Previous changeset 7:b3f7ff168b9a (2016-07-07) Next changeset 9:40b8472e91ca (2016-11-14) |
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/meme commit ef11594cf3ca79e444ab4e30d83de5951a636faf |
modified:
fimo.xml test-data/fimo_output_html_1.html test-data/fimo_output_html_2.html test-data/fimo_output_xml_1.xml test-data/fimo_output_xml_2.xml test-data/meme_output_html_1.html test-data/meme_output_html_2.html test-data/meme_output_txt_1.txt test-data/meme_output_txt_2.txt test-data/meme_output_xml_1.xml test-data/meme_output_xml_2.xml tool_dependencies.xml |
added:
test-data/meme_input_1.fasta test-data/prior30.plib |
b |
diff -r b3f7ff168b9a -r 53846f74a019 fimo.xml --- a/fimo.xml Thu Jul 07 09:55:00 2016 -0400 +++ b/fimo.xml Sun Jul 10 09:02:14 2016 -0400 |
[ |
@@ -1,9 +1,16 @@ -<tool id="meme_fimo" name="FIMO" version="4.11.0.4"> +<tool id="meme_fimo" name="FIMO" version="4.11.1.0"> <description>- Scan a set of sequences for motifs.</description> <requirements> - <requirement type="package" version="6.9.3">imagemagick</requirement> - <requirement type="package" version="4.11.0">meme</requirement> + <requirement type="package" version="1.3.20">graphicsmagick</requirement> + <requirement type="package" version="4.11.1">meme</requirement> </requirements> + <stdio> + <!-- Anything other than zero is an error --> + <exit_code range="1:" /> + <!-- In case the return code has not been set propery check stderr too --> + <regex match="Error:" /> + <regex match="Exception:" /> + </stdio> <command> <![CDATA[ mkdir -p output && @@ -255,7 +262,7 @@ <param name="fasta_type_selector" value="history"/> <param name="input_database" value="phiX.fasta" ftype="fasta"/> <param name="options_type_selector" value="advanced"/> - <param name="parse_genomic_coord" value="--parse_genomic_coord"/> + <param name="parse_genomic_coord" value="yes"/> <param name="remove_duplicate_coords" value="yes"/> <param name="output_separate_motifs" value="yes"/> <param name="non_commercial_use" value="True"/> |
b |
diff -r b3f7ff168b9a -r 53846f74a019 test-data/fimo_output_html_1.html --- a/test-data/fimo_output_html_1.html Thu Jul 07 09:55:00 2016 -0400 +++ b/test-data/fimo_output_html_1.html Sun Jul 10 09:02:14 2016 -0400 |
b |
@@ -25,7 +25,7 @@ <center><big><b>FIMO - Motif search tool</b></big></center> <hr> <p> -FIMO version 4.11.0, (Release date: Thu Nov 26 17:48:49 2015 +1000) +FIMO version 4.11.1, (Release date: Fri Jan 15 12:51:59 2016 -0800) </p> <p> For further information on how to interpret these results |
b |
diff -r b3f7ff168b9a -r 53846f74a019 test-data/fimo_output_html_2.html --- a/test-data/fimo_output_html_2.html Thu Jul 07 09:55:00 2016 -0400 +++ b/test-data/fimo_output_html_2.html Sun Jul 10 09:02:14 2016 -0400 |
b |
@@ -25,7 +25,7 @@ <center><big><b>FIMO - Motif search tool</b></big></center> <hr> <p> -FIMO version 4.11.0, (Release date: Thu Nov 26 17:48:49 2015 +1000) +FIMO version 4.11.1, (Release date: Fri Jan 15 12:51:59 2016 -0800) </p> <p> For further information on how to interpret these results |
b |
diff -r b3f7ff168b9a -r 53846f74a019 test-data/fimo_output_xml_1.xml --- a/test-data/fimo_output_xml_1.xml Thu Jul 07 09:55:00 2016 -0400 +++ b/test-data/fimo_output_xml_1.xml Sun Jul 10 09:02:14 2016 -0400 |
b |
