| Previous changeset 14:b9e04854e2bb (2019-11-28) Next changeset 16:e132e7d02a3e (2020-12-04) |
|
Commit message:
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/rgrnastar commit a8e319862d723654c372a6d71e5de76e052586a9" |
|
modified:
macros.xml rg_rnaStar.xml test-data/test-cache/tophat-test/genomeParameters.txt tool_data_table_conf.xml.sample tool_data_table_conf.xml.test |
|
added:
test-data/filtered.barcodes.txt test-data/filtered3.Homo_sapiens.GRCh38.100.chr21.gtf test-data/filtered3.Homo_sapiens.GRCh38.dna.chromosome.21.fa.gz test-data/filtered3.bam test-data/pbmc_1k_v2_L001.R1.10k.fastq.gz test-data/pbmc_1k_v2_L001.R2.10k.fastq.gz test-data/rnastar_index2x_versioned.loc test-data/test-cache/tophat-test/Log.out tool-data/rnastar_index2x_versioned.loc.sample |
|
removed:
test-data/41737_R1_sub240k.fastq.gz test-data/41737_R2_sub240k.fastq.gz test-data/737K-august-2016.small.txt.gz test-data/SNORD83B.22.fa test-data/SNORD83B.22.gtf test-data/rnastar_index2_versioned.loc tool-data/rnastar_index2_versioned.loc.sample |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c macros.xml --- a/macros.xml Thu Nov 28 15:56:07 2019 -0500 +++ b/macros.xml Wed Aug 05 09:40:33 2020 -0400 |
| b |
| @@ -5,7 +5,7 @@ the index versions in sync, but you should manually adjust the +galaxy version number. --> <!-- STAR version to be used --> - <token name="@VERSION@">2.7.2b</token> + <token name="@VERSION@">2.7.5b</token> <!-- STAR index version compatible with this version of STAR This is the STAR version that introduced the index structure expected by the current version. @@ -13,7 +13,8 @@ STAR -h | grep versionGenome or by looking for the versionGenome parameter in source/parametersDefault of STAR's source code --> - <token name="@IDX_VERSION@">2.7.1a</token> + <token name="@IDX_VERSION@">2.7.4a</token> + <token name="@IDX_DATA_TABLE@">rnastar_index2x_versioned</token> <xml name="requirements"> <requirements> @@ -27,7 +28,7 @@ <param argument="--genomeDir" name="genomeDir" type="select" label="Select reference genome" help="If your genome of interest is not listed, contact the Galaxy team"> - <options from_data_table="rnastar_index2_versioned"> + <options from_data_table="@IDX_DATA_TABLE@"> <filter type="static_value" column="4" value="@WITH_GENE_MODEL@" /> <filter type="static_value" column="5" value="@IDX_VERSION@" /> <filter type="sort_by" column="2" /> @@ -53,7 +54,7 @@ <conditional name="refGenomeSource.geneSource"> <when value="indexed"> <action type="metadata" name="dbkey"> - <option type="from_data_table" name="rnastar_index2_versioned" column="1" offset="0"> + <option type="from_data_table" name="@IDX_DATA_TABLE@" column="1" offset="0"> <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/> <filter type="param_value" ref="refGenomeSource.GTFconditional.genomeDir" column="0"/> </option> @@ -76,10 +77,21 @@ --genomeDir 'tempstargenomedir' --genomeFastaFiles '${refGenomeSource.genomeFastaFiles}' ## Handle difference between indices with/without annotations - #if str($refGenomeSource.GTFconditional.GTFselect) == 