|
Commit message:
Uploaded |
|
added:
ITSx ITSx.xml ITSx_db/HMMs/A.hmm ITSx_db/HMMs/A.hmm.h3f ITSx_db/HMMs/A.hmm.h3i ITSx_db/HMMs/A.hmm.h3m ITSx_db/HMMs/A.hmm.h3p ITSx_db/HMMs/B.hmm ITSx_db/HMMs/B.hmm.h3f ITSx_db/HMMs/B.hmm.h3i ITSx_db/HMMs/B.hmm.h3m ITSx_db/HMMs/B.hmm.h3p ITSx_db/HMMs/C.hmm ITSx_db/HMMs/C.hmm.h3f ITSx_db/HMMs/C.hmm.h3i ITSx_db/HMMs/C.hmm.h3m ITSx_db/HMMs/C.hmm.h3p ITSx_db/HMMs/D.hmm ITSx_db/HMMs/D.hmm.h3f ITSx_db/HMMs/D.hmm.h3i ITSx_db/HMMs/D.hmm.h3m ITSx_db/HMMs/D.hmm.h3p ITSx_db/HMMs/E.hmm ITSx_db/HMMs/E.hmm.h3f ITSx_db/HMMs/E.hmm.h3i ITSx_db/HMMs/E.hmm.h3m ITSx_db/HMMs/E.hmm.h3p ITSx_db/HMMs/F.hmm ITSx_db/HMMs/F.hmm.h3f ITSx_db/HMMs/F.hmm.h3i ITSx_db/HMMs/F.hmm.h3m ITSx_db/HMMs/F.hmm.h3p ITSx_db/HMMs/G.hmm ITSx_db/HMMs/G.hmm.h3f ITSx_db/HMMs/G.hmm.h3i ITSx_db/HMMs/G.hmm.h3m ITSx_db/HMMs/G.hmm.h3p ITSx_db/HMMs/H.hmm ITSx_db/HMMs/H.hmm.h3f ITSx_db/HMMs/H.hmm.h3i ITSx_db/HMMs/H.hmm.h3m ITSx_db/HMMs/H.hmm.h3p ITSx_db/HMMs/I.hmm ITSx_db/HMMs/I.hmm.h3f ITSx_db/HMMs/I.hmm.h3i ITSx_db/HMMs/I.hmm.h3m ITSx_db/HMMs/I.hmm.h3p ITSx_db/HMMs/L.hmm ITSx_db/HMMs/L.hmm.h3f ITSx_db/HMMs/L.hmm.h3i ITSx_db/HMMs/L.hmm.h3m ITSx_db/HMMs/L.hmm.h3p ITSx_db/HMMs/M.hmm ITSx_db/HMMs/M.hmm.h3f ITSx_db/HMMs/M.hmm.h3i ITSx_db/HMMs/M.hmm.h3m ITSx_db/HMMs/M.hmm.h3p ITSx_db/HMMs/N.hmm ITSx_db/HMMs/O.hmm ITSx_db/HMMs/O.hmm.h3f ITSx_db/HMMs/O.hmm.h3i ITSx_db/HMMs/O.hmm.h3m ITSx_db/HMMs/O.hmm.h3p ITSx_db/HMMs/P.hmm ITSx_db/HMMs/P.hmm.h3f ITSx_db/HMMs/P.hmm.h3i ITSx_db/HMMs/P.hmm.h3m ITSx_db/HMMs/P.hmm.h3p ITSx_db/HMMs/Q.hmm ITSx_db/HMMs/Q.hmm.h3f ITSx_db/HMMs/Q.hmm.h3i ITSx_db/HMMs/Q.hmm.h3m ITSx_db/HMMs/Q.hmm.h3p ITSx_db/HMMs/R.hmm ITSx_db/HMMs/R.hmm.h3f ITSx_db/HMMs/R.hmm.h3i ITSx_db/HMMs/R.hmm.h3m ITSx_db/HMMs/R.hmm.h3p ITSx_db/HMMs/S.hmm ITSx_db/HMMs/S.hmm.h3f ITSx_db/HMMs/S.hmm.h3i ITSx_db/HMMs/S.hmm.h3m ITSx_db/HMMs/S.hmm.h3p ITSx_db/HMMs/T.hmm ITSx_db/HMMs/T.hmm.h3f ITSx_db/HMMs/T.hmm.h3i ITSx_db/HMMs/T.hmm.h3m ITSx_db/HMMs/T.hmm.h3p ITSx_db/HMMs/U.hmm ITSx_db/HMMs/U.hmm.h3f ITSx_db/HMMs/U.hmm.h3i ITSx_db/HMMs/U.hmm.h3m ITSx_db/HMMs/U.hmm.h3p test-data/expectedOutput.ITS1.fasta test-data/expectedOutput.ITS2.fasta test-data/expectedOutput.extractions.txt test-data/expectedOutput.full.fasta test-data/expectedOutput.graph test-data/expectedOutput.positions.txt test-data/expectedOutput.problematic.txt test-data/testITSsequences.fasta tool_dependencies.xml |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ITSx Mon Mar 14 16:15:08 2016 -0400 |
| [ |
| b'@@ -0,0 +1,2695 @@\n+#!/usr/bin/perl\n+# ITSx ITS Extractor\n+$app_title = "ITSx -- Identifies ITS sequences and extracts the ITS region";\n+$app_author = "Johan Bengtsson-Palme et al., University of Gothenburg";\n+$app_version = "1.0.11";\n+$app_message = "";\n+# ----------------------------------------------------------------- #\n+\n+# License information\n+$license =\n+" ITSx - ITS Extractor -- Identifies ITS sequences and extracts the ITS region\\\n+ Copyright (C) 2012-2014 Johan Bengtsson-Palme et al.\\\n+\\\n+ This program is free software: you can redistribute it and/or modify\\\n+ it under the terms of the GNU General Public License as published by\\\n+ the Free Software Foundation, either version 3 of the License, or\\\n+ (at your option) any later version.\\\n+\\\n+ This program is distributed in the hope that it will be useful,\\\n+ but WITHOUT ANY WARRANTY; without even the implied warranty of\\\n+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\\\n+ GNU General Public License for more details.\\\n+\\\n+ You should have received a copy of the GNU General Public License\\\n+ along with this program, in a file called \'license.txt\'\\\n+ If not, see: http://www.gnu.org/licenses/.\\\n+";\n+\n+## BUGS:\n+$bugs = "New features in this version ($app_version):\\\n+- None\\\n+\\\n+Fixed bugs in this version ($app_version):\\\n+- Fixed a bug causing newline characters to be occasionally skipped in the \'its1.full_and_partial.fasta\' FASTA output file when the \'--anchor\' option was used\\\n+\\\n+Known bugs in this version ($app_version):\\\n+- None\\\n+";\n+\n+## OPTIONS:\n+$options = "\\\n+-i {file} : DNA FASTA input file to investigate\\\n+-o {file} : Base for the names of output file(s)\\\n+-p {directory} : A path to a directory of HMM-profile collections representing ITS conserved regions, default is in the same directory as ITSx itself\\\n+--date {T or F} : Adds a date and time stamp to the output directory, off (F) by default\\\n+--reset {T or F} : Re-creates the HMM-database before ITSx is run, off (F) by default\\\n+\n+Sequence selection options:\\\n+-t {character code} : Profile set to use for the search, see the User\'s Guide (comma-separated), default is all\\\n+-E {value} : Domain E-value cutoff for a sequence to be included in the output, default = 1e-5\\\n+-S {value} : Domain score cutoff for a sequence to be included in the output, default = 0\\\n+-N {value} : The minimal number of domains that must match a sequence before it is included, default = 2\\\n+--selection_priority {sum, domains, eval, score} : Selects what will be of highest priority when determining the origin of the sequence, default is sum\\\n+--search_eval {value} : The E-value cutoff used in the HMMER search, high numbers may slow down the process, cannot be used with the --search_score option, default is 0.01\\\n+--search_score {value} : The score cutoff used in the HMMER search, low numbers may slow down the process, cannot be used with the --search_eval option, default is to used E-value cutoff, not score\\\n+--allow_single_domain {e-value,score or F} : Allow inclusion of sequences that only find a single domain, given that they meet the given E-value and score thresholds, on with parameters 1e-9,0 by default\\\n+--allow_reorder {T or F} : Allows profiles to be in the wrong order on extracted sequences, off (F) by default\\\n+--complement {T or F} : Checks both DNA strands against the database, creating reverse complements, on (T) by default\\\n+--cpu {value} : the number of CPU threads to use, default is 1\\\n+--multi_thread {T or F} : Multi-thread the HMMER-search, on (T) if number of CPUs (--cpu option > 1), else off (F) by default\\\n+--heuristics {T or F} : Selects whether to use HMMER\'s heuristic filtering, off (F) by default\\\n+\n+Output options:\\\n+--summary {T or F} : Summary of results output, on (T) by default\\\n+--graphical {T or F} : \'Graphical\' output, on (T) by default\\\n+--fasta {T or F} : FASTA-format output of extracted ITS sequences, on (T) by default\\\n+--preserve {T or '..b'ng time for the analysis\n+ close (SUMMARY); # Close summary file\n+ }\n+}\n+\n+sub hmmerSearch {\n+ $hmmerCommand = $_[0];\n+ $outputFile = $_[1];\n+ $strand = $_[2];\n+ $profileSet = $_[3];\n+ open (HMMEROUTPUT, ">$outputFile");\n+ open (HMMER, "$hmmerCommand |");\n+ $totalHitCount = 0;\n+ $hitCount = 0;\n+ $SSUCount = 0;\n+ $LSUCount = 0;\n+ $startCount = 0;\n+ $endCount = 0;\n+ $maxCount = 1;\n+ while (chomp($line = <HMMER>)) {\n+ if (substr($line,0,6) eq "Query:") {\n+ $hitCount = 0;\n+ $SSUCount = 0;\n+ $LSUCount = 0;\n+ $startCount = 0;\n+ $endCount = 0;\n+ undef @bestScore;\n+ undef @bestEntry;\n+ \n+ $query = substr($line,7);\n+ $queryLength = $query;\n+ $queryLength =~ s/.* *//;\n+ $queryLength =~ s/[^0-9]//g;\n+ $query =~ s/ *//;\n+ $query =~ s/ *.*//;\n+ \n+ print HMMEROUTPUT "## New query:\\t$query\\t$queryLength\\n";\n+\n+ }\n+ if (substr($line,0,12) eq "Description:") {\n+ $desc = $line;\n+ }\n+ if (substr($line,0,3) eq ">> ") {\n+ ($tempshit,$hmmerSubjectName) = split(\' \',$line);\n+ }\n+ if ($line =~ m/[0-9] ! /) {\n+ $stats = $line;\n+ $stats =~ s/ */\\t/g;\n+ ($empty,$no,$excl,$score) = split(\'\\t\',$stats);\n+ $hitCount++;\n+ $totalHitCount++;\n+ if ($maxCount == 0) {\n+\tprint HMMEROUTPUT "$query\\t$hmmerSubjectName\\t$queryLength$stats\\n";\n+ } else {\n+\tif (substr($hmmerSubjectName,0,5) eq "1_SSU") {\n+\t $SSUCount++;\n+\t if ($SSUCount <= $maxCount) {\n+\t @bestScore[1] = $score;\n+\t @bestEntry[1] = "$query\\t$hmmerSubjectName\\t$queryLength$stats\\n";\n+\t } else {\n+\t if ($score > @bestScore[1]) {\n+\t @bestScore[1] = $score;\n+\t @bestEntry[1] = "$query\\t$hmmerSubjectName\\t$queryLength$stats\\n";\n+\t }\n+\t }\n+\t}\n+\tif (substr($hmmerSubjectName,0,5) eq "4_LSU") {\n+\t $LSUCount++;\n+\t if ($LSUCount <= $maxCount) {\n+\t @bestScore[4] = $score;\n+\t @bestEntry[4] = "$query\\t$hmmerSubjectName\\t$queryLength$stats\\n";\n+\t } else { \n+\t if ($score > @bestScore[4]) {\n+\t @bestScore[4] = $score;\n+\t @bestEntry[4] = "$query\\t$hmmerSubjectName\\t$queryLength$stats\\n";\n+\t }\n+\t }\n+\t}\n+\tif (substr($hmmerSubjectName,0,5) eq "2_5.8") {\n+\t $startCount++;\n+\t if ($startCount <= $maxCount) {\n+\t @bestScore[2] = $score;\n+\t @bestEntry[2] = "$query\\t$hmmerSubjectName\\t$queryLength$stats\\n";\n+\t } else {\n+\t if ($score > @bestScore[2]) {\n+\t @bestScore[2] = $score;\n+\t @bestEntry[2] = "$query\\t$hmmerSubjectName\\t$queryLength$stats\\n";\n+\t }\n+\t }\n+\t}\n+\tif (substr($hmmerSubjectName,0,5) eq "3_End") {\n+\t $endCount++;\n+\t if ($endCount <= $maxCount) {\n+\t @bestScore[3] = $score;\n+\t @bestEntry[3] = "$query\\t$hmmerSubjectName\\t$queryLength$stats\\n";\n+\t } else {\n+\t if ($score > @bestScore[3]) {\n+\t @bestScore[3] = $score;\n+\t @bestEntry[3] = "$query\\t$hmmerSubjectName\\t$queryLength$stats\\n"\n+\t }\n+\t }\n+\t}\n+ }\n+ }\n+ if (substr($line,0,2) eq "//") {\n+ if ($maxCount > 0) {\n+\tif ($SSUCount > 0) {\n+\t print HMMEROUTPUT @bestEntry[1];\n+\t}\n+\tif ($startCount > 0) {\n+\t print HMMEROUTPUT @bestEntry[2];\n+\t}\n+\tif ($endCount > 0) {\n+\t print HMMEROUTPUT @bestEntry[3];\n+\t}\n+\tif ($LSUCount > 0) {\n+\t print HMMEROUTPUT @bestEntry[4];\n+\t}\n+ }\n+ print HMMEROUTPUT "//\\n";\n+ }\n+ }\n+ close(HMMEROUTPUT);\n+ $now = localtime;\n+ if ($silent == 0) {\n+ if ($strand eq "M") {\n+ print STDERR " $now : " . ucfirst($profileIndex{$profileSet}) . " analysis of main strand finished.\\n"; # Print finished type\n+ } else {\n+ print STDERR " $now : " . ucfirst($profileIndex{$profileSet}) . " analysis of complementary strand finished.\\n"; # Print finished type\n+ }\n+ }\n+}\n+\n+\n+## Please send beers, pizzas, cakes, fruit pies, job positions and other types of feedback to:\n+## johan.bengtsson [at] microbiology.se\n+## Looking forward to hearing from you.... visit my website: www.microbiology.se for info on my research\n+## //Johan Bengtsson, 2012-2014\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ITSx.xml Mon Mar 14 16:15:08 2016 -0400 |
| b |
| b'@@ -0,0 +1,173 @@\n+<tool id="ITSx" name="ITSx Extractor" version="1.0.11">\n+\n+\t<description> \n+\t\tITSx -- Identifies ITS sequences and extracts the ITS region\n+\t</description>\n+\n+\t<requirements>\n+\t\t<requirement type="package" version="3.1b2">hmmer</requirement>\n+\t</requirements>\n+\n+\t<stdio>\n+\t\t<regex match="ITSx" source="both" level="log"/>\n+\t\t<regex match="analysis" source="both" level="log"/>\n+\t\t<regex match="ERROR" source="both" level="fatal"/>\n+\t\t<regex match="error" source="both" level="fatal"/>\n+\t</stdio>\n+\t\n+\t<command interpreter="perl">\n+\t\tITSx -i $input \n+\t\t--detailed_results T\n+\t\t-E $domain_eval \n+\t\t-S $domain_score \n+\t\t-N $domain_num \n+\t\t--cpu=\\${GALAXY_SLOTS:-1}\n+\t\t$allow_reorder \n+\t\t$complement\n+\t\t$heuristics \n+\t\t$preserve \n+\t\t$reset\n+\t\t$truncate\n+\t\t#if $hmmer_search.search == "eval"\n+\t\t\t--search_eval $hmmer_search.eval_cutoff\n+\t\t#else\n+\t\t\t--search_score $hmmer_search.score_cutoff\n+\t\t#end if\n+\t</command>\n+ \n+\t<inputs>\n+\t\t<param name="input" type="data" format="fasta" label="Input Fasta"/>\n+\t\t\n+\t\t<param name="domain_eval" type="float" value="0.00001" label="Domain E-value Cutoff" \n+\t\thelp="Domain E-value cutoff a sequence must obtain in the HMMER-based step to be included in the output."/>\n+\n+\t\t<param name="domain_score" type="integer" value="0" label="Domain Score Cutoff"\n+\t\thelp="Domain score cutoff that a sequence must obtain in the HMMER-based step to be included in the output."/>\n+\n+\t\t<param name="domain_num" type="integer" value="2" label="Minimum Number of Domains"\n+ \t\thelp="The minimum number of domains (different HMM gene profiles) that must match a sequence or it to be included in the output (detected as an ITS sequence). Setting the value \t\t\tlower than two will increase the number of false positives, while increasing it above two will decrease ITSx detection abilities on fragmentary data. "/>\n+ \t\t\n+\t\t<conditional name="hmmer_search">\n+\t\t\t<param name="search" type="select" label="HMMER Search Type">\n+\t\t\t\t<option value="eval">Search E-value</option>\n+\t\t\t\t<option value="score">Search Score</option>\n+\t\t\t</param>\n+\t\t\t<when value="eval">\n+\t\t\t\t<param name="eval_cutoff" type="float" value="0.01" label="Search E-value"\n+\t\t\t\thelp="The actual E-value cutoff used in the HMMER search. High numbers may slow down the process. Should never be set to a lower value than the Domain E-value Cutoff opion. \t\t\t\t\tCannot be used in combination with Search Score option."/>\n+\t\t\t</when>\n+\t\t\t<when value="score">\n+\t\t\t\t<param name="score_cutoff" type="integer" value="0" label="Seach Score" \n+\t\t\t\thelp="The score cutoff used in the HMMER search. Low numbers may slow down the process. Should never be set to a higher number than the Domain Score Cutoff. Cannot be used \t\t\t\t\tin combination with the Search E-value option."/>\n+\t\t\t</when>\n+\t\t</conditional>\n+\n+\t\t<param name="reset" type="boolean" checked="true" truevalue="--reset T" falsevalue="--reset F" label="Re-creates the HMM-database before ITSx is run"/>\n+\n+\t\t<!-- <param name="cpu" type="integer" value="1" label="cpu"/> -->\n+\n+\t\t<param name="allow_reorder" type="boolean" checked="false" truevalue="--allow_reorder T" falsevalue="--allow_reorder F" label="Allow profiles not to be in the expected order on the \t\t\textracted sequences"/>\n+\t\t\n+\t\t<param name="complement" type="boolean" checked="true" truevalue="--complement T" falsevalue="--complement F" label="Check both DNA strands against the database"/>\n+\t\t\n+\t\t<param name="heuristics" type="boolean" checked="false" truevalue="--heuristics T" falsevalue="--heuristics F" label="Use HMMER\'s heuristic filtering"/>\n+\t\t\t\n+\t\t<param name="preserve" type="boolean" checked="false" truevalue="--preserve T" falsevalue="--preserve F" label=" Preserve sequence headers instead of printing out ITSx headers"/>\n+\n+\t\t<param name="truncate" type="boolean" checked="true" truevalue="--truncate T" falsevalue="--truncate F" label="Remove ends of ITS sequences if they are outside of the ITS region"/>\n+ \t</inputs>\n+\n+\t<outputs>\n+\t\t<data name="ITS1" format="fa'..b'xt"/>\n+\t\t<data name="problematic" format="tabular" label="Problematic sequences" from_work_dir="ITSx_out.problematic.txt"/>\n+\t\t<data name="summary" format="txt" label="ITSx summary" from_work_dir="ITSx_out.summary.txt"/>\n+\t\t<data name="extractions" format="tabular" label="ITSx extraction results" from_work_dir="ITSx_out.extraction.results"/>\n+\t</outputs>\n+\n+\t<tests>\n+\t\t<test>\n+\t\t\t<param name="input" value="testITSsequences.fasta"/>\n+\t\t\t<param name="domain_eval" value="0.00001" />\n+\t\t\t<param name="domain_score" value="0" />\n+\t\t\t<param name="domain_num" value="2" />\n+\t\t\t<param name="search" value="eval" />\n+\t\t\t<param name="eval_cutoff" value="0.01" />\n+\t\t\t<param name="reset" value="--reset T" />\n+\t\t\t<param name="allow_reorder" value="--allow_reorder F" />\n+\t\t\t<param name="complement" value="--complement T"/>\n+\t\t\t<param name="heuristics" value="--heuristics F" />\n+\t\t\t<param name="preserve" value="--preserve F" />\n+\t\t\t<param name="truncate" value="--truncate T" />\n+\t\t\t<output name="ITS1" file="expectedOutput.ITS1.fasta" />\n+\t\t\t<output name="ITS2" file="expectedOutput.ITS2.fasta" />\n+\t\t\t<output name="fullfasta" file="expectedOutput.full.fasta" />\n+\t\t\t<output name="graph" file="expectedOutput.graph" />\n+\t\t\t<!-- This output is commented out because it is empty -->\n+\t\t\t<!--<output name="nodetect" file="expectedOutput_no_detections.fasta" />-->\n+\t\t\t<output name="positions" file="expectedOutput.positions.txt" />\n+\t\t\t<!-- This output is commented out because it causes the test to fail (due to the difference in time that gets printed out in the expected output and the output of the test) -->\n+\t\t\t<!--<output name="summary" file="expectedOutput.summary.txt" />-->\n+\t\t\t<output name="problematic" file="expectedOutput.problematic.txt" />\n+\t\t\t<output name="extractions" file="expectedOutput.extractions.txt" />\n+\t\t</test>\n+\t</tests>\n+\n+\t<help>\n+**Description**\n+\t\t\n+Identifies ITS sequences and extracts the ITS regions.\n+\n+ITSx is an open source software utility to extract the highly variable ITS1 and ITS2 subregions from ITS sequences, which is commonly used as a molecular barcode for e.g. fungi. As the inclusion of parts of the neighbouring, very conserved, ribosomal genes (SSU, 5S and LSU rRNA sequences) in the sequence identification process can lead to severely misleading results, ITSx identifies and extracts only the ITS regions themselves.\n+For more information regarding the settings of the tool, please visit the ITSx Users Guide on http://microbiology.se/publ/itsx_users_guide.pdf\n+\n+-----\n+\n+**Inputs and Outputs**\n+\t\t\n+- Inputs:\n+\t+ Accepts input in the FASTA format. It is possible to input both aligned and unaligned FASTA files, containing both DNA and RNA sequences \n+\n+- Outputs:\n+\t+ Summary file of the entire run\n+\t+ One or more detailed table containing the positions in the respective sequences where the ITS subregions were found\n+\t+ Semi-graphical representation of hits\n+\t+ FASTA file of all identified sequences\n+\t+ FASTA file for ITS1 regions\n+\t+ FASTA file for ITS2 regions\n+\t+ A list of sequence IDs representing the entries (if they exist) that did not contain any ITS region \n+\t+ A file containing chimeric sequences (if they are found)\n+\t+ A file for problematic sequences\n+\n+-----\n+\n+**Tool Information**\n+\n+- ITSx tool v1.0.11: \n+\t+ Release Date: December 2014 \n+\t+ URL: http://microbiology.se/software/itsx/ \n+\t+ Source URL: http://microbiology.se/sw/ITSx_1.0.11.tar.gz\n+\t+ Copyright (C) 2012-2013 Johan Bengtsson-Palme et al.\n+\n+-----\n+\t\t\n+**Contact Information**\n+\t\t\n+- For more information, contact:\n+\t+ AAFC-MBB Team\n+\t+ E-mail: mbb@agr.gc.ca\n+\t+ Agriculture and Agri-foods Canada, Ottawa, ON, Canada\n+\t</help> \n+\n+\t<citations>\n+\t\t<citation type="bibtex">@ARTICLE{a1,\n+\t\tauthor = {Bengtsson-Palme, Johan},\n+\t\ttitle = {ITSx: Improved software detection and extraction of ITS1 and ITS2 from ribosomal ITS sequences of fungi and other eukaryotes for use in environmental sequencing},\n+\t\tyear = {2013}\n+\t\t}</citation>\n+\t</citations> \n+</tool>\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/A.hmm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ITSx_db/HMMs/A.hmm Mon Mar 14 16:15:08 2016 -0400 |