@@ -1,6 +1,6 @@ <?xml version="1.0" encoding="UTF-8" standalone="no"?> <!-- Begin document body --> -<fimo version="4.11.0" release="Thu Nov 26 17:48:49 2015 +1000"> +<fimo version="4.11.1" release="Fri Jan 15 12:51:59 2016 -0800"> xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation= xmlns:fimo="http://noble.gs.washington.edu/schema/fimo" > |
b |
diff -r b3f7ff168b9a -r 53846f74a019 test-data/fimo_output_xml_2.xml --- a/test-data/fimo_output_xml_2.xml Thu Jul 07 09:55:00 2016 -0400 +++ b/test-data/fimo_output_xml_2.xml Sun Jul 10 09:02:14 2016 -0400 |
b |
@@ -1,6 +1,6 @@ <?xml version="1.0" encoding="UTF-8" standalone="no"?> <!-- Begin document body --> -<fimo version="4.11.0" release="Thu Nov 26 17:48:49 2015 +1000"> +<fimo version="4.11.1" release="Fri Jan 15 12:51:59 2016 -0800"> xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation= xmlns:fimo="http://noble.gs.washington.edu/schema/fimo" > |
b |
diff -r b3f7ff168b9a -r 53846f74a019 test-data/meme_input_1.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/meme_input_1.fasta Sun Jul 10 09:02:14 2016 -0400 |
b |
@@ -0,0 +1,66 @@ +>chr21_19617074_19617124_+ +AAAAATTATTACTAGGGAGGGGGCCGGAACCTCGGGACGTGGGTATATAA +>chr21_26934381_26934431_+ +GCGCCTGGTCGGTTATGAGTCACAAGTGAGTTATAAAAGGGTCGCACGTT +>chr21_28217753_28217803_- +CAAAGGGGAGGAGTGGGGTGGGGGTGGGGGTTTCACTGGTCCACTATAAA +>chr21_31710037_31710087_- +AACACCCAGGTTTCTGAGTATATAATCGCCGCACCAAAGAATTTAATTTT +>chr21_31744582_31744632_- +CCCAGGTCTAAGAGCATATATAACTTGGAGTCCAGACTATGACATTCAAA +>chr21_31768316_31768366_+ +AACGTATATAAATGGTCCTGTCCAGATGTGGCATGCAAACTCAGAATCTT +>chr21_31914206_31914256_- +TGACACCCACTACTTAGAGTATAAAATCATTCTGAGAAGTTAGAGACACC +>chr21_31933633_31933683_- +TCAGAGTATATATAAATGTTCCTGTCCAGTCACAGTCACCAAACTGACCT +>chr21_31962741_31962791_- +ACATATAACTCAGGTTGGATAAAATAATTTGTACAAATCAGGAGAGTCAA +>chr21_31964683_31964733_+ +TCTGATTCACTGAGGCATATAAAAGGCCCTCTGCGGAGAAGTGTCCATAC +>chr21_31973364_31973414_+ +aaacttaaaactctataaacttaaaactCTAGAATCTGATCCTGCTATAC +>chr21_31992870_31992920_+ +CTCATACACTATTGAAGATGTATAAAATTTCATTTGCAGATGGTGACATT +>chr21_32185595_32185645_- +TCACCACCCACCAGAGCTGGGATATATAAAGAAGGTTCTGAGACTAGGAA +>chr21_32202076_32202126_- +TGCCCACCAGCTTGAGGTATAAAAAGCCCTGTACGGGAAGAGACCTTCAT +>chr21_32253899_32253949_- +AGCCCCACCCACCAGCAAGGATATATAAAAGCTCAGGAGTCTGGAGTGAC +>chr21_32410820_32410870_- +TCTACCCCACTAATCACTGAGGATGTATAAAAGTCCCAGGGAAGCTGGTG +>chr21_36411748_36411798_- +ATAGTTCTGTATAGTTTCAGTTGGCATCtaaaaattatataactttattt +>chr21_37838750_37838800_- +gatggttttataaggggcctcaccctcggctcagccctcattcttctcct +>chr21_45705687_45705737_+ +CCGGGGCGGAGCGGCCTTTGCTCTTTGCGTGGTCGCGGGGGTATAACAGC +>chr21_45971413_45971463_- +CAGGCCCTGGGCATATAAAAGCCCCAGCAGCCAACAGGctcacacacaca +>chr21_45978668_45978718_- +CAGAGGGGTATAAAGGTTCCGACCACTCAGAGGCCTGGCACGAtcactca +>chr21_45993530_45993580_+ +CCAAGGAGGAGTATAAAAGCCCCACAAACCCGAGCACCTCACTCACTCGC +>chr21_46020421_46020471_+ +GAGACATATAAAAGCCAACATCCCTGAGCACCTAACACACGGactcactc +>chr21_46031920_46031970_+ +GGAAAATACCCAGGGAGGGTATAAAACCTCAGCAGCCAGGGCACACAAAC +>chr21_46046964_46047014_+ +ACAAGGCCAGGAGGGGTATAAAAGCCTGAGAGCCCCAAGAACctcacaca +>chr21_46057197_46057247_+ +ATTGCTGAGTCTCCTGCTGGGAAAACACAGGCCCTGGGCATATAAAAGCC +>chr21_46086869_46086919_- +GACAGGTGTGCTTCTGTGCTGTGGGGATGCCTGGGCCCAGGTATAAAGGC +>chr21_46102103_46102153_- +AGGTGTGTGCTTCTGTGCTGTGGGGATGCCTGGGTCCAGGTATAAAGGCT +>chr21_47517957_47518007_+ +CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG +>chr21_47517957_47518007_+ +CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG +>chr21_47517957_47518007_+ +CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG +>chr21_47575506_47575556_- +TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG +>chr21_47575506_47575556_- +TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG |
b |
diff -r b3f7ff168b9a -r 53846f74a019 test-data/meme_output_html_1.html --- a/test-data/meme_output_html_1.html Thu Jul 07 09:55:00 2016 -0400 +++ b/test-data/meme_output_html_1.html Sun Jul 10 09:02:14 2016 -0400 |
[ |
@@ -7,8 +7,8 @@ // @JSON_VAR data var data = { "program": "MEME", - "version": "4.11.0", - "release": "Thu Nov 26 17:48:49 2015 +1000", + "version": "4.11.1", + "release": "Fri Jan 15 12:51:59 2016 -0800", "stop_reason": "Stopped because requested number of motifs (1) found.", "cmd": [ "meme", |
b |
diff -r b3f7ff168b9a -r 53846f74a019 test-data/meme_output_html_2.html --- a/test-data/meme_output_html_2.html Thu Jul 07 09:55:00 2016 -0400 +++ b/test-data/meme_output_html_2.html Sun Jul 10 09:02:14 2016 -0400 |
[ |
@@ -7,8 +7,8 @@ // @JSON_VAR data var data = { "program": "MEME", - "version": "4.11.0", - "release": "Thu Nov 26 17:48:49 2015 +1000", + "version": "4.11.1", + "release": "Fri Jan 15 12:51:59 2016 -0800", "stop_reason": "Stopped because requested number of motifs (1) found.", "cmd": [ "meme", |
b |
diff -r b3f7ff168b9a -r 53846f74a019 test-data/meme_output_txt_1.txt --- a/test-data/meme_output_txt_1.txt Thu Jul 07 09:55:00 2016 -0400 +++ b/test-data/meme_output_txt_1.txt Sun Jul 10 09:02:14 2016 -0400 |
b |
@@ -1,7 +1,7 @@ ******************************************************************************** MEME - Motif discovery tool ******************************************************************************** -MEME version 4.11.0 (Release date: Thu Nov 26 17:48:49 2015 +1000) +MEME version 4.11.1 (Release date: Fri Jan 15 12:51:59 2016 -0800) For further information on how to interpret these results or to get a copy of the MEME software please access http://meme-suite.org . |
b |
diff -r b3f7ff168b9a -r 53846f74a019 test-data/meme_output_txt_2.txt --- a/test-data/meme_output_txt_2.txt Thu Jul 07 09:55:00 2016 -0400 +++ b/test-data/meme_output_txt_2.txt Sun Jul 10 09:02:14 2016 -0400 |
b |
@@ -1,7 +1,7 @@ ******************************************************************************** MEME - Motif discovery tool ******************************************************************************** -MEME version 4.11.0 (Release date: Thu Nov 26 17:48:49 2015 +1000) +MEME version 4.11.1 (Release date: Fri Jan 15 12:51:59 2016 -0800) For further information on how to interpret these results or to get a copy of the MEME software please access http://meme-suite.org . |
b |
diff -r b3f7ff168b9a -r 53846f74a019 test-data/meme_output_xml_1.xml --- a/test-data/meme_output_xml_1.xml Thu Jul 07 09:55:00 2016 -0400 +++ b/test-data/meme_output_xml_1.xml Sun Jul 10 09:02:14 2016 -0400 |
b |
@@ -161,7 +161,7 @@ ]> <!-- Begin document body --> -<MEME version="4.11.0" release="Thu Nov 26 17:48:49 2015 +1000"> +<MEME version="4.11.1" release="Fri Jan 15 12:51:59 2016 -0800"> <training_set datafile="/Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2490.dat" length="30"> <alphabet name="Protein" like="protein"> <letter id="A" symbol="A" name="Alanine" colour="0000CC"/> |
