t454690.38\n+phiX174\t4230\t4240\t449076.92\n+phiX174\t4240\t4250\t471530.77\n+phiX174\t4250\t4260\t465917.31\n+phiX174\t4260\t4290\t510825.00\n+phiX174\t4290\t4300\t522051.92\n+phiX174\t4300\t4310\t533278.85\n+phiX174\t4310\t4320\t555732.69\n+phiX174\t4320\t4330\t561346.15\n+phiX174\t4330\t4340\t505211.54\n+phiX174\t4340\t4350\t477144.23\n+phiX174\t4350\t4370\t493984.62\n+phiX174\t4370\t4380\t505211.54\n+phiX174\t4380\t4390\t493984.62\n+phiX174\t4390\t4400\t477144.23\n+phiX174\t4400\t4410\t499598.08\n+phiX174\t4410\t4420\t510825.00\n+phiX174\t4420\t4430\t522051.92\n+phiX174\t4430\t4440\t533278.85\n+phiX174\t4440\t4450\t544505.77\n+phiX174\t4450\t4460\t533278.85\n+phiX174\t4460\t4480\t527665.38\n+phiX174\t4480\t4490\t538892.31\n+phiX174\t4490\t4500\t550119.23\n+phiX174\t4500\t4510\t527665.38\n+phiX174\t4510\t4530\t505211.54\n+phiX174\t4530\t4540\t516438.46\n+phiX174\t4540\t4550\t550119.23\n+phiX174\t4550\t4560\t555732.69\n+phiX174\t4560\t4570\t533278.85\n+phiX174\t4570\t4580\t522051.92\n+phiX174\t4580\t4600\t493984.62\n+phiX174\t4600\t4610\t505211.54\n+phiX174\t4610\t4620\t449076.92\n+phiX174\t4620\t4630\t482757.69\n+phiX174\t4630\t4640\t471530.77\n+phiX174\t4640\t4650\t488371.15\n+phiX174\t4650\t4660\t454690.38\n+phiX174\t4660\t4670\t465917.31\n+phiX174\t4670\t4690\t460303.85\n+phiX174\t4690\t4700\t488371.15\n+phiX174\t4700\t4710\t482757.69\n+phiX174\t4710\t4720\t471530.77\n+phiX174\t4720\t4730\t482757.69\n+phiX174\t4730\t4740\t510825.00\n+phiX174\t4740\t4750\t527665.38\n+phiX174\t4750\t4760\t538892.31\n+phiX174\t4760\t4770\t561346.15\n+phiX174\t4770\t4790\t611867.31\n+phiX174\t4790\t4810\t623094.23\n+phiX174\t4810\t4830\t606253.85\n+phiX174\t4830\t4840\t561346.15\n+phiX174\t4840\t4850\t617480.77\n+phiX174\t4850\t4860\t595026.92\n+phiX174\t4860\t4870\t606253.85\n+phiX174\t4870\t4880\t600640.38\n+phiX174\t4880\t4900\t589413.46\n+phiX174\t4900\t4910\t538892.31\n+phiX174\t4910\t4920\t533278.85\n+phiX174\t4920\t4930\t544505.77\n+phiX174\t4930\t4940\t516438.46\n+phiX174\t4940\t4950\t482757.69\n+phiX174\t4950\t4960\t454690.38\n+phiX174\t4960\t4970\t409782.69\n+phiX174\t4970\t4980\t381715.38\n+phiX174\t4980\t4990\t336807.69\n+phiX174\t4990\t5000\t359261.54\n+phiX174\t5000\t5010\t392942.31\n+phiX174\t5010\t5020\t415396.15\n+phiX174\t5020\t5030\t409782.69\n+phiX174\t5030\t5040\t415396.15\n+phiX174\t5040\t5050\t437850.00\n+phiX174\t5050\t5060\t381715.38\n+phiX174\t5060\t5070\t364875.00\n+phiX174\t5070\t5080\t359261.54\n+phiX174\t5080\t5090\t364875.00\n+phiX174\t5090\t5100\t370488.46\n+phiX174\t5100\t5120\t376101.92\n+phiX174\t5120\t5140\t364875.00\n+phiX174\t5140\t5150\t370488.46\n+phiX174\t5150\t5160\t359261.54\n+phiX174\t5160\t5180\t319967.31\n+phiX174\t5180\t5190\t325580.77\n+phiX174\t5190\t5200\t314353.85\n+phiX174\t5200\t5210\t269446.15\n+phiX174\t5210\t5220\t235765.38\n+phiX174\t5220\t5230\t202084.62\n+phiX174\t5230\t5240\t190857.69\n+phiX174\t5240\t5250\t162790.38\n+phiX174\t5250\t5280\t129109.62\n+phiX174\t5280\t5290\t106655.77\n+phiX174\t5290\t5300\t78588.46\n+phiX174\t5300\t5310\t61748.08\n+phiX174\t5310\t5340\t33680.77\n+phiX174\t5340\t5350\t22453.85\n+phiX174\t5350\t5386\t11226.9\n' |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/bamCoverage_result4.bw |
| b |
| Binary file test-data/bamCoverage_result4.bw has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/bamFingerprint_result1.png |
| b |
| Binary file test-data/bamFingerprint_result1.png has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/bamPEFragmentSize_histogram_result1.png |
| b |
| Binary file test-data/bamPEFragmentSize_histogram_result1.png has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/bamPEFragmentSize_result1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bamPEFragmentSize_result1.txt Tue Oct 20 14:43:12 2015 -0400 |
| b |
| @@ -0,0 +1,9 @@ +Sample size: 3 + +Min.: 241.0 +1st Qu.: 241.5 +Mean: 244.666666667 +Median: 242.0 +3rd Qu.: 246.5 +Max.: 251.0 +Std: 4.49691252108 |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/bigwigCompare_result1.bw |
| b |
| Binary file test-data/bigwigCompare_result1.bw has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/bigwigCompare_result2.bg --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bigwigCompare_result2.bg Tue Oct 20 14:43:12 2015 -0400 |
| b |
| @@ -0,0 +1,3 @@ +ch1 0 400 1.0 +ch2 0 400 1.0 +ch3 0 400 1.0 |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/bigwigCorrelate_result1.png |
| b |
| Binary file test-data/bigwigCorrelate_result1.png has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/bowtie2-test1.bam |
| b |
| Binary file test-data/bowtie2-test1.bam has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/computeGCBias_result1.tabular --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/computeGCBias_result1.tabular Tue Oct 20 14:43:12 2015 -0400 |
| b |
| @@ -0,0 +1,101 @@ +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 2.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 2.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/computeMatrix1.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/computeMatrix1.bed Tue Oct 20 14:43:12 2015 -0400 |
| b |
| @@ -0,0 +1,8 @@ +phiX174 1000 1500 CG11023 0 + +phiX174 150 1750 cda5 0 - +phiX174 150 177 cda8 0 - +phiX174 75 1500 cda9 0 + +phiX174 101 175 C11023 0 + +phiX174 125 150 ca5 0 - +phiX174 450 1750 ca8 0 + +phiX174 80 1500 cda9 0 + |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/computeMatrix2.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/computeMatrix2.bed Tue Oct 20 14:43:12 2015 -0400 |
| b |