| [ |
| b'@@ -0,0 +1,13640 @@\n+HMMER3/b [3.0 | March 2010]\n+NAME 3_End_Alveolata_58S_end_eighta_long\n+LENG 45\n+ALPH DNA\n+RF no\n+CS no\n+MAP yes\n+DATE Wed Feb 29 22:48:49 2012\n+NSEQ 2\n+EFFN 2.000000\n+CKSUM 875354829\n+STATS LOCAL MSV -7.4772 0.72750\n+STATS LOCAL VITERBI -8.4131 0.72750\n+STATS LOCAL FORWARD -3.2493 0.72750\n+HMM A C G T \n+ m->m m->i m->d i->m i->i d->m d->d\n+ COMPO 2.02810 1.19053 1.12475 1.42869\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 0.00000 *\n+ 1 2.53331 3.02441 0.20344 2.88069 1 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 2 2.53331 3.02441 0.20344 2.88069 2 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 3 2.81865 0.23582 2.88868 2.35662 3 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 4 2.53331 3.02441 0.20344 2.88069 4 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 5 2.81865 0.23582 2.88868 2.35662 5 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 6 2.81865 0.23582 2.88868 2.35662 6 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 7 2.53331 3.02441 0.20344 2.88069 7 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 8 2.57915 2.25909 2.64442 0.28946 8 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 9 0.23862 2.84929 2.43386 2.70756 9 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 10 2.81865 0.23582 2.88868 2.35662 10 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 11 2.53331 3.02441 0.20344 2.88069 11 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 12 2.53331 3.02441 0.20344 2.88069 12 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 13 2.57915 2.25909 2.64442 0.28946 13 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 14 2.57915 2.25909 2.64442 0.28946 14 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 15 2.81865 0.23582 2.88868 2.35662 15 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 16 2.53331 3.02441 0.20344 2.88069 16 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 17 2.81865 0.23582 2.88868 2.35662 17 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 18 2.81865 0.23582 2.88868 2.35662 18 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 19 2.53331 3.02441 0.20344 2.88069 19 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 20 2.57915 2.25909 2.644'..b'- -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 24 3.10493 2.60552 3.15246 0.17607 24 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 25 2.95876 3.60411 0.11539 3.51048 25 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 26 0.13978 3.39641 2.81240 3.29960 26 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 27 0.13978 3.39641 2.81240 3.29960 27 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 28 3.45170 0.12801 3.50037 2.84251 28 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 29 3.45170 0.12801 3.50037 2.84251 29 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 30 3.10493 2.60552 3.15246 0.17607 30 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 31 2.95876 3.60411 0.11539 3.51048 31 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 32 3.45170 0.12801 3.50037 2.84251 32 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 33 0.13978 3.39641 2.81240 3.29960 33 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 34 2.95876 3.60411 0.11539 3.51048 34 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 35 0.13978 3.39641 2.81240 3.29960 35 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 36 3.10493 2.60552 3.15246 0.17607 36 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 37 2.95876 3.60411 0.11539 3.51048 37 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 38 2.95876 3.60411 0.11539 3.51048 38 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 39 0.13978 3.39641 2.81240 3.29960 39 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 40 3.10493 2.60552 3.15246 0.17607 40 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 41 3.45170 0.12801 3.50037 2.84251 41 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 42 0.13978 3.39641 2.81240 3.29960 42 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 43 3.10493 2.60552 3.15246 0.17607 43 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 44 3.10493 2.60552 3.15246 0.17607 44 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03654 4.02061 4.02061 1.46634 0.26236 1.09861 0.40547\n+ 45 3.45170 0.12801 3.50037 2.84251 45 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01844 4.00251 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/A.hmm.h3f |
| b |
| Binary file ITSx_db/HMMs/A.hmm.h3f has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/A.hmm.h3i |
| b |
| Binary file ITSx_db/HMMs/A.hmm.h3i has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/A.hmm.h3m |
| b |
| Binary file ITSx_db/HMMs/A.hmm.h3m has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/A.hmm.h3p |
| b |
| Binary file ITSx_db/HMMs/A.hmm.h3p has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/B.hmm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ITSx_db/HMMs/B.hmm Mon Mar 14 16:15:08 2016 -0400 |
| [ |
| b'@@ -0,0 +1,2325 @@\n+HMMER3/b [3.0 | March 2010]\n+NAME 3_End_Bryophyta_58S_end_four_long\n+LENG 45\n+ALPH DNA\n+RF no\n+CS no\n+MAP yes\n+DATE Wed Jan 25 22:55:01 2012\n+NSEQ 32\n+EFFN 3.136719\n+CKSUM 2659440974\n+STATS LOCAL MSV -8.2375 0.71932\n+STATS LOCAL VITERBI -7.5917 0.71932\n+STATS LOCAL FORWARD -3.9020 0.71932\n+HMM A C G T \n+ m->m m->i m->d i->m i->i d->m d->d\n+ COMPO 1.72251 1.15807 1.14566 1.66454\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03820 3.97720 3.97720 1.46634 0.26236 0.00000 *\n+ 1 3.02702 2.55588 3.07751 0.18893 1 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03820 3.97720 3.97720 1.46634 0.26236 1.09861 0.40547\n+ 2 2.90418 3.52505 0.12426 3.42332 2 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03820 3.97720 3.97720 1.46634 0.26236 1.09861 0.40547\n+ 3 3.36220 0.13900 3.41461 2.77708 3 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03820 3.97720 3.97720 1.46634 0.26236 1.09861 0.40547\n+ 4 2.90418 3.52505 0.12426 3.42332 4 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03820 3.97720 3.97720 1.46634 0.26236 1.09861 0.40547\n+ 5 3.36220 0.13900 3.41461 2.77708 5 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03820 3.97720 3.97720 1.46634 0.26236 1.09861 0.40547\n+ 6 3.36220 0.13900 3.41461 2.77708 6 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03820 3.97720 3.97720 1.46634 0.26236 1.09861 0.40547\n+ 7 3.36220 0.13900 3.41461 2.77708 7 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03820 3.97720 3.97720 1.46634 0.26236 1.09861 0.40547\n+ 8 2.90418 3.52505 0.12426 3.42332 8 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03820 3.97720 3.97720 1.46634 0.26236 1.09861 0.40547\n+ 9 0.15028 3.31884 2.76184 3.21476 9 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03820 3.97720 3.97720 1.46634 0.26236 1.09861 0.40547\n+ 10 2.90418 3.52505 0.12426 3.42332 10 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03820 3.97720 3.97720 1.46634 0.26236 1.09861 0.40547\n+ 11 2.90418 3.52505 0.12426 3.42332 11 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03820 3.97720 3.97720 1.46634 0.26236 1.09861 0.40547\n+ 12 3.36220 0.13900 3.41461 2.77708 12 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03820 3.97720 3.97720 1.46634 0.26236 1.09861 0.40547\n+ 13 3.02702 2.55588 3.07751 0.18893 13 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03820 3.97720 3.97720 1.46634 0.26236 1.09861 0.40547\n+ 14 3.36220 0.13900 3.41461 2.77708 14 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03820 3.97720 3.97720 1.46634 0.26236 1.09861 0.40547\n+ 15 2.90418 3.52505 0.12426 3.42332 15 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03820 3.97720 3.97720 1.46634 0.26236 1.09861 0.40547\n+ 16 0.15028 3.31884 2.76184 3.21476 16 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03820 3.97720 3.97720 1.46634 0.26236 1.09861 0.40547\n+ 17 3.36220 0.13900 3.41461 2.77708 17 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03820 3.97720 3.97720 1.46634 0.26236 1.09861 0.40547\n+ 18 3.36220 0.13900 3.41461 2.77708 18 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03820 3.97720 3.97720 1.46634 0.26236 1.09861 0.40547\n+ 19 2.90418 3.52505 0.12426 3.42332 19 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03820 3.97720 3.97720 1.46634 0.26236 1.09861 0.40547\n+ 20 0.15028 3.31884 2.7618'..b'- -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 24 3.10096 2.60299 3.14864 0.17670 24 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 25 2.95603 3.60014 0.11581 3.50610 25 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 26 0.14029 3.39248 2.80985 3.29530 26 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 27 0.14029 3.39248 2.80985 3.29530 27 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 28 3.44718 0.12854 3.49604 2.83923 28 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 29 3.44718 0.12854 3.49604 2.83923 29 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 30 3.10096 2.60299 3.14864 0.17670 30 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 31 2.95603 3.60014 0.11581 3.50610 31 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 32 3.44718 0.12854 3.49604 2.83923 32 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 33 2.95603 3.60014 0.11581 3.50610 33 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 34 2.95603 3.60014 0.11581 3.50610 34 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 35 0.14029 3.39248 2.80985 3.29530 35 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 36 0.14029 3.39248 2.80985 3.29530 36 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 37 2.95603 3.60014 0.11581 3.50610 37 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 38 2.95603 3.60014 0.11581 3.50610 38 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 39 0.14029 3.39248 2.80985 3.29530 39 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 40 3.10096 2.60299 3.14864 0.17670 40 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 41 3.44718 0.12854 3.49604 2.83923 41 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 42 0.14029 3.39248 2.80985 3.29530 42 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 43 3.10096 2.60299 3.14864 0.17670 43 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 44 3.10096 2.60299 3.14864 0.17670 44 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03663 4.01838 4.01838 1.46634 0.26236 1.09861 0.40547\n+ 45 2.95603 3.60014 0.11581 3.50610 45 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01848 4.00023 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/B.hmm.h3f |
| b |
| Binary file ITSx_db/HMMs/B.hmm.h3f has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/B.hmm.h3i |
| b |
| Binary file ITSx_db/HMMs/B.hmm.h3i has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/B.hmm.h3m |
| b |
| Binary file ITSx_db/HMMs/B.hmm.h3m has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/B.hmm.h3p |
| b |
| Binary file ITSx_db/HMMs/B.hmm.h3p has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/C.hmm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ITSx_db/HMMs/C.hmm Mon Mar 14 16:15:08 2016 -0400 |
| [ |
| b'@@ -0,0 +1,3100 @@\n+HMMER3/b [3.0 | March 2010]\n+NAME 3_End_Bacillariophyta_58S_end_eight_long\n+LENG 45\n+ALPH DNA\n+RF no\n+CS no\n+MAP yes\n+DATE Fri Jan 20 11:42:32 2012\n+NSEQ 5\n+EFFN 3.325195\n+CKSUM 993487011\n+STATS LOCAL MSV -8.1073 0.71931\n+STATS LOCAL VITERBI -7.7843 0.71931\n+STATS LOCAL FORWARD -3.8720 0.71931\n+HMM A C G T \n+ m->m m->i m->d i->m i->i d->m d->d\n+ COMPO 1.47720 1.44778 1.45140 1.19603\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03687 4.01190 4.01190 1.46634 0.26236 0.00000 *\n+ 1 2.94809 3.58857 0.11707 3.49333 1 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03687 4.01190 4.01190 1.46634 0.26236 1.09861 0.40547\n+ 2 3.43404 0.13010 3.48346 2.82967 2 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03687 4.01190 4.01190 1.46634 0.26236 1.09861 0.40547\n+ 3 2.94809 3.58857 0.11707 3.49333 3 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03687 4.01190 4.01190 1.46634 0.26236 1.09861 0.40547\n+ 4 3.43404 0.13010 3.48346 2.82967 4 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03687 4.01190 4.01190 1.46634 0.26236 1.09861 0.40547\n+ 5 3.08942 2.59566 3.13755 0.17855 5 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03687 4.01190 4.01190 1.46634 0.26236 1.09861 0.40547\n+ 6 0.14179 3.38107 2.80245 3.28281 6 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03687 4.01190 4.01190 1.46634 0.26236 1.09861 0.40547\n+ 7 3.43404 0.13010 3.48346 2.82967 7 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03687 4.01190 4.01190 1.46634 0.26236 1.09861 0.40547\n+ 8 3.08942 2.59566 3.13755 0.17855 8 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03687 4.01190 4.01190 1.46634 0.26236 1.09861 0.40547\n+ 9 2.94809 3.58857 0.11707 3.49333 9 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03687 4.01190 4.01190 1.46634 0.26236 1.09861 0.40547\n+ 10 0.14179 3.38107 2.80245 3.28281 10 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03687 4.01190 4.01190 1.46634 0.26236 1.09861 0.40547\n+ 11 2.94809 3.58857 0.11707 3.49333 11 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03687 4.01190 4.01190 1.46634 0.26236 1.09861 0.40547\n+ 12 3.08942 2.59566 3.13755 0.17855 12 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03687 4.01190 4.01190 1.46634 0.26236 1.09861 0.40547\n+ 13 0.14179 3.38107 2.80245 3.28281 13 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03687 4.01190 4.01190 1.46634 0.26236 1.09861 0.40547\n+ 14 0.14179 3.38107 2.80245 3.28281 14 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03687 4.01190 4.01190 1.46634 0.26236 1.09861 0.40547\n+ 15 3.08942 2.59566 3.13755 0.17855 15 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03687 4.01190 4.01190 1.46634 0.26236 1.09861 0.40547\n+ 16 3.43404 0.13010 3.48346 2.82967 16 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03687 4.01190 4.01190 1.46634 0.26236 1.09861 0.40547\n+ 17 3.08942 2.59566 3.13755 0.17855 17 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03687 4.01190 4.01190 1.46634 0.26236 1.09861 0.40547\n+ 18 3.43404 0.13010 3.48346 2.82967 18 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03687 4.01190 4.01190 1.46634 0.26236 1.09861 0.40547\n+ 19 0.14179 3.38107 2.80245 3.28281 19 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03687 4.01190 4.01190 1.46634 0.26236 1.09861 0.40547\n+ 20 2.94809 3.58857 0'..b'- -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 24 3.05675 2.57485 3.10612 0.18390 24 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 25 2.92530 3.55551 0.12075 3.45686 25 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 26 0.14615 3.34859 2.78130 3.24727 26 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 27 0.14615 3.34859 2.78130 3.24727 27 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 28 3.39657 0.13465 3.44756 2.80232 28 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 29 3.39657 0.13465 3.44756 2.80232 29 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 30 3.05675 2.57485 3.10612 0.18390 30 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 31 2.92530 3.55551 0.12075 3.45686 31 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 32 3.39657 0.13465 3.44756 2.80232 32 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 33 2.92530 3.55551 0.12075 3.45686 33 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 34 2.92530 3.55551 0.12075 3.45686 34 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 35 0.14615 3.34859 2.78130 3.24727 35 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 36 0.14615 3.34859 2.78130 3.24727 36 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 37 2.92530 3.55551 0.12075 3.45686 37 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 38 2.92530 3.55551 0.12075 3.45686 38 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 39 0.14615 3.34859 2.78130 3.24727 39 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 40 3.05675 2.57485 3.10612 0.18390 40 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 41 3.39657 0.13465 3.44756 2.80232 41 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 42 0.14615 3.34859 2.78130 3.24727 42 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 43 3.05675 2.57485 3.10612 0.18390 43 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 44 3.05675 2.57485 3.10612 0.18390 44 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 45 0.14615 3.34859 2.78130 3.24727 45 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01896 3.97506 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/C.hmm.h3f |