'with-gtf': - --sjdbOverhang '${refGenomeSource.GTFconditional.sjdbOverhang}' - --sjdbGTFfile '${refGenomeSource.GTFconditional.sjdbGTFfile}' - #if str($refGenomeSource.GTFconditional.sjdbGTFfile.ext) == 'gff3': + #if 'GTFconditional' in $refGenomeSource: + ## GTFconditional exists only in STAR, but not STARsolo + #if str($refGenomeSource.GTFconditional.GTFselect) == 'with-gtf': + --sjdbOverhang '${refGenomeSource.GTFconditional.sjdbOverhang}' + --sjdbGTFfile '${refGenomeSource.GTFconditional.sjdbGTFfile}' + #if str($refGenomeSource.GTFconditional.sjdbGTFfile.ext) == 'gff3': + --sjdbGTFtagExonParentTranscript Parent + #end if + #end if + #else: + ## ref genome selection is less complex for STARsolo cause + ## with-gtf is mandatory there + --sjdbOverhang '${refGenomeSource.sjdbOverhang}' + --sjdbGTFfile '${refGenomeSource.sjdbGTFfile}' + #if str($refGenomeSource.sjdbGTFfile.ext) == 'gff3': --sjdbGTFtagExonParentTranscript Parent #end if #end if @@ -110,6 +122,13 @@ #end if #end if ]]></token> + <xml name="ref_selection"> + <param argument="--genomeFastaFiles" type="data" format="fasta" label="Select a reference genome" /> + <!-- Currently, this parameter is not exposed in the wrapper, + but used only in the tests to avoid excessive index sizes for + the tiny test genomes. --> + <param name="genomeSAindexNbases" type="hidden" value="" /> + </xml> <xml name="stdio" > <stdio> <regex match="FATAL error" source="both" level="fatal"/> @@ -119,48 +138,4 @@ <yield /> </stdio> </xml> - <xml name="refgenomehandling" > - <conditional name="refGenomeSource"> - <param name="geneSource" type="select" label="Custom or built-in reference genome" help="Built-ins were indexed using default options"> - <option value="indexed" selected="true">Use a built-in index</option> - <option value="history">Use reference genome from history and create temporary index</option> - </param> - <when value="indexed"> - <conditional name="GTFconditional"> - <param name="GTFselect" type="select" - label="Reference genome with or without an annotation" - help="Select the '... with builtin gene-model' option to select from the list of available indexes that were built with splice junction information. Select the '... without builtin gene-model' option to select from the list of available indexes without annotated splice junctions."> - <option value="without-gtf" selected='true'>use genome reference without builtin gene-model</option> - <option value="with-gtf">use genome reference with builtin gene-model</option> - </param> - <when value="with-gtf"> - <expand macro="index_selection" with_gene_model="1" /> - </when> - <when value="without-gtf"> - <expand macro="index_selection" with_gene_model="0" /> - <expand macro="@SJDBOPTIONS@" /> - </when> - </conditional> - </when> - <when value="history"> - <param argument="--genomeFastaFiles" type="data" format="fasta" label="Select a reference genome" /> - <!