| @@ -0,0 +1,6 @@ +ch1 100 150 CG11023 0 + +ch2 150 175 cda5 0 - +ch3 100 125 cda8 0 + +ch1 75 125 C11023 0 + +ch2 125 150 ca5 0 - +ch3 75 100 ca8 0 + |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/computeMatrix2.bw |
| b |
| Binary file test-data/computeMatrix2.bw has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/computeMatrix_result1.gz |
| b |
| Binary file test-data/computeMatrix_result1.gz has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/computeMatrix_result2.gz |
| b |
| Binary file test-data/computeMatrix_result2.gz has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/correctGCBias_result1.bam |
| b |
| Binary file test-data/correctGCBias_result1.bam has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/heatmapper_result1.png |
| b |
| Binary file test-data/heatmapper_result1.png has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/master.mat.gz |
| b |
| Binary file test-data/master.mat.gz has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/master.png |
| b |
| Binary file test-data/master.png has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/paired_chr2L.bam |
| b |
| Binary file test-data/paired_chr2L.bam has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/phiX.2bit |
| b |
| Binary file test-data/phiX.2bit has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/phiX.bam |
| b |
| Binary file test-data/phiX.bam has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/phiX.bam.bai |
| b |
| Binary file test-data/phiX.bam.bai has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/phiX.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/phiX.fasta Tue Oct 20 14:43:12 2015 -0400 |
| b |
| @@ -0,0 +1,79 @@ +>phiX174 +GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT +GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA +ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG +TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA +GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC +TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT +TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT +CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT +TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG +TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC +GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA +CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG +TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT +AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC +CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA +TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC +TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA +CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA +GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT +GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA +ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC +TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT +TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC +ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC +CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT +GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC +CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC +TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG +TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT +TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA +AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT +TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT +ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC +GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC +TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT +TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA +TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG +TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC +CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG +AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC +CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT +TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG +CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA +AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT +GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG +GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA +TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT +CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG +TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA +GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC +CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA +TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA +AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC +TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT +CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA +TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG +TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT +CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT +TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC +ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG +TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA +ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG +GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC +CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT +GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG +GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT +ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG +CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC +CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC +GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT +CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG +CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA +TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT +TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG +TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC +AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC +TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA + |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/profiler_result1.png |