| b |
| Binary file ITSx_db/HMMs/C.hmm.h3f has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/C.hmm.h3i |
| b |
| Binary file ITSx_db/HMMs/C.hmm.h3i has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/C.hmm.h3m |
| b |
| Binary file ITSx_db/HMMs/C.hmm.h3m has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/C.hmm.h3p |
| b |
| Binary file ITSx_db/HMMs/C.hmm.h3p has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/D.hmm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ITSx_db/HMMs/D.hmm Mon Mar 14 16:15:08 2016 -0400 |
| [ |
| b'@@ -0,0 +1,3875 @@\n+HMMER3/b [3.0 | March 2010]\n+NAME 3_End_Amoebozoa_58S_end_four_long\n+LENG 45\n+ALPH DNA\n+RF no\n+CS no\n+MAP yes\n+DATE Fri Jan 20 23:03:49 2012\n+NSEQ 5\n+EFFN 3.198242\n+CKSUM 1352929219\n+STATS LOCAL MSV -8.1195 0.71934\n+STATS LOCAL VITERBI -7.8448 0.71934\n+STATS LOCAL FORWARD -3.8579 0.71934\n+HMM A C G T \n+ m->m m->i m->d i->m i->i d->m d->d\n+ COMPO 2.36165 1.09112 1.20867 1.30453\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03775 3.98866 3.98866 1.46634 0.26236 0.00000 *\n+ 1 0.14739 3.33958 2.77542 3.23743 1 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03775 3.98866 3.98866 1.46634 0.26236 1.09861 0.40547\n+ 2 3.38618 0.13595 3.43760 2.79470 2 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03775 3.98866 3.98866 1.46634 0.26236 1.09861 0.40547\n+ 3 2.91894 3.54631 0.12180 3.44673 3 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03775 3.98866 3.98866 1.46634 0.26236 1.09861 0.40547\n+ 4 3.04773 2.56910 3.09744 0.18541 4 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03775 3.98866 3.98866 1.46634 0.26236 1.09861 0.40547\n+ 5 2.91894 3.54631 0.12180 3.44673 5 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03775 3.98866 3.98866 1.46634 0.26236 1.09861 0.40547\n+ 6 3.38618 0.13595 3.43760 2.79470 6 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03775 3.98866 3.98866 1.46634 0.26236 1.09861 0.40547\n+ 7 2.91894 3.54631 0.12180 3.44673 7 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03775 3.98866 3.98866 1.46634 0.26236 1.09861 0.40547\n+ 8 2.91894 3.54631 0.12180 3.44673 8 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03775 3.98866 3.98866 1.46634 0.26236 1.09861 0.40547\n+ 9 3.38618 0.13595 3.43760 2.79470 9 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03775 3.98866 3.98866 1.46634 0.26236 1.09861 0.40547\n+ 10 3.38618 0.13595 3.43760 2.79470 10 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03775 3.98866 3.98866 1.46634 0.26236 1.09861 0.40547\n+ 11 3.04773 2.56910 3.09744 0.18541 11 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03775 3.98866 3.98866 1.46634 0.26236 1.09861 0.40547\n+ 12 3.38618 0.13595 3.43760 2.79470 12 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03775 3.98866 3.98866 1.46634 0.26236 1.09861 0.40547\n+ 13 2.91894 3.54631 0.12180 3.44673 13 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03775 3.98866 3.98866 1.46634 0.26236 1.09861 0.40547\n+ 14 3.04773 2.56910 3.09744 0.18541 14 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03775 3.98866 3.98866 1.46634 0.26236 1.09861 0.40547\n+ 15 3.38618 0.13595 3.43760 2.79470 15 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03775 3.98866 3.98866 1.46634 0.26236 1.09861 0.40547\n+ 16 3.04773 2.56910 3.09744 0.18541 16 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03775 3.98866 3.98866 1.46634 0.26236 1.09861 0.40547\n+ 17 3.04773 2.56910 3.09744 0.18541 17 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03775 3.98866 3.98866 1.46634 0.26236 1.09861 0.40547\n+ 18 3.38618 0.13595 3.43760 2.79470 18 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03775 3.98866 3.98866 1.46634 0.26236 1.09861 0.40547\n+ 19 2.91894 3.54631 0.12180 3.44673 19 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03775 3.98866 3.98866 1.46634 0.26236 1.09861 0.40547\n+ 20 2.91894 3.54631 0.12180'..b'- -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 24 3.10566 2.60598 3.15316 0.17595 24 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 25 2.95925 3.60483 0.11531 3.51128 25 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 26 0.13969 3.39712 2.81286 3.30038 26 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 27 0.13969 3.39712 2.81286 3.30038 27 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 28 3.45252 0.12792 3.50115 2.84311 28 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 29 3.45252 0.12792 3.50115 2.84311 29 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 30 3.10566 2.60598 3.15316 0.17595 30 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 31 2.95925 3.60483 0.11531 3.51128 31 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 32 3.45252 0.12792 3.50115 2.84311 32 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 33 2.71968 2.72902 0.19871 3.01523 33 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 34 2.95925 3.60483 0.11531 3.51128 34 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 35 0.13969 3.39712 2.81286 3.30038 35 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 36 3.10566 2.60598 3.15316 0.17595 36 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 37 2.95925 3.60483 0.11531 3.51128 37 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 38 2.95925 3.60483 0.11531 3.51128 38 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 39 0.13969 3.39712 2.81286 3.30038 39 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 40 3.10566 2.60598 3.15316 0.17595 40 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 41 3.45252 0.12792 3.50115 2.84311 41 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 42 0.13969 3.39712 2.81286 3.30038 42 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 43 3.10566 2.60598 3.15316 0.17595 43 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 44 3.10566 2.60598 3.15316 0.17595 44 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03653 4.02102 4.02102 1.46634 0.26236 1.09861 0.40547\n+ 45 2.33315 2.44141 2.77551 0.28282 45 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01843 4.00292 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/D.hmm.h3f |
| b |
| Binary file ITSx_db/HMMs/D.hmm.h3f has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/D.hmm.h3i |
| b |
| Binary file ITSx_db/HMMs/D.hmm.h3i has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/D.hmm.h3m |
| b |
| Binary file ITSx_db/HMMs/D.hmm.h3m has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/D.hmm.h3p |
| b |
| Binary file ITSx_db/HMMs/D.hmm.h3p has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/E.hmm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ITSx_db/HMMs/E.hmm Mon Mar 14 16:15:08 2016 -0400 |
| [ |
| b'@@ -0,0 +1,2170 @@\n+HMMER3/b [3.0 | March 2010]\n+NAME 3_End_Euglenozoa_58S_end_five_long\n+LENG 45\n+ALPH DNA\n+RF no\n+CS no\n+MAP yes\n+DATE Fri Jan 20 21:20:25 2012\n+NSEQ 5\n+EFFN 3.305664\n+CKSUM 1011588078\n+STATS LOCAL MSV -8.1772 0.71930\n+STATS LOCAL VITERBI -7.8656 0.71930\n+STATS LOCAL FORWARD -3.6513 0.71930\n+HMM A C G T \n+ m->m m->i m->d i->m i->i d->m d->d\n+ COMPO 1.83104 0.97779 1.32465 1.62094\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03700 4.00836 4.00836 1.46634 0.26236 0.00000 *\n+ 1 3.42681 0.13096 3.47654 2.82441 1 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03700 4.00836 4.00836 1.46634 0.26236 1.09861 0.40547\n+ 2 3.42681 0.13096 3.47654 2.82441 2 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03700 4.00836 4.00836 1.46634 0.26236 1.09861 0.40547\n+ 3 3.42681 0.13096 3.47654 2.82441 3 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03700 4.00836 4.00836 1.46634 0.26236 1.09861 0.40547\n+ 4 3.42681 0.13096 3.47654 2.82441 4 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03700 4.00836 4.00836 1.46634 0.26236 1.09861 0.40547\n+ 5 2.43822 1.17704 2.50879 0.64793 5 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03700 4.00836 4.00836 1.46634 0.26236 1.09861 0.40547\n+ 6 3.42681 0.13096 3.47654 2.82441 6 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03700 4.00836 4.00836 1.46634 0.26236 1.09861 0.40547\n+ 7 2.94371 3.58221 0.11777 3.48630 7 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03700 4.00836 4.00836 1.46634 0.26236 1.09861 0.40547\n+ 8 2.94371 3.58221 0.11777 3.48630 8 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03700 4.00836 4.00836 1.46634 0.26236 1.09861 0.40547\n+ 9 2.94371 3.58221 0.11777 3.48630 9 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03700 4.00836 4.00836 1.46634 0.26236 1.09861 0.40547\n+ 10 2.94371 3.58221 0.11777 3.48630 10 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03700 4.00836 4.00836 1.46634 0.26236 1.09861 0.40547\n+ 11 2.66304 1.70497 2.72642 0.38121 11 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03700 4.00836 4.00836 1.46634 0.26236 1.09861 0.40547\n+ 12 3.42681 0.13096 3.47654 2.82441 12 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03700 4.00836 4.00836 1.46634 0.26236 1.09861 0.40547\n+ 13 0.14262 3.37480 2.79837 3.27595 13 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03700 4.00836 4.00836 1.46634 0.26236 1.09861 0.40547\n+ 14 3.08310 2.59163 3.13146 0.17957 14 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03700 4.00836 4.00836 1.46634 0.26236 1.09861 0.40547\n+ 15 3.42681 0.13096 3.47654 2.82441 15 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03700 4.00836 4.00836 1.46634 0.26236 1.09861 0.40547\n+ 16 3.42681 0.13096 3.47654 2.82441 16 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03700 4.00836 4.00836 1.46634 0.26236 1.09861 0.40547\n+ 17 3.42681 0.13096 3.47654 2.82441 17 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03700 4.00836 4.00836 1.46634 0.26236 1.09861 0.40547\n+ 18 3.42681 0.13096 3.47654 2.82441 18 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03700 4.00836 4.00836 1.46634 0.26236 1.09861 0.40547\n+ 19 2.94371 3.58221 0.11777 3.48630 19 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03700 4.00836 4.00836 1.46634 0.26236 1.09861 0.40547\n+ 20 3.08310 2.59163 3.1314'..b'- -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 24 0.15719 3.27118 2.73043 3.16274 24 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 25 3.30705 0.14631 3.36166 2.73626 25 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 26 3.30705 0.14631 3.36166 2.73626 26 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 27 2.97980 2.52563 3.03204 0.19727 27 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 28 2.86982 3.47591 0.13017 3.36931 28 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 29 3.30705 0.14631 3.36166 2.73626 29 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 30 0.15719 3.27118 2.73043 3.16274 30 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 31 2.86982 3.47591 0.13017 3.36931 31 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 32 3.30705 0.14631 3.36166 2.73626 32 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 33 0.15719 3.27118 2.73043 3.16274 33 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 34 2.86982 3.47591 0.13017 3.36931 34 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 35 3.30705 0.14631 3.36166 2.73626 35 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 36 2.97980 2.52563 3.03204 0.19727 36 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 37 2.86982 3.47591 0.13017 3.36931 37 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 38 2.86982 3.47591 0.13017 3.36931 38 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 39 0.15719 3.27118 2.73043 3.16274 39 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 40 2.97980 2.52563 3.03204 0.19727 40 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 41 3.30705 0.14631 3.36166 2.73626 41 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 42 0.15719 3.27118 2.73043 3.16274 42 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 43 2.97980 2.52563 3.03204 0.19727 43 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 44 2.97980 2.52563 3.03204 0.19727 44 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03922 3.95124 3.95124 1.46634 0.26236 1.09861 0.40547\n+ 45 2.97980 2.52563 3.03204 0.19727 45 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01980 3.93183 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/E.hmm.h3f |
| b |
| Binary file ITSx_db/HMMs/E.hmm.h3f has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/E.hmm.h3i |
| b |
| Binary file ITSx_db/HMMs/E.hmm.h3i has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/E.hmm.h3m |
| b |
| Binary file ITSx_db/HMMs/E.hmm.h3m has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/E.hmm.h3p |
| b |
| Binary file ITSx_db/HMMs/E.hmm.h3p has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/F.hmm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ITSx_db/HMMs/F.hmm Mon Mar 14 16:15:08 2016 -0400 |
| [ |
| b'@@ -0,0 +1,65255 @@\n+HMMER3/b [3.0 | March 2010]\n+NAME 3_End_Fungi_Ca_58S_end_one_long\n+LENG 45\n+ALPH DNA\n+RF no\n+CS no\n+MAP yes\n+DATE Tue Feb 7 14:07:35 2012\n+NSEQ 24\n+EFFN 3.272461\n+CKSUM 1239174981\n+STATS LOCAL MSV -8.1718 0.71931\n+STATS LOCAL VITERBI -7.7338 0.71931\n+STATS LOCAL FORWARD -3.5765 0.71931\n+HMM A C G T \n+ m->m m->i m->d i->m i->i d->m d->d\n+ COMPO 1.36710 1.94048 0.91540 1.60363\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03723 4.00231 4.00231 1.46634 0.26236 0.00000 *\n+ 1 2.93618 3.57128 0.11898 3.47424 1 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03723 4.00231 4.00231 1.46634 0.26236 1.09861 0.40547\n+ 2 3.07227 2.58474 3.12105 0.18133 2 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03723 4.00231 4.00231 1.46634 0.26236 1.09861 0.40547\n+ 3 2.93618 3.57128 0.11898 3.47424 3 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03723 4.00231 4.00231 1.46634 0.26236 1.09861 0.40547\n+ 4 2.93618 3.57128 0.11898 3.47424 4 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03723 4.00231 4.00231 1.46634 0.26236 1.09861 0.40547\n+ 5 3.41442 0.13246 3.46466 2.81537 5 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03723 4.00231 4.00231 1.46634 0.26236 1.09861 0.40547\n+ 6 2.93618 3.57128 0.11898 3.47424 6 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03723 4.00231 4.00231 1.46634 0.26236 1.09861 0.40547\n+ 7 2.93618 3.57128 0.11898 3.47424 7 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03723 4.00231 4.00231 1.46634 0.26236 1.09861 0.40547\n+ 8 0.14405 3.36405 2.79138 3.26418 8 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03723 4.00231 4.00231 1.46634 0.26236 1.09861 0.40547\n+ 9 2.93618 3.57128 0.11898 3.47424 9 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03723 4.00231 4.00231 1.46634 0.26236 1.09861 0.40547\n+ 10 2.93618 3.57128 0.11898 3.47424 10 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03723 4.00231 4.00231 1.46634 0.26236 1.09861 0.40547\n+ 11 0.14405 3.36405 2.79138 3.26418 11 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03723 4.00231 4.00231 1.46634 0.26236 1.09861 0.40547\n+ 12 3.07227 2.58474 3.12105 0.18133 12 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03723 4.00231 4.00231 1.46634 0.26236 1.09861 0.40547\n+ 13 2.93618 3.57128 0.11898 3.47424 13 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03723 4.00231 4.00231 1.46634 0.26236 1.09861 0.40547\n+ 14 0.14405 3.36405 2.79138 3.26418 14 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03723 4.00231 4.00231 1.46634 0.26236 1.09861 0.40547\n+ 15 0.14405 3.36405 2.79138 3.26418 15 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03723 4.00231 4.00231 1.46634 0.26236 1.09861 0.40547\n+ 16 2.93618 3.57128 0.11898 3.47424 16 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03723 4.00231 4.00231 1.46634 0.26236 1.09861 0.40547\n+ 17 0.14405 3.36405 2.79138 3.26418 17 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03723 4.00231 4.00231 1.46634 0.26236 1.09861 0.40547\n+ 18 3.41442 0.13246 3.46466 2.81537 18 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03723 4.00231 4.00231 1.46634 0.26236 1.09861 0.40547\n+ 19 0.14405 3.36405 2.79138 3.26418 19 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03723 4.00231 4.00231 1.46634 0.26236 1.09861 0.40547\n+ 20 0.14405 3.36405 2.79138'..b'- -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 24 2.53331 3.02441 0.20344 2.88069 24 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 25 2.53331 3.02441 0.20344 2.88069 25 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 26 0.23862 2.84929 2.43386 2.70756 26 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 27 0.23862 2.84929 2.43386 2.70756 27 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 28 2.81865 0.23582 2.88868 2.35662 28 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 29 2.81865 0.23582 2.88868 2.35662 29 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 30 2.57915 2.25909 2.64442 0.28946 30 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 31 2.53331 3.02441 0.20344 2.88069 31 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 32 2.81865 0.23582 2.88868 2.35662 32 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 33 2.53331 3.02441 0.20344 2.88069 33 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 34 2.53331 3.02441 0.20344 2.88069 34 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 35 0.23862 2.84929 2.43386 2.70756 35 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 36 0.23862 2.84929 2.43386 2.70756 36 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 37 2.53331 3.02441 0.20344 2.88069 37 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 38 2.53331 3.02441 0.20344 2.88069 38 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 39 0.23862 2.84929 2.43386 2.70756 39 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 40 2.57915 2.25909 2.64442 0.28946 40 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 41 2.81865 0.23582 2.88868 2.35662 41 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 42 0.23862 2.84929 2.43386 2.70756 42 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 43 2.57915 2.25909 2.64442 0.28946 43 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 44 2.57915 2.25909 2.64442 0.28946 44 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 45 0.23862 2.84929 2.43386 2.70756 45 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02469 3.71357 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/F.hmm.h3f |