b |
diff -r b3f7ff168b9a -r 53846f74a019 test-data/meme_output_xml_2.xml --- a/test-data/meme_output_xml_2.xml Thu Jul 07 09:55:00 2016 -0400 +++ b/test-data/meme_output_xml_2.xml Sun Jul 10 09:02:14 2016 -0400 |
b |
@@ -161,7 +161,7 @@ ]> <!-- Begin document body --> -<MEME version="4.11.0" release="Thu Nov 26 17:48:49 2015 +1000"> +<MEME version="4.11.1" release="Fri Jan 15 12:51:59 2016 -0800"> <training_set datafile="Galaxy_FASTA_Input" length="30"> <alphabet name="DNA" like="dna"> <letter id="A" symbol="A" complement="T" name="Adenine" colour="CC0000"/> |
b |
diff -r b3f7ff168b9a -r 53846f74a019 test-data/prior30.plib --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/prior30.plib Sun Jul 10 09:02:14 2016 -0400 |
b |
b'@@ -0,0 +1,275 @@\n+Alphabet= ACDEFGHIKLMNPQRSTVWY\n+NumDistr= 30\n+Number= 0\n+Mixture= 0.055795\n+B= 5.623820\n+Alpha= 0.0855491 0.0221831 0.0111063 0.0209959 0.0505726 0.025437 0.0155389 0.132951 0.0247865 0.150287 0.0577239 0.0209317 0.0166629 0.0220905 0.0244295 0.0497608 0.070277 0.157532 0.0102219 0.0309633 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 0\n+Comment= HMM9.4 reestimated in henikoff29.2\n+\n+Number= 1\n+Mixture= 0.198333\n+B= 0.097240\n+Alpha= 0.0562629 0.0329597 0.0692513 0.0385232 0.0400041 0.143573 0.0428939 0.0226244 0.0442102 0.0665467 0.0117853 0.0447655 0.0833299 0.0395825 0.0611271 0.0588852 0.0513472 0.0317153 0.0237865 0.0368161 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 24\n+Comment= Outside\n+\n+Number= 2\n+Mixture= 0.043566\n+B= 1.648336\n+Alpha= 0.0144564 0.00845337 0.00785519 0.00864933 0.255959 0.0110815 0.0509526 0.0234533 0.0120443 0.0561967 0.015111 0.0190974 0.00857653 0.0167812 0.0164918 0.0197108 0.0151013 0.0252782 0.050139 0.364613 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 26\n+Comment= Inside\n+\n+Number= 3\n+Mixture= 0.060170\n+B= 2.595432\n+Alpha= 0.0452144 0.00587917 0.169731 0.0751478 0.00749471 0.0845832 0.0369819 0.00610072 0.0548186 0.011029 0.00382749 0.212785 0.0206532 0.0416705 0.0280716 0.117267 0.0533742 0.00943157 0.00216149 0.0137784 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 19\n+Comment= Outside Alpha\n+\n+Number= 4\n+Mixture= 0.065466\n+B= 3.112271\n+Alpha= 0.0361167 0.0049157 0.0134924 0.0461325 0.00557631 0.0209043 0.0302551 0.016425 0.307554 0.0338255 0.0139435 0.0360733 0.0127659 0.0873761 0.222668 0.0369042 0.0354442 0.0228891 0.00434827 0.0123906 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 21\n+Comment= Outside Beta\n+\n+Number= 5\n+Mixture= 0.067614\n+B= 2.053644\n+Alpha= 0.0194362 0.00765176 0.00188738 0.00372898 0.0849894 0.00421787 0.00400459 0.152735 0.00407958 0.4568 0.106051 0.00304386 0.00545956 0.00900935 0.00605071 0.00519029 0.016255 0.0861045 0.00787965 0.0154248 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 22\n+Comment= Inside alpha\n+\n+Number= 6\n+Mixture= 0.080724\n+B= 2.138987\n+Alpha= 0.0423172 0.0153891 0.00409306 0.00565735 0.0197117 0.00590607 0.00139926 0.307863 0.00544884 0.115721 0.0285808 0.00522771 0.00474851 0.00328193 0.00351054 0.00892385 0.0348922 0.380003 0.00117673 0.00614917 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 23\n+Comment= Inside beta\n+\n+Number= 7\n+Mixture= 0.051030\n+B= 3.878926\n+Alpha= 0.0548123 0.000759746 0.144127 0.46019 0.00249502 