-- Currently, this parameter is not exposed in the wrapper, - but used only in the tests to avoid excessive index sizes for - the tiny test genomes. --> - <param name="genomeSAindexNbases" type="hidden" value="" /> - <conditional name="GTFconditional"> - <param name="GTFselect" type="select" - label="Build index with our without known splice junctions annotation" - help="To build an index with known splice junctions annotated, you will have to provide a GTF or GFF3 dataset that describes the gene models (the location of genes, transcripts and exons) known for the reference genome."> - <option value="without-gtf">build index without gene-model</option> - <option value="with-gtf">build index with gene-model</option> - </param> - <when value="with-gtf"> - <expand macro="@SJDBOPTIONS@" optional="false"/> - </when> - <when value="without-gtf" /> - </conditional> - </when> - </conditional> - </xml> </macros> |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c rg_rnaStar.xml --- a/rg_rnaStar.xml Thu Nov 28 15:56:07 2019 -0500 +++ b/rg_rnaStar.xml Wed Aug 05 09:40:33 2020 -0400 |
| b |
| @@ -246,7 +246,44 @@ </conditional> <!-- Genome source. --> - <expand macro="refgenomehandling" /> + <conditional name="refGenomeSource"> + <param name="geneSource" type="select" label="Custom or built-in reference genome" help="Built-ins were indexed using default options"> + <option value="indexed" selected="true">Use a built-in index</option> + <option value="history">Use reference genome from history and create temporary index</option> + </param> + <when value="indexed"> + <conditional name="GTFconditional"> + <param name="GTFselect" type="select" + label="Reference genome with or without an annotation" + help="Select the '... with builtin gene-model' option to select from the list of available indexes that were built with splice junction information. Select the '... without builtin gene-model' option to select from the list of available indexes without annotated splice junctions, and, optionally, provide your own splice-junction annonations."> + <option value="without-gtf" selected='true'>use genome reference without builtin gene-model</option> + <option value="with-gtf">use genome reference with builtin gene-model</option> + </param> + <when value="with-gtf"> + <expand macro="index_selection" with_gene_model="1" /> + </when> + <when value="without-gtf"> + <expand macro="index_selection" with_gene_model="0" /> + <expand macro="@SJDBOPTIONS@" /> + </when> + </conditional> + </when> + <when value="history"> + <expand macro="ref_selection" /> + <conditional name="GTFconditional"> + <param name="GTFselect" type="select" + label="Build index with or without known splice junctions annotation" + help="To build an index with known splice junctions annotated, you will have to provide a GTF or GFF3 dataset that describes the gene models (the location of genes, transcripts and exons) known for the reference genome."> + <option value="without-gtf">build index without gene-model</option> + <option value="with-gtf">build index with gene-model</option> + </param> + <when value="with-gtf"> + <expand macro="@SJDBOPTIONS@" optional="false"/> + </when> + <when value="without-gtf" /> + </conditional> + </when> + </conditional> <conditional name="twopass"> <param argument="--twopassMode" type="select" |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c test-data/41737_R1_sub240k.fastq.gz |