| b |
| Binary file ITSx_db/HMMs/F.hmm.h3f has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/F.hmm.h3i |
| b |
| Binary file ITSx_db/HMMs/F.hmm.h3i has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/F.hmm.h3m |
| b |
| Binary file ITSx_db/HMMs/F.hmm.h3m has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/F.hmm.h3p |
| b |
| Binary file ITSx_db/HMMs/F.hmm.h3p has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/G.hmm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ITSx_db/HMMs/G.hmm Mon Mar 14 16:15:08 2016 -0400 |
| [ |
| b'@@ -0,0 +1,8370 @@\n+HMMER3/b [3.0 | March 2010]\n+NAME 3_End_Chlorophyta_58S_end_eight_long\n+LENG 45\n+ALPH DNA\n+RF no\n+CS no\n+MAP yes\n+DATE Sat Jan 28 01:06:57 2012\n+NSEQ 8\n+EFFN 3.128906\n+CKSUM 1519682346\n+STATS LOCAL MSV -8.1109 0.71934\n+STATS LOCAL VITERBI -7.7889 0.71934\n+STATS LOCAL FORWARD -3.6308 0.71934\n+HMM A C G T \n+ m->m m->i m->d i->m i->i d->m d->d\n+ COMPO 2.06483 0.95712 1.26884 1.57019\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03825 3.97573 3.97573 1.46634 0.26236 0.00000 *\n+ 1 3.35912 0.13939 3.41165 2.77481 1 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03825 3.97573 3.97573 1.46634 0.26236 1.09861 0.40547\n+ 2 2.90228 3.52232 0.12458 3.42031 2 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03825 3.97573 3.97573 1.46634 0.26236 1.09861 0.40547\n+ 3 3.35912 0.13939 3.41165 2.77481 3 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03825 3.97573 3.97573 1.46634 0.26236 1.09861 0.40547\n+ 4 3.35912 0.13939 3.41165 2.77481 4 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03825 3.97573 3.97573 1.46634 0.26236 1.09861 0.40547\n+ 5 3.35912 0.13939 3.41165 2.77481 5 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03825 3.97573 3.97573 1.46634 0.26236 1.09861 0.40547\n+ 6 3.35912 0.13939 3.41165 2.77481 6 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03825 3.97573 3.97573 1.46634 0.26236 1.09861 0.40547\n+ 7 0.15066 3.31617 2.76009 3.21184 7 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03825 3.97573 3.97573 1.46634 0.26236 1.09861 0.40547\n+ 8 3.35912 0.13939 3.41165 2.77481 8 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03825 3.97573 3.97573 1.46634 0.26236 1.09861 0.40547\n+ 9 2.90228 3.52232 0.12458 3.42031 9 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03825 3.97573 3.97573 1.46634 0.26236 1.09861 0.40547\n+ 10 2.90228 3.52232 0.12458 3.42031 10 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03825 3.97573 3.97573 1.46634 0.26236 1.09861 0.40547\n+ 11 3.35912 0.13939 3.41165 2.77481 11 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03825 3.97573 3.97573 1.46634 0.26236 1.09861 0.40547\n+ 12 3.35912 0.13939 3.41165 2.77481 12 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03825 3.97573 3.97573 1.46634 0.26236 1.09861 0.40547\n+ 13 3.02437 2.55419 3.07496 0.18939 13 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03825 3.97573 3.97573 1.46634 0.26236 1.09861 0.40547\n+ 14 3.35912 0.13939 3.41165 2.77481 14 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03825 3.97573 3.97573 1.46634 0.26236 1.09861 0.40547\n+ 15 2.90228 3.52232 0.12458 3.42031 15 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03825 3.97573 3.97573 1.46634 0.26236 1.09861 0.40547\n+ 16 2.90228 3.52232 0.12458 3.42031 16 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03825 3.97573 3.97573 1.46634 0.26236 1.09861 0.40547\n+ 17 3.35912 0.13939 3.41165 2.77481 17 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03825 3.97573 3.97573 1.46634 0.26236 1.09861 0.40547\n+ 18 3.35912 0.13939 3.41165 2.77481 18 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03825 3.97573 3.97573 1.46634 0.26236 1.09861 0.40547\n+ 19 3.35912 0.13939 3.41165 2.77481 19 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03825 3.97573 3.97573 1.46634 0.26236 1.09861 0.40547\n+ 20 0.15066 3.31617 2.76'..b'- -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 24 3.05375 2.57294 3.10323 0.18440 24 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 25 2.92319 3.55246 0.12110 3.45350 25 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 26 0.14656 3.34560 2.77935 3.24400 26 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 27 0.14656 3.34560 2.77935 3.24400 27 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 28 3.39312 0.13508 3.44425 2.79979 28 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 29 3.39312 0.13508 3.44425 2.79979 29 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 30 3.05375 2.57294 3.10323 0.18440 30 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 31 2.92319 3.55246 0.12110 3.45350 31 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 32 3.39312 0.13508 3.44425 2.79979 32 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 33 2.92319 3.55246 0.12110 3.45350 33 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 34 2.92319 3.55246 0.12110 3.45350 34 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 35 0.14656 3.34560 2.77935 3.24400 35 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 36 0.14656 3.34560 2.77935 3.24400 36 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 37 2.92319 3.55246 0.12110 3.45350 37 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 38 2.92319 3.55246 0.12110 3.45350 38 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 39 0.14656 3.34560 2.77935 3.24400 39 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 40 3.05375 2.57294 3.10323 0.18440 40 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 41 3.39312 0.13508 3.44425 2.79979 41 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 42 0.14656 3.34560 2.77935 3.24400 42 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 43 3.05375 2.57294 3.10323 0.18440 43 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 44 3.05375 2.57294 3.10323 0.18440 44 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03762 3.99200 3.99200 1.46634 0.26236 1.09861 0.40547\n+ 45 2.92319 3.55246 0.12110 3.45350 45 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01899 3.97336 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/G.hmm.h3f |
| b |
| Binary file ITSx_db/HMMs/G.hmm.h3f has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/G.hmm.h3i |
| b |
| Binary file ITSx_db/HMMs/G.hmm.h3i has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/G.hmm.h3m |
| b |
| Binary file ITSx_db/HMMs/G.hmm.h3m has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/G.hmm.h3p |
| b |
| Binary file ITSx_db/HMMs/G.hmm.h3p has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/H.hmm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ITSx_db/HMMs/H.hmm Mon Mar 14 16:15:08 2016 -0400 |
| [ |
| b'@@ -0,0 +1,3720 @@\n+HMMER3/b [3.0 | March 2010]\n+NAME 3_End_Rhodophyta_58S_end_four_long\n+LENG 45\n+ALPH DNA\n+RF no\n+CS no\n+MAP yes\n+DATE Wed Jan 25 21:56:19 2012\n+NSEQ 2\n+EFFN 2.000000\n+CKSUM 3310020795\n+STATS LOCAL MSV -7.3962 0.72785\n+STATS LOCAL VITERBI -8.3431 0.72785\n+STATS LOCAL FORWARD -3.4147 0.72785\n+HMM A C G T \n+ m->m m->i m->d i->m i->i d->m d->d\n+ COMPO 1.39505 1.59495 1.20617 1.38662\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 0.00000 *\n+ 1 2.53331 3.02441 0.20344 2.88069 1 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 2 2.81865 0.23582 2.88868 2.35662 2 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 3 2.53331 3.02441 0.20344 2.88069 3 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 4 2.81865 0.23582 2.88868 2.35662 4 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 5 2.57915 2.25909 2.64442 0.28946 5 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 6 2.81865 0.23582 2.88868 2.35662 6 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 7 2.57915 2.25909 2.64442 0.28946 7 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 8 2.81865 0.23582 2.88868 2.35662 8 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 9 2.53331 3.02441 0.20344 2.88069 9 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 10 2.53331 3.02441 0.20344 2.88069 10 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 11 2.53331 3.02441 0.20344 2.88069 11 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 12 2.57915 2.25909 2.64442 0.28946 12 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 13 0.23862 2.84929 2.43386 2.70756 13 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 14 0.23862 2.84929 2.43386 2.70756 14 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 15 2.57915 2.25909 2.64442 0.28946 15 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 16 2.81865 0.23582 2.88868 2.35662 16 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 17 2.81865 0.23582 2.88868 2.35662 17 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 18 2.57915 2.25909 2.64442 0.28946 18 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 19 2.53331 3.02441 0.20344 2.88069 19 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 20 2.53331 3.02441 0.2034'..b'- -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 24 3.41129 0.13284 3.46167 2.81309 24 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 25 0.14442 3.36134 2.78962 3.26122 25 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 26 3.06955 2.58301 3.11843 0.18178 26 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 27 2.93428 3.56852 0.11929 3.47120 27 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 28 3.06955 2.58301 3.11843 0.18178 28 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 29 3.41129 0.13284 3.46167 2.81309 29 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 30 3.06955 2.58301 3.11843 0.18178 30 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 31 2.93428 3.56852 0.11929 3.47120 31 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 32 3.06955 2.58301 3.11843 0.18178 32 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 33 3.06955 2.58301 3.11843 0.18178 33 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 34 3.06955 2.58301 3.11843 0.18178 34 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 35 2.93428 3.56852 0.11929 3.47120 35 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 36 0.14442 3.36134 2.78962 3.26122 36 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 37 2.93428 3.56852 0.11929 3.47120 37 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 38 3.06955 2.58301 3.11843 0.18178 38 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 39 2.93428 3.56852 0.11929 3.47120 39 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 40 3.06955 2.58301 3.11843 0.18178 40 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 41 3.41129 0.13284 3.46167 2.81309 41 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 42 0.14442 3.36134 2.78962 3.26122 42 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 43 3.41129 0.13284 3.46167 2.81309 43 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 44 3.06955 2.58301 3.11843 0.18178 44 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03729 4.00080 4.00080 1.46634 0.26236 1.09861 0.40547\n+ 45 3.06955 2.58301 3.11843 0.18178 45 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01882 3.98232 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/H.hmm.h3f |
| b |
| Binary file ITSx_db/HMMs/H.hmm.h3f has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/H.hmm.h3i |
| b |
| Binary file ITSx_db/HMMs/H.hmm.h3i has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/H.hmm.h3m |
| b |
| Binary file ITSx_db/HMMs/H.hmm.h3m has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/H.hmm.h3p |
| b |
| Binary file ITSx_db/HMMs/H.hmm.h3p has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/I.hmm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ITSx_db/HMMs/I.hmm Mon Mar 14 16:15:08 2016 -0400 |
| [ |
| b'@@ -0,0 +1,775 @@\n+HMMER3/b [3.0 | March 2010]\n+NAME 3_End_Phaeophyceae_58S_end_one_long\n+LENG 45\n+ALPH DNA\n+RF no\n+CS no\n+MAP yes\n+DATE Fri Jan 20 12:12:36 2012\n+NSEQ 157\n+EFFN 3.732391\n+CKSUM 82106143\n+STATS LOCAL MSV -6.9907 0.71931\n+STATS LOCAL VITERBI -7.6013 0.71931\n+STATS LOCAL FORWARD -3.9860 0.71931\n+HMM A C G T \n+ m->m m->i m->d i->m i->i d->m d->d\n+ COMPO 1.91751 1.41520 1.11917 1.26019\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03429 4.08301 4.08301 1.46634 0.26236 0.00000 *\n+ 1 3.57378 0.11461 3.61706 2.93034 1 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03429 4.08301 4.08301 1.46634 0.26236 1.09861 0.40547\n+ 2 3.03127 3.71067 0.10455 3.62844 2 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03429 4.08301 4.08301 1.46634 0.26236 1.09861 0.40547\n+ 3 3.57378 0.11461 3.61706 2.93034 3 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03429 4.08301 4.08301 1.46634 0.26236 1.09861 0.40547\n+ 4 3.21417 2.67481 3.25746 0.15969 4 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03429 4.08301 4.08301 1.46634 0.26236 1.09861 0.40547\n+ 5 3.21417 2.67481 3.25746 0.15969 5 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03429 4.08301 4.08301 1.46634 0.26236 1.09861 0.40547\n+ 6 3.57378 0.11461 3.61706 2.93034 6 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03429 4.08301 4.08301 1.46634 0.26236 1.09861 0.40547\n+ 7 3.57378 0.11461 3.61706 2.93034 7 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03429 4.08301 4.08301 1.46634 0.26236 1.09861 0.40547\n+ 8 3.03127 3.71067 0.10455 3.62844 8 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03429 4.08301 4.08301 1.46634 0.26236 1.09861 0.40547\n+ 9 3.03127 3.71067 0.10455 3.62844 9 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03429 4.08301 4.08301 1.46634 0.26236 1.09861 0.40547\n+ 10 3.03127 3.71067 0.10455 3.62844 10 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04253 4.08301 3.69765 1.46634 0.26236 1.09861 0.40547\n+ 11 0.15619 3.32897 2.80495 3.03107 11 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03457 4.07506 4.07506 1.46634 0.26236 0.85884 0.55105\n+ 12 1.83744 2.35418 2.56143 0.40256 12 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03429 4.08301 4.08301 1.46634 0.26236 1.09861 0.40547\n+ 13 0.12671 3.50290 2.88107 3.41642 13 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03429 4.08301 4.08301 1.46634 0.26236 1.09861 0.40547\n+ 14 2.61652 1.41576 2.68268 0.48480 14 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03429 4.08301 4.08301 1.46634 0.26236 1.09861 0.40547\n+ 15 2.01308 1.45171 1.26036 1.05354 15 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03429 4.08301 4.08301 1.46634 0.26236 1.09861 0.40547\n+ 16 3.57378 0.11461 3.61706 2.93034 16 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03429 4.08301 4.08301 1.46634 0.26236 1.09861 0.40547\n+ 17 3.57378 0.11461 3.61706 2.93034 17 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03429 4.08301 4.08301 1.46634 0.26236 1.09861 0.40547\n+ 18 3.14605 2.49866 3.19205 0.18189 18 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03429 4.08301 4.08301 1.46634 0.26236 1.09861 0.40547\n+ 19 3.03127 3.71067 0.10455 3.62844 19 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03429 4.08301 4.08301 1.46634 0.26236 1.09861 0.40547\n+ 20 3.03127 3.71067 0.1045'..b'- -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 24 3.05809 2.57571 3.10741 0.18367 24 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 25 2.92625 3.55688 0.12059 3.45837 25 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 26 0.14597 3.34993 2.78218 3.24874 26 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 27 0.14597 3.34993 2.78218 3.24874 27 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 28 3.39812 0.13446 3.44905 2.80346 28 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 29 3.39812 0.13446 3.44905 2.80346 29 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 30 3.05809 2.57571 3.10741 0.18367 30 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 31 2.92625 3.55688 0.12059 3.45837 31 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 32 3.39812 0.13446 3.44905 2.80346 32 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 33 2.92625 3.55688 0.12059 3.45837 33 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 34 2.92625 3.55688 0.12059 3.45837 34 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 35 0.14597 3.34993 2.78218 3.24874 35 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 36 0.14597 3.34993 2.78218 3.24874 36 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 37 2.92625 3.55688 0.12059 3.45837 37 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 38 2.92625 3.55688 0.12059 3.45837 38 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 39 0.14597 3.34993 2.78218 3.24874 39 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 40 3.05809 2.57571 3.10741 0.18367 40 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 41 3.39812 0.13446 3.44905 2.80346 41 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 42 0.14597 3.34993 2.78218 3.24874 42 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 43 3.05809 2.57571 3.10741 0.18367 43 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 44 3.05809 2.57571 3.10741 0.18367 44 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99441 3.99441 1.46634 0.26236 1.09861 0.40547\n+ 45 0.14597 3.34993 2.78218 3.24874 45 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01894 3.97582 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/I.hmm.h3f |