0.0192754 0.0106535 0.00938765 0.0562429 0.0163148 0.00717389 0.0245612 0.0177482 0.0744802 0.0199233 0.0323535 0.0257651 0.018574 0.00087086 0.00429088 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 23\n+Comment= Alpha helix\n+\n+Number= 8\n+Mixture= 0.103529\n+B= 1.486325\n+Alpha= 0.315754 0.0384546 0.0116388 0.0133665 0.0111126 0.107921 0.00752325 0.0154885 0.0111281 0.0231087 0.011626 0.0228375 0.0304785 0.0166632 0.0156345 0.186379 0.0954421 0.0546691 0.00351538 0.00725682 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 23\n+Comment= Beta strand\n+\n+Number= 9\n+Mixture= 0.062940\n+B= 8.221215\n+Alpha= 0.0869919 0.00672577 0.0600995 0.10763 0.0153489 0.0378086 0.0325335 0.023388 0.113765 0.041623 0.0196906 0.0625344 0.0262599 0.0788667 0.0707399 0.0886634 0.0666777 0.0361472 0.00484308 0.0196629 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 23\n+Comment= Other\n+\n+Number= 10\n+Mixture= 0.012518\n+B= 38.955631\n+Alpha= 0.732922 0.0145131 0.00623235 0.00951423 0.00717778 0.0289521 0.00351664 0.0125081 0.00886593 0.0183651 0.00832812 0.00670968 0.00364556 0.00622169 0.00812899 0.0582399 0.0205067 0.0394327 0.00207485 0.00414489 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 0\n+Comment= A\n+\n+Number= 11\n+Mixture= 0.004953\n+B= 381.562195\n+Alpha= 0.00563239 0.959814 0.00144129 0.00213042 0.00158645 0.00168393 0.000989765 0.00325263 0.00148501 0.00343924 0.00168673 0.00159054 0.00121534 0.00129942 0.00195209 0.00296106 0.0039912 0.00266944 0.000327808 0.000851203 \n+FullUpdate= 1\n+QUpdate= 1\n+Str'..b'nt= I \n+\n+Number= 18\n+Mixture= 0.009400\n+B= 150.415985\n+Alpha= 0.00688657 0.00169711 0.00222738 0.00346887 0.00115861 0.00302866 0.00209171 0.00400905 0.903944 0.0037747 0.00186061 0.00449531 0.00249618 0.00324487 0.041775 0.00392196 0.00461714 0.00296607 0.000893256 0.00144282 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 0\n+Comment= K \n+\n+Number= 19\n+Mixture= 0.017057\n+B= 31.896633\n+Alpha= 0.0114646 0.00367926 0.00296188 0.00596126 0.0190009 0.00382486 0.00338381 0.0401936 0.00650072 0.790038 0.031659 0.00392791 0.0050046 0.00753591 0.00771818 0.00748621 0.0101555 0.0312597 0.00242405 0.00581952 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 0\n+Comment= L \n+\n+Number= 20\n+Mixture= 0.002761\n+B= 201.346268\n+Alpha= 0.00353933 0.00165628 0.0014931 0.00161065 0.00279831 0.00194259 0.00101868 0.00969101 0.00211316 0.0217036 0.928022 0.00162899 0.0015681 0.0015629 0.00138977 0.00294601 0.00311476 0.00723178 0.00156295 0.00340569 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 0\n+Comment= M \n+\n+Number= 21\n+Mixture= 0.005734\n+B= 108.343185\n+Alpha= 0.0067512 0.00239062 0.0140378 0.0043452 0.00365788 0.00689345 0.0148828 0.00715373 0.00789036 0.00614036 0.00289697 0.858995 0.00399721 0.00770961 0.00570515 0.0238176 0.011602 0.00591549 0.00167893 0.00353897 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 0\n+Comment= N \n+\n+Number= 22\n+Mixture= 0.022818\n+B= 15.153304\n+Alpha= 0.0417987 0.00360232 0.0113792 0.0152366 0.00564775 0.0123795 0.00606957 0.0091353 0.0165122 0.0167265 0.00490487 0.00915437 0.755604 0.0131375 0.012587 0.0283392 0.0189623 0.0140029 0.0012848 0.00353553 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 0\n+Comment= P \n+\n+Number= 23\n+Mixture= 0.005931\n+B= 79.417511\n+Alpha= 0.0142993 0.00266984 