| b |
| Binary file test-data/41737_R1_sub240k.fastq.gz has changed |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c test-data/41737_R2_sub240k.fastq.gz |
| b |
| Binary file test-data/41737_R2_sub240k.fastq.gz has changed |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c test-data/737K-august-2016.small.txt.gz |
| b |
| Binary file test-data/737K-august-2016.small.txt.gz has changed |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c test-data/SNORD83B.22.fa --- a/test-data/SNORD83B.22.fa Thu Nov 28 15:56:07 2019 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| b |
| @@ -1,17 +0,0 @@ ->22 dna:chromosome chromosome:GRCh38:22:39313740:50818468:1 REF -CACACTCAAAGCAGCAAACAGCCCAGCAAGGCCAGACTGGGAATTTCCTCATCTCAGGAC -TTCAAAGCCAGTGTGAAAGGACTGCCAACACCCTCTCCTTCCTTTCCTCTCCCACCACAG -GGCCACCAGCGTCTGTGGCCTTGGATCCTCCCTCTACAAGAGCCCCCCCATGACAAGTCA -GGACCTGCCTCACCTTGCGGAGGGTGAGCACCCGCTTCTTGGTTCCCACCACACAGCCTT -TCAGCATGACAAAGTCATTGGTCACTTCACCATAGTGGACAAAGCCACCCTGGAAAACGA -GCATCGGATCAGCACAGGCCCAGGAGGGGATTGTCGTGCAGATGACCCCTCCAGGTTCAG -GCCCTCCCTGACCACAGGGCTGTTCTCAGAAGGAAGGCAACAAGGAACGGTTCCGCAGTC -TGTCTCGGGCGCTGTGCCCAGCGCACATTCCAGGCCTCATCACTGAACAGCTGAGCCTGA -GACCCCACTTCTCACCAGCCAACCCCGACGAGTGGACTCAGATGACAACATGCCACTTAC -AAGGGACACAGCTAGGTGTTGTGTTGGCTTCAGTTAACGATCCTGCTAGCAGCCCCTAGG -AAGCAGCCTATCCCCAAAAGCACGAGGCCTGGGATGGCCTCACAGAGCAGAACACCCATT -ACTTACCAGAGGGTTGATGCTCTTGTCAGATAGGTCATAGTCAGTGGAGGCATTGTTCTT -GATCAGCTTGCCGTCCTTGATAAGGTAGCCCTGGCCAATCTTATAAATCTGAATGAACAA -GAAGGGTGTAAGGCTGGGGCATTAGGGACAAATAACCCAGACATGCCAGTGTGCTGACCT -GCAAAGCACGCTAGAAGGCAGCTGAGGCCTCAGTCCCAGTCACAGCGTATCCCAAGGTCA -GAGCAAAAAGCTGGCTGGCCCTCCAGGTTCCTTTCTGTAAGGCGGCTGGGCTAAAACTAA \ No newline at end of file |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c test-data/SNORD83B.22.gtf --- a/test-data/SNORD83B.22.gtf Thu Nov 28 15:56:07 2019 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| b |
| @@ -1,8 +0,0 @@ -#!genome-build GRCh38.p12 -#!genome-version GRCh38 -#!genome-date 2013-12 -#!genome-build-accession NCBI:GCA_000001405.27 -#!genebuild-last-updated 2018-11 -22 ensembl gene 39313819 39313911 . - . gene_id "ENSG00000209480"; gene_version "1"; gene_name "SNORD83B"; gene_source "ensembl"; gene_biotype "snoRNA"; -22 ensembl transcript 39313819 39313911 . - . gene_id "ENSG00000209480"; gene_version "1"; transcript_id "ENST00000386745"; transcript_version "1"; gene_name "SNORD83B"; gene_source "ensembl"; gene_biotype "snoRNA"; transcript_name "SNORD83B-201"; transcript_source "ensembl"; transcript_biotype "snoRNA"; tag "basic"; transcript_support_level "NA"; -22 ensembl exon 39313819 39313911 . - . gene_id "ENSG00000209480"; gene_version "1"; transcript_id "ENST00000386745"; transcript_version "1"; exon_number "1"; gene_name "SNORD83B"; gene_source "ensembl"; gene_biotype "snoRNA"; transcript_name "SNORD83B-201"; transcript_source "ensembl"; transcript_biotype "snoRNA"; exon_id "ENSE00001501751"; exon_version "1"; tag "basic"; transcript_support_level "NA"; |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c test-data/filtered.barcodes.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/filtered.barcodes.txt Wed Aug 05 09:40:33 2020 -0400 |