| b |
| Binary file ITSx_db/HMMs/I.hmm.h3f has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/I.hmm.h3i |
| b |
| Binary file ITSx_db/HMMs/I.hmm.h3i has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/I.hmm.h3m |
| b |
| Binary file ITSx_db/HMMs/I.hmm.h3m has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/I.hmm.h3p |
| b |
| Binary file ITSx_db/HMMs/I.hmm.h3p has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/L.hmm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ITSx_db/HMMs/L.hmm Mon Mar 14 16:15:08 2016 -0400 |
| [ |
| b'@@ -0,0 +1,6045 @@\n+HMMER3/b [3.0 | March 2010]\n+NAME 3_End_Marchantiophyta_58S_end_foura_long\n+LENG 45\n+ALPH DNA\n+RF no\n+CS no\n+MAP yes\n+DATE Wed Jan 25 17:48:18 2012\n+NSEQ 4\n+EFFN 3.089844\n+CKSUM 3677159024\n+STATS LOCAL MSV -8.1113 0.71933\n+STATS LOCAL VITERBI -7.8119 0.71933\n+STATS LOCAL FORWARD -3.9220 0.71933\n+HMM A C G T \n+ m->m m->i m->d i->m i->i d->m d->d\n+ COMPO 1.72586 1.10743 1.14821 1.74657\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03854 3.96837 3.96837 1.46634 0.26236 0.00000 *\n+ 1 3.34359 0.14142 3.39674 2.76335 1 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03854 3.96837 3.96837 1.46634 0.26236 1.09861 0.40547\n+ 2 2.89265 3.50850 0.12621 3.40512 2 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03854 3.96837 3.96837 1.46634 0.26236 1.09861 0.40547\n+ 3 3.34359 0.14142 3.39674 2.76335 3 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03854 3.96837 3.96837 1.46634 0.26236 1.09861 0.40547\n+ 4 3.34359 0.14142 3.39674 2.76335 4 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03854 3.96837 3.96837 1.46634 0.26236 1.09861 0.40547\n+ 5 3.34359 0.14142 3.39674 2.76335 5 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03854 3.96837 3.96837 1.46634 0.26236 1.09861 0.40547\n+ 6 2.89265 3.50850 0.12621 3.40512 6 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03854 3.96837 3.96837 1.46634 0.26236 1.09861 0.40547\n+ 7 0.15258 3.30274 2.75126 3.19718 7 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03854 3.96837 3.96837 1.46634 0.26236 1.09861 0.40547\n+ 8 2.89265 3.50850 0.12621 3.40512 8 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03854 3.96837 3.96837 1.46634 0.26236 1.09861 0.40547\n+ 9 2.89265 3.50850 0.12621 3.40512 9 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03854 3.96837 3.96837 1.46634 0.26236 1.09861 0.40547\n+ 10 3.01102 2.54565 3.06211 0.19171 10 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03854 3.96837 3.96837 1.46634 0.26236 1.09861 0.40547\n+ 11 3.34359 0.14142 3.39674 2.76335 11 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03854 3.96837 3.96837 1.46634 0.26236 1.09861 0.40547\n+ 12 3.01102 2.54565 3.06211 0.19171 12 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03854 3.96837 3.96837 1.46634 0.26236 1.09861 0.40547\n+ 13 3.34359 0.14142 3.39674 2.76335 13 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03854 3.96837 3.96837 1.46634 0.26236 1.09861 0.40547\n+ 14 2.89265 3.50850 0.12621 3.40512 14 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03854 3.96837 3.96837 1.46634 0.26236 1.09861 0.40547\n+ 15 3.01102 2.54565 3.06211 0.19171 15 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03854 3.96837 3.96837 1.46634 0.26236 1.09861 0.40547\n+ 16 0.15258 3.30274 2.75126 3.19718 16 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03854 3.96837 3.96837 1.46634 0.26236 1.09861 0.40547\n+ 17 3.34359 0.14142 3.39674 2.76335 17 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03854 3.96837 3.96837 1.46634 0.26236 1.09861 0.40547\n+ 18 3.34359 0.14142 3.39674 2.76335 18 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03854 3.96837 3.96837 1.46634 0.26236 1.09861 0.40547\n+ 19 2.89265 3.50850 0.12621 3.40512 19 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03854 3.96837 3.96837 1.46634 0.26236 1.09861 0.40547\n+ 20 0.15258 3.30274 '..b'- -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 24 3.05756 2.57537 3.10690 0.18376 24 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 25 2.92588 3.55634 0.12065 3.45778 25 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 26 0.14604 3.34940 2.78183 3.24816 26 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 27 0.14604 3.34940 2.78183 3.24816 27 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 28 3.39751 0.13454 3.44846 2.80301 28 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 29 3.39751 0.13454 3.44846 2.80301 29 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 30 3.05756 2.57537 3.10690 0.18376 30 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 31 2.92588 3.55634 0.12065 3.45778 31 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 32 3.39751 0.13454 3.44846 2.80301 32 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 33 2.92588 3.55634 0.12065 3.45778 33 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 34 2.92588 3.55634 0.12065 3.45778 34 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 35 0.14604 3.34940 2.78183 3.24816 35 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 36 0.14604 3.34940 2.78183 3.24816 36 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 37 2.92588 3.55634 0.12065 3.45778 37 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 38 2.92588 3.55634 0.12065 3.45778 38 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 39 0.14604 3.34940 2.78183 3.24816 39 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 40 3.05756 2.57537 3.10690 0.18376 40 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 41 3.39751 0.13454 3.44846 2.80301 41 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 42 0.14604 3.34940 2.78183 3.24816 42 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 43 3.05756 2.57537 3.10690 0.18376 43 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 44 3.05756 2.57537 3.10690 0.18376 44 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03754 3.99412 3.99412 1.46634 0.26236 1.09861 0.40547\n+ 45 2.92588 3.55634 0.12065 3.45778 45 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01895 3.97552 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/L.hmm.h3f |
| b |
| Binary file ITSx_db/HMMs/L.hmm.h3f has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/L.hmm.h3i |
| b |
| Binary file ITSx_db/HMMs/L.hmm.h3i has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/L.hmm.h3m |
| b |
| Binary file ITSx_db/HMMs/L.hmm.h3m has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/L.hmm.h3p |
| b |
| Binary file ITSx_db/HMMs/L.hmm.h3p has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/M.hmm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ITSx_db/HMMs/M.hmm Mon Mar 14 16:15:08 2016 -0400 |
| [ |
| b'@@ -0,0 +1,54870 @@\n+HMMER3/b [3.0 | March 2010]\n+NAME 3_End_Metazoa_58S_end_eight_long\n+LENG 45\n+ALPH DNA\n+RF no\n+CS no\n+MAP yes\n+DATE Sat Feb 25 14:35:27 2012\n+NSEQ 2\n+EFFN 2.000000\n+CKSUM 2003464747\n+STATS LOCAL MSV -7.3950 0.72793\n+STATS LOCAL VITERBI -8.3145 0.72793\n+STATS LOCAL FORWARD -3.2953 0.72793\n+HMM A C G T \n+ m->m m->i m->d i->m i->i d->m d->d\n+ COMPO 1.58596 1.45659 1.21394 1.32730\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 0.00000 *\n+ 1 2.57915 2.25909 2.64442 0.28946 1 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 2 2.81865 0.23582 2.88868 2.35662 2 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 3 0.23862 2.84929 2.43386 2.70756 3 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 4 2.53331 3.02441 0.20344 2.88069 4 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 5 2.53331 3.02441 0.20344 2.88069 5 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 6 0.23862 2.84929 2.43386 2.70756 6 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 7 2.81865 0.23582 2.88868 2.35662 7 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 8 2.81865 0.23582 2.88868 2.35662 8 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 9 0.23862 2.84929 2.43386 2.70756 9 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 10 0.23862 2.84929 2.43386 2.70756 10 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 11 2.57915 2.25909 2.64442 0.28946 11 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 12 0.23862 2.84929 2.43386 2.70756 12 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 13 0.23862 2.84929 2.43386 2.70756 13 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 14 2.57915 2.25909 2.64442 0.28946 14 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 15 2.57915 2.25909 2.64442 0.28946 15 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 16 2.81865 0.23582 2.88868 2.35662 16 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 17 2.81865 0.23582 2.88868 2.35662 17 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 18 2.57915 2.25909 2.64442 0.28946 18 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 19 2.53331 3.02441 0.20344 2.88069 19 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 20 2.81865 0.23582 2.88868'..b'- -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 24 3.12118 2.61584 3.16808 0.17352 24 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 25 2.96982 3.62027 0.11366 3.52834 25 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 26 0.13772 3.41241 2.82276 3.31713 26 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 27 0.13772 3.41241 2.82276 3.31713 27 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 28 3.47011 0.12588 3.51799 2.85586 28 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 29 3.47011 0.12588 3.51799 2.85586 29 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 30 3.12118 2.61584 3.16808 0.17352 30 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 31 2.96982 3.62027 0.11366 3.52834 31 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 32 3.47011 0.12588 3.51799 2.85586 32 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 33 2.13519 2.26919 2.09248 0.42312 33 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 34 2.96982 3.62027 0.11366 3.52834 34 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 35 3.47011 0.12588 3.51799 2.85586 35 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 36 2.10812 1.99792 2.53146 0.41042 36 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 37 2.96982 3.62027 0.11366 3.52834 37 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 38 2.96982 3.62027 0.11366 3.52834 38 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 39 0.13772 3.41241 2.82276 3.31713 39 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 40 3.12118 2.61584 3.16808 0.17352 40 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 41 3.47011 0.12588 3.51799 2.85586 41 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 42 0.13772 3.41241 2.82276 3.31713 42 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 43 2.97957 2.28186 3.03175 0.22457 43 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 44 3.12118 2.61584 3.16808 0.17352 44 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03620 4.02977 4.02977 1.46634 0.26236 1.09861 0.40547\n+ 45 0.13772 3.41241 2.82276 3.31713 45 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01827 4.01183 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/M.hmm.h3f |
| b |
| Binary file ITSx_db/HMMs/M.hmm.h3f has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/M.hmm.h3i |
| b |
| Binary file ITSx_db/HMMs/M.hmm.h3i has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/M.hmm.h3m |
| b |
| Binary file ITSx_db/HMMs/M.hmm.h3m has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/M.hmm.h3p |
| b |
| Binary file ITSx_db/HMMs/M.hmm.h3p has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/O.hmm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ITSx_db/HMMs/O.hmm Mon Mar 14 16:15:08 2016 -0400 |
| [ |
| b'@@ -0,0 +1,11005 @@\n+HMMER3/b [3.0 | March 2010]\n+NAME 3_End_Oomycota_58S_end_eight_long\n+LENG 45\n+ALPH DNA\n+RF no\n+CS no\n+MAP yes\n+DATE Mon Jan 23 23:03:14 2012\n+NSEQ 2983\n+EFFN 3.376790\n+CKSUM 630809808\n+STATS LOCAL MSV -7.3235 0.71932\n+STATS LOCAL VITERBI -7.7268 0.71932\n+STATS LOCAL FORWARD -3.9994 0.71932\n+HMM A C G T \n+ m->m m->i m->d i->m i->i d->m d->d\n+ COMPO 1.71234 1.37658 1.27028 1.25049\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03652 4.02119 4.02119 1.46634 0.26236 0.00000 *\n+ 1 3.45287 0.12788 3.50149 2.84336 1 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03652 4.02119 4.02119 1.46634 0.26236 1.09861 0.40547\n+ 2 0.13965 3.39742 2.81306 3.30071 2 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03652 4.02119 4.02119 1.46634 0.26236 1.09861 0.40547\n+ 3 3.45287 0.12788 3.50149 2.84336 3 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03652 4.02119 4.02119 1.46634 0.26236 1.09861 0.40547\n+ 4 3.10596 2.60617 3.15345 0.17590 4 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03652 4.02119 4.02119 1.46634 0.26236 1.09861 0.40547\n+ 5 3.07064 2.51740 3.11930 0.18784 5 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03652 4.02119 4.02119 1.46634 0.26236 1.09861 0.40547\n+ 6 3.40266 0.13843 3.45273 2.74368 6 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03652 4.02119 4.02119 1.46634 0.26236 1.09861 0.40547\n+ 7 3.45287 0.12788 3.50149 2.84336 7 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03652 4.02119 4.02119 1.46634 0.26236 1.09861 0.40547\n+ 8 2.95946 3.60514 0.11528 3.51162 8 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03652 4.02119 4.02119 1.46634 0.26236 1.09861 0.40547\n+ 9 2.95946 3.60514 0.11528 3.51162 9 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03652 4.02119 4.02119 1.46634 0.26236 1.09861 0.40547\n+ 10 2.95946 3.60514 0.11528 3.51162 10 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03652 4.02119 4.02119 1.46634 0.26236 1.09861 0.40547\n+ 11 3.07576 2.52995 3.12424 0.18607 11 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03652 4.02119 4.02119 1.46634 0.26236 1.09861 0.40547\n+ 12 3.10596 2.60617 3.15345 0.17590 12 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03652 4.02119 4.02119 1.46634 0.26236 1.09861 0.40547\n+ 13 0.13965 3.39742 2.81306 3.30071 13 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03652 4.02119 4.02119 1.46634 0.26236 1.09861 0.40547\n+ 14 2.95946 3.60514 0.11528 3.51162 14 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03652 4.02119 4.02119 1.46634 0.26236 1.09861 0.40547\n+ 15 3.01261 2.38100 3.06343 0.20868 15 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03652 4.02119 4.02119 1.46634 0.26236 1.09861 0.40547\n+ 16 3.45287 0.12788 3.50149 2.84336 16 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03652 4.02119 4.02119 1.46634 0.26236 1.09861 0.40547\n+ 17 3.45287 0.12788 3.50149 2.84336 17 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03652 4.02119 4.02119 1.46634 0.26236 1.09861 0.40547\n+ 18 3.10596 2.60617 3.15345 0.17590 18 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03652 4.02119 4.02119 1.46634 0.26236 1.09861 0.40547\n+ 19 2.95946 3.60514 0.11528 3.51162 19 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03652 4.02119 4.02119 1.46634 0.26236 1.09861 0.40547\n+ 20 2.95946 3.60514 0.11'..b'- -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03718 4.00361 4.00361 1.46634 0.26236 1.09861 0.40547\n+ 24 3.07459 2.58622 3.12328 0.18095 24 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03718 4.00361 4.00361 1.46634 0.26236 1.09861 0.40547\n+ 25 2.93780 3.57362 0.11872 3.47683 25 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03718 4.00361 4.00361 1.46634 0.26236 1.09861 0.40547\n+ 26 0.14375 3.36635 2.79288 3.26670 26 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03718 4.00361 4.00361 1.46634 0.26236 1.09861 0.40547\n+ 27 0.14375 3.36635 2.79288 3.26670 27 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.05071 4.00361 3.46743 1.46634 0.26236 1.09861 0.40547\n+ 28 3.39016 0.13545 3.44142 2.79762 28 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03768 3.99057 3.99057 1.46634 0.26236 0.77471 0.61774\n+ 29 3.41707 0.13214 3.46721 2.81731 29 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03718 4.00361 4.00361 1.46634 0.26236 1.09861 0.40547\n+ 30 3.07459 2.58622 3.12328 0.18095 30 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03718 4.00361 4.00361 1.46634 0.26236 1.09861 0.40547\n+ 31 2.93780 3.57362 0.11872 3.47683 31 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03718 4.00361 4.00361 1.46634 0.26236 1.09861 0.40547\n+ 32 3.41707 0.13214 3.46721 2.81731 32 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03718 4.00361 4.00361 1.46634 0.26236 1.09861 0.40547\n+ 33 2.93780 3.57362 0.11872 3.47683 33 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03718 4.00361 4.00361 1.46634 0.26236 1.09861 0.40547\n+ 34 2.93780 3.57362 0.11872 3.47683 34 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03718 4.00361 4.00361 1.46634 0.26236 1.09861 0.40547\n+ 35 0.14375 3.36635 2.79288 3.26670 35 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03718 4.00361 4.00361 1.46634 0.26236 1.09861 0.40547\n+ 36 0.14375 3.36635 2.79288 3.26670 36 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03718 4.00361 4.00361 1.46634 0.26236 1.09861 0.40547\n+ 37 2.93780 3.57362 0.11872 3.47683 37 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03718 4.00361 4.00361 1.46634 0.26236 1.09861 0.40547\n+ 38 2.93780 3.57362 0.11872 3.47683 38 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03718 4.00361 4.00361 1.46634 0.26236 1.09861 0.40547\n+ 39 0.14375 3.36635 2.79288 3.26670 39 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03718 4.00361 4.00361 1.46634 0.26236 1.09861 0.40547\n+ 40 3.07459 2.58622 3.12328 0.18095 40 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03718 4.00361 4.00361 1.46634 0.26236 1.09861 0.40547\n+ 41 3.41707 0.13214 3.46721 2.81731 41 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03718 4.00361 4.00361 1.46634 0.26236 1.09861 0.40547\n+ 42 0.14375 3.36635 2.79288 3.26670 42 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03718 4.00361 4.00361 1.46634 0.26236 1.09861 0.40547\n+ 43 3.07459 2.58622 3.12328 0.18095 43 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03718 4.00361 4.00361 1.46634 0.26236 1.09861 0.40547\n+ 44 3.07459 2.58622 3.12328 0.18095 44 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03718 4.00361 4.00361 1.46634 0.26236 1.09861 0.40547\n+ 45 0.14375 3.36635 2.79288 3.26670 45 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01876 3.98519 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/O.hmm.h3f |