| b |
| Binary file test-data/profiler_result1.png has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/sequence.2bit |
| b |
| Binary file test-data/sequence.2bit has changed |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 test-data/test2.bed --- a/test-data/test2.bed Tue Sep 16 13:46:05 2014 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| b |
| @@ -1,8 +0,0 @@ -ch1 100 150 CG11023 0 + -ch2 150 175 cda5 0 - -ch3 100 125 cda8 0 + -#Group 1 -ch1 75 125 C11023 0 + -ch2 125 150 ca5 0 - -ch3 75 100 ca8 0 + -#Group 2 |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 tool-data/deepTools_seqs.loc.sample --- a/tool-data/deepTools_seqs.loc.sample Tue Sep 16 13:46:05 2014 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| b |
| @@ -1,27 +0,0 @@ -#This is a sample file distributed with Galaxy that enables tools -#to use a directory of 2bit genome files for use with deepTools. You will -#need to supply these files and then create a deepTools_seqs.loc file -#similar to this one (store it in this directory) that points to -#the directories in which those files are stored. The deepTools_seqs.loc -#file has this format: -# -#<unique_build_id> <display_name> <file_path> -# -#So, for example, if your deepTools_seqs.loc began like this: -# -#hg18 Human (Homo sapiens): hg18 /depot/data2/galaxy/twobit/hg18.2bit -#hg19 Human (Homo sapiens): hg19 /depot/data2/galaxy/twobit/hg19.2bit -#mm9 Mouse (Mus musculus): mm9 /depot/data2/galaxy/twobit/mm9.2bit -# -#then your /depot/data2/galaxy/twobit/ directory -#would need to contain the following 2bit files: -# -#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.2bit -#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg19.2bit -#-rw-r--r-- 1 james universe 269808 2005-09-13 10:12 mm9.2bit -# -#Your deepTools_seqs.loc file should include an entry per line for -#each file you have stored that you want to be available. Note that -#your files should all have the extension '2bit'. -# -#Please note that the <unique_build_id> is also used as "Species name abbreviation". |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 tool-data/lastz_seqs.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/lastz_seqs.loc.sample Tue Oct 20 14:43:12 2015 -0400 |
| b |
| @@ -0,0 +1,29 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of 2bit genome files for use with deepTools. +#This file is named lastz_seqs.loc file to make use of an already existing loc +#file from the lastz tool that is created by the twobit data-manager. +#You will need to supply these files and then create a lastz_seqs.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The lastz_seqs.loc +#file has this format: +# +#<unique_build_id> <display_name> <file_path> +# +#So, for example, if your lastz_seqs.loc began like this: +# +#hg18 Human (Homo sapiens): hg18 /depot/data2/galaxy/twobit/hg18.2bit +#hg19 Human (Homo sapiens): hg19 /depot/data2/galaxy/twobit/hg19.2bit +#mm9 Mouse (Mus musculus): mm9 /depot/data2/galaxy/twobit/mm9.2bit +# +#then your /depot/data2/galaxy/twobit/ directory +#would need to contain the following 2bit files: +# +#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.2bit +#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg19.2bit +#-rw-r--r-- 1 james universe 269808 2005-09-13 10:12 mm9.2bit +# +#Your lastz_seqs.loc file should include an entry per line for +#each file you have stored that you want to be available. Note that +#your files should all have the extension '2bit'. +# +#Please note that the <unique_build_id> is also used as "Species name abbreviation". |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 tool_data_table_conf.xml.sample --- a/tool_data_table_conf.xml.sample Tue Sep 16 13:46:05 2014 -0400 +++ b/tool_data_table_conf.xml.sample Tue Oct 20 14:43:12 2015 -0400 |
| b |
| @@ -1,7 +1,8 @@ +<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> <tables> - <!-- Locations of 2bit sequence files for use in deepTools --> - <table name="deepTools_seqs" comment_char="#"> + <!-- Locations of 2bit sequence files for use in Lastz --> + <table name="lastz_seqs" comment_char="#"> <columns>value, name, path</columns> - <file path="tool-data/deepTools_seqs.loc" /> + <file path="tool-data/lastz_seqs.loc" /> </table> </tables> |
| b |
| diff -r 3a2aab18a217 -r 5231f398d784 tool_dependencies.xml --- a/tool_dependencies.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/tool_dependencies.xml Tue Oct 20 14:43:12 2015 -0400 |
| b |