0.0053289 0.0321605 0.0028715 0.00426743 0.0257509 0.00565307 0.0106106 0.0161186 0.00955753 0.0104696 0.00638107 0.807311 0.0149106 0.0111968 0.00889459 0.00681482 0.00206658 0.00266624 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 0\n+Comment= Q \n+\n+Number= 24\n+Mixture= 0.011491\n+B= 93.103897\n+Alpha= 0.00756896 0.00314197 0.00296652 0.00327634 0.00194604 0.00467894 0.00721049 0.00406061 0.0277257 0.00663852 0.00217868 0.00577047 0.00473306 0.00953551 0.889701 0.00650859 0.00506022 0.00294281 0.00205549 0.00230062 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 0\n+Comment= R \n+\n+Number= 25\n+Mixture= 0.008219\n+B= 47.504795\n+Alpha= 0.0284818 0.00697155 0.00749796 0.00604665 0.00515171 0.00954817 0.00380684 0.00637929 0.0104463 0.00908885 0.00471437 0.0194592 0.00711823 0.00611827 0.00979722 0.707416 0.139256 0.00656298 0.0015377 0.00460086 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 0\n+Comment= S \n+\n+Number= 26\n+Mixture= 0.019050\n+B= 14.027470\n+Alpha= 0.0247201 0.00718027 0.00845584 0.0076239 0.00600101 0.0073401 0.00492149 0.0173757 0.0129878 0.0125773 0.0100452 0.0230424 0.00659406 0.0110314 0.0112037 0.107763 0.690341 0.0249364 0.00193884 0.00392074 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 0\n+Comment= T \n+\n+Number= 27\n+Mixture= 0.007047\n+B= 76.958153\n+Alpha= 0.0447488 0.00734525 0.00576457 0.00805666 0.00714188 0.00593389 0.0041663 0.0688592 0.00714299 0.0255115 0.00800708 0.00501678 0.00632646 0.00492002 0.00812967 0.0100074 0.0240134 0.745035 0.00126243 0.00261056 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 0\n+Comment= V \n+\n+Number= 28\n+Mixture= 0.003957\n+B= 150.973328\n+Alpha= 0.00517343 0.00213336 0.00350645 0.00390297 0.018439 0.0041919 0.0023655 0.00404231 0.00420998 0.0171406 0.00379068 0.00363696 0.00245861 0.00387467 0.00502035 0.00465674 0.00417283 0.00620977 0.888513 0.012561 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 0\n+Comment= W \n+\n+Number= 29\n+Mixture= 0.004904\n+B= 30.653225\n+Alpha= 0.0342049 0.00809912 0.0126852 0.0174701 0.156033 0.0118268 0.0431342 0.0204751 0.0164439 0.0363664 0.0129811 0.0131986 0.0103037 0.0116235 0.0159032 0.0287792 0.0176143 0.024986 0.0131845 0.494687 \n+FullUpdate= 1\n+QUpdate= 1\n+StructID= 0\n+Comment= Y \n+\n+/* $Header$ */\n+/* $Header$ */\n+/* $Header$ */\n' |
b |
diff -r b3f7ff168b9a -r 53846f74a019 tool_dependencies.xml --- a/tool_dependencies.xml Thu Jul 07 09:55:00 2016 -0400 +++ b/tool_dependencies.xml Sun Jul 10 09:02:14 2016 -0400 |
b |
@@ -1,9 +1,9 @@ <?xml version="1.0"?> <tool_dependency> - <package name="imagemagick" version="6.9.3"> - <repository changeset_revision="942ae5bafee3" name="package_imagemagick_6_9_3" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" /> + <package name="graphicsmagick" version="1.3.20"> + <repository changeset_revision="f2855f4cbc8f" name="package_graphicsmagick_1_3_20" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" /> </package> - <package name="meme" version="4.11.0"> - <repository changeset_revision="5774a0e96d6f" name="package_meme_4_11_0" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> + <package name="meme" version="4.11.1"> + <repository changeset_revision="336b41a99b8f" name="package_meme_4_11_1" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> </package> </tool_dependency> |