| b |
| Binary file ITSx_db/HMMs/O.hmm.h3f has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/O.hmm.h3i |
| b |
| Binary file ITSx_db/HMMs/O.hmm.h3i has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/O.hmm.h3m |
| b |
| Binary file ITSx_db/HMMs/O.hmm.h3m has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/O.hmm.h3p |
| b |
| Binary file ITSx_db/HMMs/O.hmm.h3p has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/P.hmm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ITSx_db/HMMs/P.hmm Mon Mar 14 16:15:08 2016 -0400 |
| [ |
| b'@@ -0,0 +1,1550 @@\n+HMMER3/b [3.0 | March 2010]\n+NAME 3_End_Haptophyceae_58S_end_five_long\n+LENG 45\n+ALPH DNA\n+RF no\n+CS no\n+MAP yes\n+DATE Thu Jan 19 21:11:03 2012\n+NSEQ 2\n+EFFN 2.000000\n+CKSUM 2494581836\n+STATS LOCAL MSV -7.5772 0.72779\n+STATS LOCAL VITERBI -8.4466 0.72779\n+STATS LOCAL FORWARD -3.4217 0.72779\n+HMM A C G T \n+ m->m m->i m->d i->m i->i d->m d->d\n+ COMPO 1.83092 1.23370 1.22080 1.37229\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 0.00000 *\n+ 1 2.81865 0.23582 2.88868 2.35662 1 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 2 2.53331 3.02441 0.20344 2.88069 2 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 3 2.81865 0.23582 2.88868 2.35662 3 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 4 2.57915 2.25909 2.64442 0.28946 4 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 5 2.57915 2.25909 2.64442 0.28946 5 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 6 2.57915 2.25909 2.64442 0.28946 6 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 7 2.53331 3.02441 0.20344 2.88069 7 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 8 2.57915 2.25909 2.64442 0.28946 8 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 9 2.53331 3.02441 0.20344 2.88069 9 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 10 2.53331 3.02441 0.20344 2.88069 10 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 11 2.81865 0.23582 2.88868 2.35662 11 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 12 2.57915 2.25909 2.64442 0.28946 12 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 13 2.81865 0.23582 2.88868 2.35662 13 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 14 2.81865 0.23582 2.88868 2.35662 14 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 15 2.53331 3.02441 0.20344 2.88069 15 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 16 2.81865 0.23582 2.88868 2.35662 16 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 17 2.81865 0.23582 2.88868 2.35662 17 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 18 2.53331 3.02441 0.20344 2.88069 18 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 19 2.81865 0.23582 2.88868 2.35662 19 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 20 2.53331 3.02441 0.20'..b'- -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 24 3.05675 2.57485 3.10612 0.18390 24 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 25 2.92530 3.55551 0.12075 3.45686 25 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 26 0.14615 3.34859 2.78130 3.24727 26 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 27 0.14615 3.34859 2.78130 3.24727 27 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 28 3.39657 0.13465 3.44756 2.80232 28 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 29 3.39657 0.13465 3.44756 2.80232 29 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 30 3.05675 2.57485 3.10612 0.18390 30 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 31 2.92530 3.55551 0.12075 3.45686 31 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 32 3.39657 0.13465 3.44756 2.80232 32 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 33 2.92530 3.55551 0.12075 3.45686 33 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 34 2.92530 3.55551 0.12075 3.45686 34 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 35 0.14615 3.34859 2.78130 3.24727 35 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 36 0.14615 3.34859 2.78130 3.24727 36 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 37 2.92530 3.55551 0.12075 3.45686 37 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 38 2.92530 3.55551 0.12075 3.45686 38 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 39 0.14615 3.34859 2.78130 3.24727 39 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 40 3.05675 2.57485 3.10612 0.18390 40 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 41 3.39657 0.13465 3.44756 2.80232 41 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 42 0.14615 3.34859 2.78130 3.24727 42 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 43 3.05675 2.57485 3.10612 0.18390 43 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 44 3.05675 2.57485 3.10612 0.18390 44 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99367 3.99367 1.46634 0.26236 1.09861 0.40547\n+ 45 0.14615 3.34859 2.78130 3.24727 45 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01896 3.97506 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/P.hmm.h3f |
| b |
| Binary file ITSx_db/HMMs/P.hmm.h3f has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/P.hmm.h3i |
| b |
| Binary file ITSx_db/HMMs/P.hmm.h3i has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/P.hmm.h3m |
| b |
| Binary file ITSx_db/HMMs/P.hmm.h3m has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/P.hmm.h3p |
| b |
| Binary file ITSx_db/HMMs/P.hmm.h3p has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/Q.hmm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ITSx_db/HMMs/Q.hmm Mon Mar 14 16:15:08 2016 -0400 |
| [ |
| b'@@ -0,0 +1,1085 @@\n+HMMER3/b [3.0 | March 2010]\n+NAME 3_End_Raphidophyceae_58S_end_one_long\n+LENG 45\n+ALPH DNA\n+RF no\n+CS no\n+MAP yes\n+DATE Thu Jan 19 22:28:09 2012\n+NSEQ 29\n+EFFN 3.345337\n+CKSUM 2540392139\n+STATS LOCAL MSV -8.0627 0.71933\n+STATS LOCAL VITERBI -7.5685 0.71933\n+STATS LOCAL FORWARD -3.8000 0.71933\n+HMM A C G T \n+ m->m m->i m->d i->m i->i d->m d->d\n+ COMPO 1.72491 1.59887 1.25392 1.09570\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03673 4.01554 4.01554 1.46634 0.26236 0.00000 *\n+ 1 3.44143 0.12922 3.49054 2.83505 1 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03673 4.01554 4.01554 1.46634 0.26236 1.09861 0.40547\n+ 2 0.14094 3.38749 2.80662 3.28984 2 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03673 4.01554 4.01554 1.46634 0.26236 1.09861 0.40547\n+ 3 3.44143 0.12922 3.49054 2.83505 3 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03673 4.01554 4.01554 1.46634 0.26236 1.09861 0.40547\n+ 4 3.09591 2.59978 3.14378 0.17750 4 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03673 4.01554 4.01554 1.46634 0.26236 1.09861 0.40547\n+ 5 3.09591 2.59978 3.14378 0.17750 5 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03673 4.01554 4.01554 1.46634 0.26236 1.09861 0.40547\n+ 6 3.44143 0.12922 3.49054 2.83505 6 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03673 4.01554 4.01554 1.46634 0.26236 1.09861 0.40547\n+ 7 3.44143 0.12922 3.49054 2.83505 7 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03673 4.01554 4.01554 1.46634 0.26236 1.09861 0.40547\n+ 8 2.95256 3.59508 0.11636 3.50051 8 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03673 4.01554 4.01554 1.46634 0.26236 1.09861 0.40547\n+ 9 2.95256 3.59508 0.11636 3.50051 9 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03673 4.01554 4.01554 1.46634 0.26236 1.09861 0.40547\n+ 10 2.95256 3.59508 0.11636 3.50051 10 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03673 4.01554 4.01554 1.46634 0.26236 1.09861 0.40547\n+ 11 0.14094 3.38749 2.80662 3.28984 11 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03673 4.01554 4.01554 1.46634 0.26236 1.09861 0.40547\n+ 12 3.09591 2.59978 3.14378 0.17750 12 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03673 4.01554 4.01554 1.46634 0.26236 1.09861 0.40547\n+ 13 0.14094 3.38749 2.80662 3.28984 13 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03673 4.01554 4.01554 1.46634 0.26236 1.09861 0.40547\n+ 14 3.09591 2.59978 3.14378 0.17750 14 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03673 4.01554 4.01554 1.46634 0.26236 1.09861 0.40547\n+ 15 3.09591 2.59978 3.14378 0.17750 15 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03673 4.01554 4.01554 1.46634 0.26236 1.09861 0.40547\n+ 16 3.44143 0.12922 3.49054 2.83505 16 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03673 4.01554 4.01554 1.46634 0.26236 1.09861 0.40547\n+ 17 3.44143 0.12922 3.49054 2.83505 17 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03673 4.01554 4.01554 1.46634 0.26236 1.09861 0.40547\n+ 18 3.09591 2.59978 3.14378 0.17750 18 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03673 4.01554 4.01554 1.46634 0.26236 1.09861 0.40547\n+ 19 2.95256 3.59508 0.11636 3.50051 19 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03673 4.01554 4.01554 1.46634 0.26236 1.09861 0.40547\n+ 20 2.95256 3.59508 0.'..b'- -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 24 3.05845 2.57594 3.10775 0.18362 24 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 25 2.92650 3.55724 0.12055 3.45877 25 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 26 0.14592 3.35028 2.78241 3.24912 26 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 27 0.14592 3.35028 2.78241 3.24912 27 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 28 3.39853 0.13441 3.44944 2.80375 28 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 29 3.39853 0.13441 3.44944 2.80375 29 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 30 3.05845 2.57594 3.10775 0.18362 30 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 31 2.92650 3.55724 0.12055 3.45877 31 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 32 3.39853 0.13441 3.44944 2.80375 32 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 33 2.92650 3.55724 0.12055 3.45877 33 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 34 2.92650 3.55724 0.12055 3.45877 34 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 35 0.14592 3.35028 2.78241 3.24912 35 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 36 0.14592 3.35028 2.78241 3.24912 36 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 37 2.92650 3.55724 0.12055 3.45877 37 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 38 2.92650 3.55724 0.12055 3.45877 38 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 39 0.14592 3.35028 2.78241 3.24912 39 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 40 3.05845 2.57594 3.10775 0.18362 40 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 41 3.39853 0.13441 3.44944 2.80375 41 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 42 0.14592 3.35028 2.78241 3.24912 42 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 43 3.05845 2.57594 3.10775 0.18362 43 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 44 3.05845 2.57594 3.10775 0.18362 44 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03752 3.99461 3.99461 1.46634 0.26236 1.09861 0.40547\n+ 45 0.14592 3.35028 2.78241 3.24912 45 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01894 3.97602 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/Q.hmm.h3f |
| b |
| Binary file ITSx_db/HMMs/Q.hmm.h3f has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/Q.hmm.h3i |
| b |
| Binary file ITSx_db/HMMs/Q.hmm.h3i has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/Q.hmm.h3m |
| b |
| Binary file ITSx_db/HMMs/Q.hmm.h3m has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/Q.hmm.h3p |
| b |
| Binary file ITSx_db/HMMs/Q.hmm.h3p has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/R.hmm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ITSx_db/HMMs/R.hmm Mon Mar 14 16:15:08 2016 -0400 |
| [ |
| b'@@ -0,0 +1,6355 @@\n+HMMER3/b [3.0 | March 2010]\n+NAME 3_End_Rhizaria_58S_end_eight_long\n+LENG 45\n+ALPH DNA\n+RF no\n+CS no\n+MAP yes\n+DATE Fri Jan 20 15:33:02 2012\n+NSEQ 2\n+EFFN 2.000000\n+CKSUM 1899220078\n+STATS LOCAL MSV -7.5314 0.72773\n+STATS LOCAL VITERBI -8.2053 0.72773\n+STATS LOCAL FORWARD -3.4398 0.72773\n+HMM A C G T \n+ m->m m->i m->d i->m i->i d->m d->d\n+ COMPO 1.39561 1.53003 1.21055 1.43652\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 0.00000 *\n+ 1 2.57915 2.25909 2.64442 0.28946 1 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 2 2.81865 0.23582 2.88868 2.35662 2 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 3 2.57915 2.25909 2.64442 0.28946 3 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 4 0.23862 2.84929 2.43386 2.70756 4 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 5 2.57915 2.25909 2.64442 0.28946 5 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 6 2.57915 2.25909 2.64442 0.28946 6 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 7 2.81865 0.23582 2.88868 2.35662 7 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 8 2.57915 2.25909 2.64442 0.28946 8 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 9 2.81865 0.23582 2.88868 2.35662 9 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 10 2.81865 0.23582 2.88868 2.35662 10 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 11 0.23862 2.84929 2.43386 2.70756 11 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 12 0.23862 2.84929 2.43386 2.70756 12 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 13 2.81865 0.23582 2.88868 2.35662 13 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 14 0.23862 2.84929 2.43386 2.70756 14 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 15 2.53331 3.02441 0.20344 2.88069 15 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 16 2.53331 3.02441 0.20344 2.88069 16 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 17 0.23862 2.84929 2.43386 2.70756 17 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 18 0.23862 2.84929 2.43386 2.70756 18 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 19 2.57915 2.25909 2.64442 0.28946 19 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 20 0.23862 2.84929 2.43386'..b'- -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 24 3.06506 2.58015 3.11411 0.18252 24 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 25 2.93114 3.56396 0.11980 3.46618 25 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 26 0.14502 3.35687 2.78670 3.25633 26 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 27 0.14502 3.35687 2.78670 3.25633 27 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 28 3.40613 0.13347 3.45673 2.80932 28 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 29 3.40613 0.13347 3.45673 2.80932 29 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 30 3.06506 2.58015 3.11411 0.18252 30 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 31 2.93114 3.56396 0.11980 3.46618 31 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 32 3.40613 0.13347 3.45673 2.80932 32 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 33 2.93114 3.56396 0.11980 3.46618 33 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 34 2.93114 3.56396 0.11980 3.46618 34 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 35 0.14502 3.35687 2.78670 3.25633 35 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 36 0.14502 3.35687 2.78670 3.25633 36 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 37 2.93114 3.56396 0.11980 3.46618 37 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 38 2.93114 3.56396 0.11980 3.46618 38 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 39 0.14502 3.35687 2.78670 3.25633 39 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 40 3.06506 2.58015 3.11411 0.18252 40 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 41 3.40613 0.13347 3.45673 2.80932 41 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 42 0.14502 3.35687 2.78670 3.25633 42 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 43 3.06506 2.58015 3.11411 0.18252 43 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 44 3.06506 2.58015 3.11411 0.18252 44 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03738 3.99829 3.99829 1.46634 0.26236 1.09861 0.40547\n+ 45 0.14502 3.35687 2.78670 3.25633 45 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01887 3.97977 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/R.hmm.h3f |
| b |
| Binary file ITSx_db/HMMs/R.hmm.h3f has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/R.hmm.h3i |
| b |
| Binary file ITSx_db/HMMs/R.hmm.h3i has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/R.hmm.h3m |
| b |
| Binary file ITSx_db/HMMs/R.hmm.h3m has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/R.hmm.h3p |
| b |
| Binary file ITSx_db/HMMs/R.hmm.h3p has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/S.hmm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ITSx_db/HMMs/S.hmm Mon Mar 14 16:15:08 2016 -0400 |
| [ |