| @@ -1,101 +1,9 @@ <?xml version="1.0"?> <tool_dependency> - <package name="samtools" version="0.1.19"> - <repository changeset_revision="923adc89c666" name="package_samtools_0_1_19" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" /> - </package> - <package name="numpy" version="1.7.1"> - <repository changeset_revision="ef12a3a11d5b" name="package_numpy_1_7" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" /> - </package> - <package name="matplotlib" version="1.2.1"> - <repository changeset_revision="fe60617380df" name="package_matplotlib_1_2" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" /> - </package> - <package name="scipy" version="0.12.0"> - <repository changeset_revision="984d208b0808" name="package_scipy_0_12" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" /> - </package> - <package name="pysam" version="0.7.7"> - <repository changeset_revision="b62538c8c664" name="package_pysam_0_7_7" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" /> - </package> - <package name="bx-python" version="12-2013"> - <repository changeset_revision="55bd96a1c3b3" name="package_bx_python_12_2013" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" /> + <package name="python" version="2.7"> + <repository changeset_revision="eb37ce21eef1" name="package_python_2_7" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> </package> - - <package name="ucsc_tools" version="0.1"> - <install version="1.0"> - <actions> - <action type="download_binary"> - <url_template architecture="x86_64" os="linux">http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/bedGraphToBigWig</url_template> - <url_template architecture="i686" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bedGraphToBigWig</url_template> - <url_template architecture="i386" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bedGraphToBigWig</url_template> - <url_template architecture="x86_64" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.x86_64/bedGraphToBigWig</url_template> - </action> - <action type="chmod"> - <file mode="755">$INSTALL_DIR/bedGraphToBigWig</file> - </action> - <action type="download_binary"> - <url_template architecture="x86_64" os="linux">http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/bigWigInfo</url_template> - <url_template architecture="i686" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bigWigInfo</url_template> - <url_template architecture="i386" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bigWigInfo</url_template> - <url_template architecture="x86_64" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.x86_64/bigWigInfo</url_template> - </action> - <action type="chmod"> - <file mode="755">$INSTALL_DIR/bigWigInfo</file> - </action> - <action type="download_binary"> - <url_template architecture="x86_64" os="linux">http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/bigWigToBedGraph</url_template> - <url_template architecture="i686" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bigWigToBedGraph</url_template> - <url_template architecture="i386" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bigWigToBedGraph</url_template> - <url_template architecture="x86_64" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.x86_64/bigWigToBedGraph</url_template> - </action> - <action type="chmod"> - <file mode="755">$INSTALL_DIR/bigWigToBedGraph</file> - </action> - <action type="set_environment"> - <environment_variable action="prepend_to" name="PATH">$INSTALL_DIR</environment_variable> - </action> - </actions> - </install> - <readme>The tools downloaded by this dependency definition are free for academic use. TODO: UCSC tools are only available with their latest version. That is not good for reproducibility.</readme> - </package> - - <package name="deepTools" version="1.5.9.1"> - <install version="1.0"> - <actions> - <action type="shell_command">git clone --recursive https://github.com/fidelram/deepTools.git</action> - <!-- populate the environment variables from the dependend repos --> - <action type="set_environment_for_install"> - <repository changeset_revision="b62538c8c664" name="package_pysam_0_7_7" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu"> - <package name="pysam" version="0.7.7" /> - </repository> - <repository changeset_revision="55bd96a1c3b3" name="package_bx_python_12_2013" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu"> - <package name="bx-python" version="12-2013" /> - </repository> - <repository changeset_revision="ef12a3a11d5b" name="package_numpy_1_7" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu"> - <package name="numpy" version="1.7.1" /> - </repository> - <repository changeset_revision="fe60617380df" name="package_matplotlib_1_2" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu"> - <package name="matplotlib" version="1.2.1" /> - </repository> - <repository changeset_revision="984d208b0808" name="package_scipy_0_12" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu"> - <package name="scipy" version="0.12.0" /> - </repository> - </action> - <action type="shell_command">git reset --hard 351890e3db9a443484c5c349791b7247163cc94f</action> - <action type="make_directory">$INSTALL_DIR/lib/python</action> - <action type="shell_command"> - export PYTHONPATH=$PYTHONPATH:$INSTALL_DIR/lib/python && - python setup.py install --install-lib $INSTALL_DIR/lib/python --install-scripts $INSTALL_DIR/bin - </action> - <action type="set_environment"> - <environment_variable action="prepend_to" name="PATH">$INSTALL_DIR/bin</environment_variable> - <environment_variable action="prepend_to" name="PYTHONPATH">$INSTALL_DIR/lib/python</environment_variable> - <!-- disable the config file of deepTools --> - <environment_variable action="set_to" name="DEEP_TOOLS_NO_CONFIG">TRUE</environment_variable> - </action> - </actions> - </install> - <readme> - Installation of deepTools from Fidel Ramirez. - https://github.com/fidelram/deepTools - </readme> - </package> + <package name="deepTools" version="1.5.11"> + <repository changeset_revision="01eb49da8dcf" name="package_python_2_7_deeptools_1_5_11" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> + </package> </tool_dependency> |