| b'@@ -0,0 +1,1240 @@\n+HMMER3/b [3.0 | March 2010]\n+NAME 3_End_Synurophyceae_58S_end_one_long\n+LENG 45\n+ALPH DNA\n+RF no\n+CS no\n+MAP yes\n+DATE Thu Jan 19 22:10:37 2012\n+NSEQ 114\n+EFFN 3.336365\n+CKSUM 556246054\n+STATS LOCAL MSV -7.9476 0.71931\n+STATS LOCAL VITERBI -7.6935 0.71931\n+STATS LOCAL FORWARD -4.0189 0.71931\n+HMM A C G T \n+ m->m m->i m->d i->m i->i d->m d->d\n+ COMPO 1.82422 1.38641 1.25673 1.19039\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01392 4.01392 1.46634 0.26236 0.00000 *\n+ 1 3.43814 0.12961 3.48739 2.83266 1 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01392 4.01392 1.46634 0.26236 1.09861 0.40547\n+ 2 2.95057 3.59219 0.11668 3.49732 2 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01392 4.01392 1.46634 0.26236 1.09861 0.40547\n+ 3 3.43814 0.12961 3.48739 2.83266 3 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01392 4.01392 1.46634 0.26236 1.09861 0.40547\n+ 4 0.14132 3.38463 2.80476 3.28671 4 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01392 4.01392 1.46634 0.26236 1.09861 0.40547\n+ 5 3.09302 2.59795 3.14101 0.17797 5 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01392 4.01392 1.46634 0.26236 1.09861 0.40547\n+ 6 3.43814 0.12961 3.48739 2.83266 6 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01392 4.01392 1.46634 0.26236 1.09861 0.40547\n+ 7 3.09302 2.59795 3.14101 0.17797 7 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01392 4.01392 1.46634 0.26236 1.09861 0.40547\n+ 8 3.09302 2.59795 3.14101 0.17797 8 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01392 4.01392 1.46634 0.26236 1.09861 0.40547\n+ 9 2.95057 3.59219 0.11668 3.49732 9 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01392 4.01392 1.46634 0.26236 1.09861 0.40547\n+ 10 3.43814 0.12961 3.48739 2.83266 10 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01392 4.01392 1.46634 0.26236 1.09861 0.40547\n+ 11 0.14132 3.38463 2.80476 3.28671 11 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01392 4.01392 1.46634 0.26236 1.09861 0.40547\n+ 12 3.43814 0.12961 3.48739 2.83266 12 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01392 4.01392 1.46634 0.26236 1.09861 0.40547\n+ 13 3.09302 2.59795 3.14101 0.17797 13 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01392 4.01392 1.46634 0.26236 1.09861 0.40547\n+ 14 2.95057 3.59219 0.11668 3.49732 14 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01392 4.01392 1.46634 0.26236 1.09861 0.40547\n+ 15 3.43814 0.12961 3.48739 2.83266 15 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01392 4.01392 1.46634 0.26236 1.09861 0.40547\n+ 16 3.43814 0.12961 3.48739 2.83266 16 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01392 4.01392 1.46634 0.26236 1.09861 0.40547\n+ 17 3.09302 2.59795 3.14101 0.17797 17 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01392 4.01392 1.46634 0.26236 1.09861 0.40547\n+ 18 2.93904 0.27285 3.00266 1.99347 18 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01392 4.01392 1.46634 0.26236 1.09861 0.40547\n+ 19 2.95057 3.59219 0.11668 3.49732 19 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01392 4.01392 1.46634 0.26236 1.09861 0.40547\n+ 20 2.95057 3.59219 0.1'..b'- -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 24 3.05815 2.57575 3.10747 0.18366 24 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 25 2.92629 3.55695 0.12059 3.45844 25 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 26 0.14596 3.34999 2.78222 3.24880 26 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 27 0.14596 3.34999 2.78222 3.24880 27 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 28 3.39819 0.13445 3.44912 2.80351 28 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 29 3.39819 0.13445 3.44912 2.80351 29 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 30 3.05815 2.57575 3.10747 0.18366 30 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 31 2.92629 3.55695 0.12059 3.45844 31 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 32 3.39819 0.13445 3.44912 2.80351 32 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 33 2.92629 3.55695 0.12059 3.45844 33 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 34 2.92629 3.55695 0.12059 3.45844 34 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 35 0.14596 3.34999 2.78222 3.24880 35 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 36 0.14596 3.34999 2.78222 3.24880 36 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 37 2.92629 3.55695 0.12059 3.45844 37 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 38 2.92629 3.55695 0.12059 3.45844 38 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 39 0.14596 3.34999 2.78222 3.24880 39 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 40 3.05815 2.57575 3.10747 0.18366 40 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 41 3.39819 0.13445 3.44912 2.80351 41 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 42 0.14596 3.34999 2.78222 3.24880 42 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 43 3.05815 2.57575 3.10747 0.18366 43 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 44 3.05815 2.57575 3.10747 0.18366 44 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03753 3.99445 3.99445 1.46634 0.26236 1.09861 0.40547\n+ 45 0.14596 3.34999 2.78222 3.24880 45 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01894 3.97586 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/S.hmm.h3f |
| b |
| Binary file ITSx_db/HMMs/S.hmm.h3f has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/S.hmm.h3i |
| b |
| Binary file ITSx_db/HMMs/S.hmm.h3i has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/S.hmm.h3m |
| b |
| Binary file ITSx_db/HMMs/S.hmm.h3m has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/S.hmm.h3p |
| b |
| Binary file ITSx_db/HMMs/S.hmm.h3p has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/T.hmm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ITSx_db/HMMs/T.hmm Mon Mar 14 16:15:08 2016 -0400 |
| [ |
| b'@@ -0,0 +1,34720 @@\n+HMMER3/b [3.0 | March 2010]\n+NAME 3_End_Tracheophyta_58S_end_eight_long\n+LENG 45\n+ALPH DNA\n+RF no\n+CS no\n+MAP yes\n+DATE Sat Feb 18 00:57:06 2012\n+NSEQ 662\n+EFFN 4.649132\n+CKSUM 878970887\n+STATS LOCAL MSV -6.9557 0.71932\n+STATS LOCAL VITERBI -7.5350 0.71932\n+STATS LOCAL FORWARD -3.7755 0.71932\n+HMM A C G T \n+ m->m m->i m->d i->m i->i d->m d->d\n+ COMPO 1.86570 1.07040 1.08935 1.79633\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02964 4.22671 4.22671 1.46634 0.26236 0.00000 *\n+ 1 3.17620 3.92530 0.08600 3.86688 1 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02964 4.22671 4.22671 1.46634 0.26236 1.09861 0.40547\n+ 2 3.82361 0.09186 3.85519 3.10671 2 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02964 4.22671 4.22671 1.46634 0.26236 1.09861 0.40547\n+ 3 3.82361 0.09186 3.85519 3.10671 3 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02964 4.22671 4.22671 1.46634 0.26236 1.09861 0.40547\n+ 4 3.57901 0.14044 3.62229 2.57183 4 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02964 4.22671 4.22671 1.46634 0.26236 1.09861 0.40547\n+ 5 1.93587 1.39029 0.83718 1.75004 5 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02964 4.22671 4.22671 1.46634 0.26236 1.09861 0.40547\n+ 6 0.10359 3.72520 3.02434 3.66086 6 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02964 4.22671 4.22671 1.46634 0.26236 1.09861 0.40547\n+ 7 0.19844 3.34834 2.27973 3.15742 7 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02964 4.22671 4.22671 1.46634 0.26236 1.09861 0.40547\n+ 8 3.17620 3.92530 0.08600 3.86688 8 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02964 4.22671 4.22671 1.46634 0.26236 1.09861 0.40547\n+ 9 3.82361 0.09186 3.85519 3.10671 9 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02964 4.22671 4.22671 1.46634 0.26236 1.09861 0.40547\n+ 10 3.77465 0.10089 3.80859 2.97902 10 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02964 4.22671 4.22671 1.46634 0.26236 1.09861 0.40547\n+ 11 0.84316 2.18097 1.68775 1.30274 11 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02964 4.22671 4.22671 1.46634 0.26236 1.09861 0.40547\n+ 12 3.24031 2.25577 3.28501 0.20014 12 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02964 4.22671 4.22671 1.46634 0.26236 1.09861 0.40547\n+ 13 2.81050 1.42383 2.87304 0.44238 13 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02964 4.22671 4.22671 1.46634 0.26236 1.09861 0.40547\n+ 14 1.22032 1.28525 1.91165 1.27137 14 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02964 4.22671 4.22671 1.46634 0.26236 1.09861 0.40547\n+ 15 3.17620 3.92530 0.08600 3.86688 15 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02964 4.22671 4.22671 1.46634 0.26236 1.09861 0.40547\n+ 16 3.17620 3.92530 0.08600 3.86688 16 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02964 4.22671 4.22671 1.46634 0.26236 1.09861 0.40547\n+ 17 3.55653 0.14545 3.60081 2.53166 17 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02964 4.22671 4.22671 1.46634 0.26236 1.09861 0.40547\n+ 18 3.35052 0.19783 3.40305 2.19688 18 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02964 4.22671 4.22671 1.46634 0.26236 1.09861 0.40547\n+ 19 2.73063 3.76185 0.12042 3.68745 19 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02964 4.22671 4.22671 1.46634 0.26236 1.09861 0.40547\n+ 20 0.10359 3.72520 3'..b'- -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 24 2.57915 2.25909 2.64442 0.28946 24 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 25 2.53331 3.02441 0.20344 2.88069 25 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 26 0.23862 2.84929 2.43386 2.70756 26 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 27 0.23862 2.84929 2.43386 2.70756 27 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 28 2.81865 0.23582 2.88868 2.35662 28 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 29 2.81865 0.23582 2.88868 2.35662 29 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 30 2.57915 2.25909 2.64442 0.28946 30 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 31 2.53331 3.02441 0.20344 2.88069 31 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 32 2.81865 0.23582 2.88868 2.35662 32 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 33 2.53331 3.02441 0.20344 2.88069 33 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 34 2.53331 3.02441 0.20344 2.88069 34 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 35 0.23862 2.84929 2.43386 2.70756 35 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 36 0.23862 2.84929 2.43386 2.70756 36 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 37 2.53331 3.02441 0.20344 2.88069 37 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 38 2.53331 3.02441 0.20344 2.88069 38 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 39 0.23862 2.84929 2.43386 2.70756 39 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 40 2.57915 2.25909 2.64442 0.28946 40 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 41 2.81865 0.23582 2.88868 2.35662 41 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 42 0.23862 2.84929 2.43386 2.70756 42 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 43 2.57915 2.25909 2.64442 0.28946 43 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 44 2.57915 2.25909 2.64442 0.28946 44 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 45 2.53331 3.02441 0.20344 2.88069 45 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02469 3.71357 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/T.hmm.h3f |
| b |
| Binary file ITSx_db/HMMs/T.hmm.h3f has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/T.hmm.h3i |
| b |
| Binary file ITSx_db/HMMs/T.hmm.h3i has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/T.hmm.h3m |
| b |
| Binary file ITSx_db/HMMs/T.hmm.h3m has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/T.hmm.h3p |
| b |
| Binary file ITSx_db/HMMs/T.hmm.h3p has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/U.hmm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ITSx_db/HMMs/U.hmm Mon Mar 14 16:15:08 2016 -0400 |
| [ |
| b'@@ -0,0 +1,620 @@\n+HMMER3/b [3.0 | March 2010]\n+NAME 3_End_Eustigmatophyceae_58S_end_long\n+LENG 45\n+ALPH DNA\n+RF no\n+CS no\n+MAP yes\n+DATE Sun Sep 25 01:39:32 2011\n+NSEQ 6\n+EFFN 3.336914\n+CKSUM 3393550359\n+STATS LOCAL MSV -8.0163 0.71932\n+STATS LOCAL VITERBI -7.6944 0.71932\n+STATS LOCAL FORWARD -4.0151 0.71932\n+HMM A C G T \n+ m->m m->i m->d i->m i->i d->m d->d\n+ COMPO 1.93226 1.59605 1.19721 1.04854\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01402 4.01402 1.46634 0.26236 0.00000 *\n+ 1 3.43835 0.12958 3.48758 2.83281 1 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01402 4.01402 1.46634 0.26236 1.09861 0.40547\n+ 2 2.95070 3.59237 0.11666 3.49752 2 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01402 4.01402 1.46634 0.26236 1.09861 0.40547\n+ 3 3.43835 0.12958 3.48758 2.83281 3 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01402 4.01402 1.46634 0.26236 1.09861 0.40547\n+ 4 3.09320 2.59806 3.14118 0.17794 4 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01402 4.01402 1.46634 0.26236 1.09861 0.40547\n+ 5 3.09320 2.59806 3.14118 0.17794 5 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01402 4.01402 1.46634 0.26236 1.09861 0.40547\n+ 6 3.09320 2.59806 3.14118 0.17794 6 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01402 4.01402 1.46634 0.26236 1.09861 0.40547\n+ 7 3.43835 0.12958 3.48758 2.83281 7 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01402 4.01402 1.46634 0.26236 1.09861 0.40547\n+ 8 2.95070 3.59237 0.11666 3.49752 8 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01402 4.01402 1.46634 0.26236 1.09861 0.40547\n+ 9 2.95070 3.59237 0.11666 3.49752 9 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01402 4.01402 1.46634 0.26236 1.09861 0.40547\n+ 10 2.95070 3.59237 0.11666 3.49752 10 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01402 4.01402 1.46634 0.26236 1.09861 0.40547\n+ 11 0.14130 3.38481 2.80488 3.28690 11 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01402 4.01402 1.46634 0.26236 1.09861 0.40547\n+ 12 3.09320 2.59806 3.14118 0.17794 12 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01402 4.01402 1.46634 0.26236 1.09861 0.40547\n+ 13 0.14130 3.38481 2.80488 3.28690 13 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01402 4.01402 1.46634 0.26236 1.09861 0.40547\n+ 14 3.09320 2.59806 3.14118 0.17794 14 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01402 4.01402 1.46634 0.26236 1.09861 0.40547\n+ 15 2.95070 3.59237 0.11666 3.49752 15 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01402 4.01402 1.46634 0.26236 1.09861 0.40547\n+ 16 3.43835 0.12958 3.48758 2.83281 16 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01402 4.01402 1.46634 0.26236 1.09861 0.40547\n+ 17 3.43835 0.12958 3.48758 2.83281 17 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01402 4.01402 1.46634 0.26236 1.09861 0.40547\n+ 18 3.43835 0.12958 3.48758 2.83281 18 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01402 4.01402 1.46634 0.26236 1.09861 0.40547\n+ 19 2.95070 3.59237 0.11666 3.49752 19 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03679 4.01402 4.01402 1.46634 0.26236 1.09861 0.40547\n+ 20 3.09320 2.59806 3.141'..b'- -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 24 3.05683 2.57491 3.10619 0.18389 24 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 25 2.92536 3.55560 0.12074 3.45696 25 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 26 0.14614 3.34867 2.78135 3.24736 26 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 27 0.14614 3.34867 2.78135 3.24736 27 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 28 3.39667 0.13464 3.44765 2.80239 28 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 29 3.39667 0.13464 3.44765 2.80239 29 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 30 3.05683 2.57491 3.10619 0.18389 30 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 31 2.92536 3.55560 0.12074 3.45696 31 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 32 3.39667 0.13464 3.44765 2.80239 32 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 33 2.92536 3.55560 0.12074 3.45696 33 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 34 2.92536 3.55560 0.12074 3.45696 34 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 35 0.14614 3.34867 2.78135 3.24736 35 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 36 0.14614 3.34867 2.78135 3.24736 36 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 37 2.92536 3.55560 0.12074 3.45696 37 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 38 2.92536 3.55560 0.12074 3.45696 38 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 39 0.14614 3.34867 2.78135 3.24736 39 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 40 3.05683 2.57491 3.10619 0.18389 40 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 41 3.39667 0.13464 3.44765 2.80239 41 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 42 0.14614 3.34867 2.78135 3.24736 42 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 43 3.05683 2.57491 3.10619 0.18389 43 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 44 3.05683 2.57491 3.10619 0.18389 44 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03756 3.99371 3.99371 1.46634 0.26236 1.09861 0.40547\n+ 45 0.14614 3.34867 2.78135 3.24736 45 - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01896 3.97511 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/U.hmm.h3f |
| b |
| Binary file ITSx_db/HMMs/U.hmm.h3f has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/U.hmm.h3i |
| b |
| Binary file ITSx_db/HMMs/U.hmm.h3i has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/U.hmm.h3m |
| b |
| Binary file ITSx_db/HMMs/U.hmm.h3m has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 ITSx_db/HMMs/U.hmm.h3p |
| b |
| Binary file ITSx_db/HMMs/U.hmm.h3p has changed |
| b |
| diff -r 000000000000 -r 57e76d405a97 test-data/expectedOutput.ITS1.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/expectedOutput.ITS1.fasta Mon Mar 14 16:15:08 2016 -0400 |
| b |
| @@ -0,0 +1,6 @@ +>gi|150439140|emb|AM747290.1||F|ITS1 Extracted ITS1 sequence 41-207 (167 bp) +ATGAATTCAAGAGAGTTGATGCTGGCGGTCTTGTGGCTGCATGTGCTCGCTCTCCTAATCCAATTTACACCTGTGCACTTAACTTTGAAGGGAGGGTAAAACCTGCCTTCGAAATCTTTAAACTCTTATATAACGAATGTTTATCTGCCGCAAGGCAAAATTTAATA +>gi|50874860|emb|AJ634045.1||F|ITS1 Extracted ITS1 sequence 1-238 (238 bp) +GAACCTGCGGAAGGATCATTATTAGAGACAGGGCCTGTCTAGGCCCGACCTCCAACCCCCTGTCTACCTACCTATTGTTGCTTTGGCGGTGCGTCTGGTGCTTGCCGCACGCGTTACGGCTAAGAACCGCCAGTGGCCCGGCGTGCGCCAGGCCGCTGAGTCGCCGTCAAGGGGCTACTTCTAAATTCTCCGCACCAGTAAGCCGTCTAAGAGGAACTTGCAAAATAATCGCCTCGAA +>gi|50874843|emb|AJ634028.1||F|ITS1 Extracted ITS1 sequence 1-241 (241 bp) +GAACCTGCGGAAGGATCATTATTAGAGATAGGGCCTGTCTAGGTCCGACCTCCAACCCCCTGTTTACCTAACCCATTGTTGCTTTGGCGATGCGTCTGGTGCTCGCCGTACGCGTTACGGCTAAGCACCGCCGGTGGCCCGGTGTACGCGGGGTCGCTGAGTCGTCGTCAAGGGGCTACTTCTAAATTCTCCGTACTAGCAAGTCGTCTTAAGAGCAACTTTTTGAAATAATCGCCTCGAA |
| b |
| diff -r 000000000000 -r 57e76d405a97 test-data/expectedOutput.ITS2.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/expectedOutput.ITS2.fasta Mon Mar 14 16:15:08 2016 -0400 |
| b |
| @@ -0,0 +1,6 @@ +>gi|150439140|emb|AM747290.1||F|ITS2 Extracted ITS2 sequence 366-570 (205 bp) +AACTCTCAAGCAAGATAGATTTATTTCTATCTCTGTTTGGATATGGACTCTGCCGCGTCAATGCGGCTGGTCTTAAATATATTAGCTGGTCCTAGTGAAGGTTTGGTTCTACTCAGCATGATAATTATCTGATGTTGAGGACAGTCTTAGGACTGGCCAGGCTCTCTCTGGATTGCTTCTAATCGTCTTTGGACAATTAATCAAT +>gi|50874860|emb|AJ634045.1||F|ITS2 Extracted ITS2 sequence 397-577 (181 bp) +AAATCATCAAGCACCGCTTGGTATTGGGTCTGACGTCCCTACACCCGCAGAGGGACGTACCCTAAAACCCTCGGCAACGTCCCGTGGCCGTAGGCGTAGCGGAATATGATCTTTACCACGTCTGCGAGGCGCACGAGGTCGTCCGGCCCCTCTGAATCTTAAACGTCTACTAGAACCTTAC +>gi|50874843|emb|AJ634028.1||F|ITS2 Extracted ITS2 sequence 400-596 (197 bp) +AAATCATCAAGCACCGCTTGGTATTGGGTCAGACGTCCCTGCACTCGCAGAGGGACGTACCCTAAACCCCTCGGCAACGTCCCGTGGCCGTAGACGTAGCGGAATATACAATCTTTACCATGTCTGCGAGGCGCGCGAGGTCGTCTAGCCCCTCCGAATCTTAACGTAGAACCTTAACCGTTGGCCACGGATCAGGC |
| b |
| diff -r 000000000000 -r 57e76d405a97 test-data/expectedOutput.extractions.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/expectedOutput.extractions.txt Mon Mar 14 16:15:08 2016 -0400 |
| b |
| @@ -0,0 +1,3 @@ +gi|150439140|emb|AM747290.1| 1206 F 0 4 1.733075e-14 53.525 53.525 1 615 1_SSU_Fungi_Tu_1_SSU_end_five_long 4_LSU_Fungi_Ge_4_LSU_start_eighteen_long 1_SSU_Fungi_Tu_1_SSU_end_five_long,2_5.8_Fungi_Ge_58S_start_threed_long,3_End_Fungi_Ge_58S_end_thirtyeighta_long,4_LSU_Fungi_Ge_4_LSU_start_eighteen_long A: 3 2.6733345e-08 34.3, B: 3 2.06703352333333e-08 34.3333333333333, C: 4 2.15037500825e-07 29.75, D: 2 1.535e-12 38.2, E: 3 1.14266666666667e-06 19.7, F: 4 1.733075e-14 53.525, G: 4 1.875752203e-09 42, H: 4 4.20000465e-08 33.325, I: 3 1.33352333360667e-06 29.8666666666667, L: 3 4.00900066666667e-08 33.3666666666667, M: 4 6.25013405e-08 38.375, O: 3 7.59667066666667e-09 34.5, P: 3 2.70000053333333e-09 33.1333333333333, Q: 4 3.050300000275e-06 26.35, R: 3 2.37035666666667e-10 38.7333333333333, S: 3 5.066671e-10 34.2333333333333, T: 4 1.127545e-11 42.725, U: 3 1.46933355333333e-09 34.8 +gi|50874860|emb|AJ634045.1| 637 F 0 3 9.025e-15 53.9 40.425 1 622 2_5.8_Fungi_Ge_58S_start_onee_long 4_LSU_Fungi_Ge_4_LSU_start_fifteen_long 2_5.8_Fungi_Ge_58S_start_onee_long,3_End_Fungi_Ge_58S_end_oneg_long,4_LSU_Fungi_Ge_4_LSU_start_fifteen_long A: 2 7.00485e-07 25.95, B: 3 3.566679e-06 22.2, C: 3 1.17016333333333e-06 24.3, D: 1 6.8e-11 33.1, F: 3 9.025e-15 53.9, G: 4 2.355097502125e-06 30.5, H: 2 1.050031e-07 29.1, I: 3 2.90723333333333e-07 23.9333333333333, L: 2 4.65e-10 30.85, M: 2 9.517e-10 36.3, O: 2 5.00375e-07 25.9, P: 3 7.84666666666667e-07 19.5333333333333, Q: 3 7.6681e-07 21.3, R: 3 2.53391666666667e-06 26.5333333333333, S: 3 4.68444333333333e-07 25.1, T: 3 7.37013333333333e-14 51.4333333333333, U: 3 2.7679e-07 21.8333333333333 +gi|50874843|emb|AJ634028.1| 596 F 0 2 3.7509e-14 52.1 26.05 1 596 2_5.8_Fungi_Ge_58S_start_onee_long *** 2_5.8_Fungi_Ge_58S_start_onee_long,3_End_Fungi_Ge_58S_end_twelvec_long A: 1 8.9e-10 31, B: 2 3.150017e-06 24.8, C: 2 1.65027e-06 23.5, F: 2 3.7509e-14 52.1, G: 3 2.90633333593333e-06 30.2, H: 2 6.0000285e-07 27.85, I: 2 4.058e-07 21.95, L: 1 3.9e-10 31.2, P: 2 1.01e-06 18.55, Q: 2 5.50195e-07 23.05, R: 2 3.55007e-06 25.25, S: 2 6.500155e-07 25, T: 2 1.000000185e-11 48.65, U: 2 3.2517e-07 22.85 |
| b |
| diff -r 000000000000 -r 57e76d405a97 test-data/expectedOutput.full.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/expectedOutput.full.fasta Mon Mar 14 16:15:08 2016 -0400 |
| b |
| @@ -0,0 +1,2 @@ +>gi|150439140|emb|AM747290.1||F fungi ITS sequence (531 bp) on main strand +ATGAATTCAAGAGAGTTGATGCTGGCGGTCTTGTGGCTGCATGTGCTCGCTCTCCTAATCCAATTTACACCTGTGCACTTAACTTTGAAGGGAGGGTAAAACCTGCCTTCGAAATCTTTAAACTCTTATATAACGAATGTTTATCTGCCGCAAGGCAAAATTTAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCACGCCTGTTCGAGTGTCATGAAACTCTCAAGCAAGATAGATTTATTTCTATCTCTGTTTGGATATGGACTCTGCCGCGTCAATGCGGCTGGTCTTAAATATATTAGCTGGTCCTAGTGAAGGTTTGGTTCTACTCAGCATGATAATTATCTGATGTTGAGGACAGTCTTAGGACTGGCCAGGCTCTCTCTGGATTGCTTCTAATCGTCTTTGGACAATTAATCAATA |
| b |
| diff -r 000000000000 -r 57e76d405a97 test-data/expectedOutput.graph --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/expectedOutput.graph Mon Mar 14 16:15:08 2016 -0400 |
| b |
| b'@@ -0,0 +1,170 @@\n+***********************************************************\n+A matches on main strand:\n+>> gi|150439140|emb|AM747290.1|\t1206 bp\n+-SSU--------------5.8---------------------------LSU--------------------------------------------------\n+>> gi|50874860|emb|AJ634045.1|\t637 bp\n+--------------------------------------5.8====----------------------------------------------LSU====---\n+>> gi|50874843|emb|AJ634028.1|\t596 bp\n+-----------------------------------------5.8====-----------------------------------------------------\n+***********************************************************\n+A matches on complementary strand:\n+***********************************************************\n+B matches on main strand:\n+>> gi|150439140|emb|AM747290.1|\t1206 bp\n+-SSU--------------5.8---------------------------LSU--------------------------------------------------\n+>> gi|50874860|emb|AJ634045.1|\t637 bp\n+-SSU----------------------------------5.8====----------------------------------------------LSU====---\n+>> gi|50874843|emb|AJ634028.1|\t596 bp\n+-SSU-------------------------------------5.8====-----------------------------------------------------\n+***********************************************************\n+B matches on complementary strand:\n+***********************************************************\n+C matches on main strand:\n+>> gi|150439140|emb|AM747290.1|\t1206 bp\n+-SSU--------------5.8------End=-----------------LSU--------------------------------------------------\n+>> gi|50874860|emb|AJ634045.1|\t637 bp\n+-SSU----------------------------------5.8====----------------------------------------------LSU====---\n+>> gi|50874843|emb|AJ634028.1|\t596 bp\n+-SSU-------------------------------------5.8====-----------------------------------------------------\n+***********************************************************\n+C matches on complementary strand:\n+***********************************************************\n+D matches on main strand:\n+>> gi|150439140|emb|AM747290.1|\t1206 bp\n+-SSU--------------------------------------------LSU--------------------------------------------------\n+>> gi|50874860|emb|AJ634045.1|\t637 bp\n+-------------------------------------------------------------------------------------------LSU====---\n+***********************************************************\n+D matches on complementary strand:\n+***********************************************************\n+E matches on main strand:\n+>> gi|150439140|emb|AM747290.1|\t1206 bp\n+-SSU--------------5.8---------------------------LSU=-------------------------------------------------\n+***********************************************************\n+E matches on complementary strand:\n+***********************************************************\n+F matches on main strand:\n+>> gi|150439140|emb|AM747290.1|\t1206 bp\n+-SSU--------------5.8------End=-----------------LSU--------------------------------------------------\n+>> gi|50874860|emb|AJ634045.1|\t637 bp\n+--------------------------------------5.8====-----------End====----------------------------LSU====---\n+>> gi|50874843|emb|AJ634028.1|\t596 bp\n+-----------------------------------------5.8====------------End====----------------------------------\n+***********************************************************\n+F matches on complementary strand:\n+***********************************************************\n+G matches on main strand:\n+>> gi|150439140|emb|AM747290.1|\t1206 bp\n+-SSU--------------5.8------End=-----------------LSU--------------------------------------------------\n+>> gi|50874860|emb|AJ634045.1|\t637 bp\n+-SSU----------------------------------5.8====-----------End====----------------------------LSU====---\n+>> gi|50874843|emb|AJ634028.1|\t596 bp\n+-SSU-------------------------------------5.8====------------End====----------------------------------\n+***********************************************************\n+G matches on complementary strand:\n+***********************************************************\n+H matches on main strand:\n+>> gi|150439140|emb|AM74729'..b'8---------------------------LSU--------------------------------------------------\n+>> gi|50874860|emb|AJ634045.1|\t637 bp\n+--------------------------------------5.8====----------------------------------------------LSU====---\n+***********************************************************\n+O matches on complementary strand:\n+***********************************************************\n+P matches on main strand:\n+>> gi|150439140|emb|AM747290.1|\t1206 bp\n+-SSU--------------5.8---------------------------LSU--------------------------------------------------\n+>> gi|50874860|emb|AJ634045.1|\t637 bp\n+-SSU----------------------------------5.8====----------------------------------------------LSU====---\n+>> gi|50874843|emb|AJ634028.1|\t596 bp\n+-SSU-------------------------------------5.8====-----------------------------------------------------\n+***********************************************************\n+P matches on complementary strand:\n+***********************************************************\n+Q matches on main strand:\n+>> gi|150439140|emb|AM747290.1|\t1206 bp\n+-SSU--------------5.8------End=-----------------LSU--------------------------------------------------\n+>> gi|50874860|emb|AJ634045.1|\t637 bp\n+-SSU----------------------------------5.8====----------------------------------------------LSU====---\n+>> gi|50874843|emb|AJ634028.1|\t596 bp\n+-SSU-------------------------------------5.8====-----------------------------------------------------\n+***********************************************************\n+Q matches on complementary strand:\n+***********************************************************\n+R matches on main strand:\n+>> gi|150439140|emb|AM747290.1|\t1206 bp\n+-SSU--------------5.8---------------------------LSU--------------------------------------------------\n+>> gi|50874860|emb|AJ634045.1|\t637 bp\n+-SSU----------------------------------5.8====----------------------------------------------LSU====---\n+>> gi|50874843|emb|AJ634028.1|\t596 bp\n+-SSU-------------------------------------5.8====-----------------------------------------------------\n+***********************************************************\n+R matches on complementary strand:\n+***********************************************************\n+S matches on main strand:\n+>> gi|150439140|emb|AM747290.1|\t1206 bp\n+-SSU--------------5.8---------------------------LSU--------------------------------------------------\n+>> gi|50874860|emb|AJ634045.1|\t637 bp\n+-SSU----------------------------------5.8====----------------------------------------------LSU====---\n+>> gi|50874843|emb|AJ634028.1|\t596 bp\n+-SSU-------------------------------------5.8====-----------------------------------------------------\n+***********************************************************\n+S matches on complementary strand:\n+***********************************************************\n+T matches on main strand:\n+>> gi|150439140|emb|AM747290.1|\t1206 bp\n+-SSU--------------5.8------End=-----------------LSU--------------------------------------------------\n+>> gi|50874860|emb|AJ634045.1|\t637 bp\n+--------------------------------------5.8====-----------End====----------------------------LSU====---\n+>> gi|50874843|emb|AJ634028.1|\t596 bp\n+-----------------------------------------5.8====------------End====----------------------------------\n+***********************************************************\n+T matches on complementary strand:\n+***********************************************************\n+U matches on main strand:\n+>> gi|150439140|emb|AM747290.1|\t1206 bp\n+-SSU--------------5.8---------------------------LSU--------------------------------------------------\n+>> gi|50874860|emb|AJ634045.1|\t637 bp\n+-SSU----------------------------------5.8====----------------------------------------------LSU====---\n+>> gi|50874843|emb|AJ634028.1|\t596 bp\n+-SSU-------------------------------------5.8====-----------------------------------------------------\n+***********************************************************\n+U matches on complementary strand:\n' |
| b |
| diff -r 000000000000 -r 57e76d405a97 test-data/expectedOutput.positions.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/expectedOutput.positions.txt Mon Mar 14 16:15:08 2016 -0400 |
| b |
| @@ -0,0 +1,3 @@ +gi|150439140|emb|AM747290.1| 1206 bp. SSU: 1-40 ITS1: 41-207 5.8S: 208-365 ITS2: 366-570 LSU: 571-1206 +gi|50874860|emb|AJ634045.1| 637 bp. SSU: Not found ITS1: 1-238 5.8S: 239-396 ITS2: 397-577 LSU: 578-637 +gi|50874843|emb|AJ634028.1| 596 bp. SSU: Not found ITS1: 1-241 5.8S: 242-399 ITS2: 400-596 LSU: Not found |
| b |
| diff -r 000000000000 -r 57e76d405a97 test-data/expectedOutput.problematic.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/expectedOutput.problematic.txt Mon Mar 14 16:15:08 2016 -0400 |
| b |
| @@ -0,0 +1,2 @@ +gi|50874860|emb|AJ634045.1| End of SSU sequence not found +gi|50874843|emb|AJ634028.1| End of SSU sequence not found; Start of LSU sequence not found |
| b |
| diff -r 000000000000 -r 57e76d405a97 test-data/testITSsequences.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/testITSsequences.fasta Mon Mar 14 16:15:08 2016 -0400 |
| b |
| @@ -0,0 +1,42 @@ +>gi|150439140|emb|AM747290.1| Homobasidiomycete sp. BM63-1206 SSU gene, ITS1, 5.8S rRNA gene, ITS2 and partial LSU gene, clone BM63-1206 +GTACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATTCAAGAGAGTTGATGCTGGCGGTC +TTGTGGCTGCATGTGCTCGCTCTCCTAATCCAATTTACACCTGTGCACTTAACTTTGAAGGGAGGGTAAA +ACCTGCCTTCGAAATCTTTAAACTCTTATATAACGAATGTTTATCTGCCGCAAGGCAAAATTTAATACAA +CTTTTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT +TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCACGCCT +GTTCGAGTGTCATGAAACTCTCAAGCAAGATAGATTTATTTCTATCTCTGTTTGGATATGGACTCTGCCG +CGTCAATGCGGCTGGTCTTAAATATATTAGCTGGTCCTAGTGAAGGTTTGGTTCTACTCAGCATGATAAT +TATCTGATGTTGAGGACAGTCTTAGGACTGGCCAGGCTCTCTCTGGATTGCTTCTAATCGTCTTTGGACA +ATTAATCAATATCTGACCTCGAATCAGGTGGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA +AAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTGGTA +GCCTTTGGTTGCCCGAGTTGTAATCTAGAGAAGCGTTTTCCGTGCTGGACTGTGTACAAGTTTCCTGGAT +ACGGAACATCATAGAGGGTGAGAATCCCGTCCTTGACACAGACTCCCAGTGCTTTGTGATGCGCTCTCAA +CGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGAGGTAAATTCCTTCTAAAGCTAAATATTGGCGAG +AGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGT +GAAATTGTTAAAAGGGAAACGATTGAAGTCAGTCGCGTCTACTTGGACTCAGCCTTACCTCGGTTTGGTG +CATTTCCTTGTGGACGGGCCAGTGTCCATGTTGATTGCTGGAAAAGGTTCAGGGGAATGTGGCTCTTTTA +GAGTGTTATAGCCTCTGTTCATATACAGTAGTTGATATGGAGTGATACAGCATGCTTCGGCGGTGCTTGT +ACTGGCATAATGGCTT + +>gi|50874860|emb|AJ634045.1| Roccella tuberculata partial SSU rRNA gene, ITS1, 5.8S rRNA gene, ITS2 and partial LSU rRNA gene, specimen voucher 8225 (S) +GAACCTGCGGAAGGATCATTATTAGAGACAGGGCCTGTCTAGGCCCGACCTCCAACCCCCTGTCTACCTA +CCTATTGTTGCTTTGGCGGTGCGTCTGGTGCTTGCCGCACGCGTTACGGCTAAGAACCGCCAGTGGCCCG +GCGTGCGCCAGGCCGCTGAGTCGCCGTCAAGGGGCTACTTCTAAATTCTCCGCACCAGTAAGCCGTCTAA +GAGGAACTTGCAAAATAATCGCCTCGAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAG +AACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCT +TGCGCCCCCCGGTATCCCGGTGGGCATGCCTGTTCGAGCGTCATTAAAATCATCAAGCACCGCTTGGTAT +TGGGTCTGACGTCCCTACACCCGCAGAGGGACGTACCCTAAAACCCTCGGCAACGTCCCGTGGCCGTAGG +CGTAGCGGAATATGATCTTTACCACGTCTGCGAGGCGCACGAGGTCGTCCGGCCCCTCTGAATCTTAAAC +GTCTACTAGAACCTTACCGTTGACCTCGGATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAAG +CGGAGGA + +>gi|50874843|emb|AJ634028.1| Roccella phycopsis partial SSU rRNA gene, ITS1, 5.8S rRNA gene, ITS2 and partial LSU rRNA gene, specimen voucher 8150a (S) +GAACCTGCGGAAGGATCATTATTAGAGATAGGGCCTGTCTAGGTCCGACCTCCAACCCCCTGTTTACCTA +ACCCATTGTTGCTTTGGCGATGCGTCTGGTGCTCGCCGTACGCGTTACGGCTAAGCACCGCCGGTGGCCC +GGTGTACGCGGGGTCGCTGAGTCGTCGTCAAGGGGCTACTTCTAAATTCTCCGTACTAGCAAGTCGTCTT +AAGAGCAACTTTTTGAAATAATCGCCTCGAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATG +AAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCA +TCTTGCGCCCTCCGGTACCCCGGTGGGCATGCCTGTTCGAGCGTCATTAAAATCATCAAGCACCGCTTGG +TATTGGGTCAGACGTCCCTGCACTCGCAGAGGGACGTACCCTAAACCCCTCGGCAACGTCCCGTGGCCGT +AGACGTAGCGGAATATACAATCTTTACCATGTCTGCGAGGCGCGCGAGGTCGTCTAGCCCCTCCGAATCT +TAACGTAGAACCTTAACCGTTGGCCACGGATCAGGC |
| b |
| diff -r 000000000000 -r 57e76d405a97 tool_dependencies.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Mon Mar 14 16:15:08 2016 -0400 |
| b |
| @@ -0,0 +1,6 @@ +<?xml version="1.0"?> +<tool_dependency> + <package name="hmmer" version="3.1b2"> + <repository changeset_revision="bccac727ef9e" name="package_hmmer_3_1b2" owner="aafc-mbb" toolshed="https://toolshed.g2.bx.psu.edu/" /> + </package> +</tool_dependency> |