| b |
| @@ -0,0 +1,394 @@ +AAACCTGAGCGCTCCA +AAACGGGGTTTGTGTG +AAAGATGAGTACTTGC +AAAGCAATCCACGAAT +AAAGTAGGTAGCAAAT +AACCATGGTAGTACCT +AACCGCGCACATCTTT +AACCGCGCATGCCTAA +AACGTTGTCACAGTAC +AACTTTCTCTGTTTGT +AAGACCTTCAAACGGG +AAGGAGCAGTATCGAA +AAGGAGCAGTGGTAGC +AAGGAGCCAGCTTAAC +AAGGAGCTCTAAGCCA +ACACCAACAGCTGTAT +ACACCGGTCTAACGGT +ACATACGCACACCGCA +ACATACGTCTGCCCTA +ACATACGTCTGGCGAC +ACATCAGCAAACGCGA +ACATGGTCAGACTCGC +ACCAGTAAGCCTCGTG +ACCGTAACACAACGCC +ACCGTAAGTTCAGTAC +ACCGTAATCTTGGGTA +ACGAGCCCAAGAGTCG +ACGAGCCGTGCTGTAT +ACGAGGATCCTATGTT +ACGAGGATCTTTAGTC +ACGATACCAAAGTCAA +ACGCAGCTCACCGTAA +ACGCCGAAGCGCTTAT +ACGGAGACATCTATGG +ACGGCCACACCGAAAG +ACGGGCTGTCGGCACT +ACGGGTCCACACCGCA +ACTGAGTAGACGACGT +ACTGAGTTCGGAGCAA +ACTGAGTTCGTCTGAA +ACTGATGCAAGTTCTG +ACTGCTCGTGCAGGTA +ACTGTCCAGAGCTGCA +ACTGTCCTCCCACTTG +ACTTACTAGTTAGCGG +ACTTACTGTCCCTTGT +ACTTACTGTTACCAGT +ACTTTCAGTCTCCACT +ACTTTCAGTTAAAGTG +AGAATAGCAGCTGTAT +AGACGTTCAAGGCTCC +AGACGTTCAGACTCGC +AGACGTTGTCAAAGCG +AGACGTTTCAGTTTGG +AGAGCTTGTGACGCCT +AGAGTGGCAGATGAGC +AGAGTGGTCTTTAGGG +AGCATACCAGGGTATG +AGCCTAAGTTTAGGAA +AGCCTAATCCCGACTT +AGCGGTCAGTACATGA +AGCGGTCGTTCCACGG +AGCTCCTGTGTTTGGT +AGCTCTCAGCAGCCTC +AGCTCTCAGTGTTAGA +AGGCCACGTCAGCTAT +AGGCCACGTGCAGGTA +AGGCCACTCGTGGTCG +AGGGAGTAGGGTCTCC +AGGGAGTTCGATGAGG +AGGGATGGTTCAGGCC +AGGTCATAGCTCCTCT +AGGTCATCATCCGTGG +AGTAGTCAGGATGTAT +AGTAGTCCAATGGATA +AGTCTTTAGCAGGCTA +AGTGAGGCAATCGGTT +AGTGAGGTCGAACGGA +AGTGTCAAGGCGATAC +AGTGTCAGTTCCATGA +ATAACGCGTCGGCACT +ATAAGAGCACCAGGTC +ATAAGAGCACTTCTGC +ATAAGAGTCGGGAGTA +ATAGACCGTCCTAGCG +ATCACGACATATGCTG +ATCACGAGTCGACTGC +ATCATGGTCCGTACAA +ATCCACCCATTACGAC +ATCGAGTCAGGTCTCG +ATCGAGTGTTCCGTCT +ATCTGCCCACCAGGCT +ATCTGCCTCGCCATAA +ATGAGGGGTCTTCAAG +ATGTGTGAGGCTCAGA +ATTACTCAGACCCACC +ATTCTACAGTTTCCTT +ATTCTACTCATTGCGA +ATTTCTGTCTAACTCT +CAACCAAGTCCGTCAG +CAACTAGTCATGGTCA +CAAGAAAGTTCCGTCT +CAAGATCTCGTAGGTT +CAAGGCCCAATCTACG +CAAGGCCGTTATTCTC +CAAGTTGTCGTACGGC +CACAAACAGCCCAATT +CACACCTTCCCAACGG +CACACTCCATATGAGA +CACAGGCCAGTCCTTC +CACAGGCGTCATGCCG +CACAGTAAGCTGTCTA +CACAGTACAGTCGTGC +CACATAGTCGTACCGG +CACCACTAGTGTACCT +CACCACTCATACGCCG +CACCTTGAGTGTACGG +CAGAATCGTGAAGGCT +CAGAATCGTTACGACT +CAGAGAGTCTTGTACT +CAGCAGCGTGCAACGA +CAGCATAAGTGGCACA +CAGCCGAGTTCTGAAC +CAGCTAACACCTCGTT +CAGCTAAGTCAGTGGA +CATATTCCACCTCGTT +CATCAAGAGACAGAGA +CATCCACAGGCGACAT +CATCCACTCTGCCAGG +CATGCCTGTTCTCATT +CCAATCCAGACCTAGG +CCACCTACAGAAGCAC +CCACCTACAGCCTGTG +CCCAATCTCCTAAGTG +CCCAGTTAGTCCAGGA +CCCAGTTCAAGGTTCT +CCCATACAGCACCGCT +CCCATACGTACCGCTG +CCCATACGTGTTTGTG +CCCTCCTGTGTGCCTG +CCCTCCTTCGGTCCGA +CCGGTAGGTGCAGTAG +CCGGTAGTCTTCCTTC +CCGTACTCATGGTCTA +CCGTACTTCACTTCAT +CCTAAAGGTGAGGGAG +CCTACCAAGTGGGATC +CCTACCAGTAAGTGGC +CCTAGCTAGTCAAGCG +CCTAGCTGTTTGCATG +CGACCTTAGCCGTCGT +CGACCTTAGCGATCCC +CGACCTTTCTGTCAAG +CGACTTCGTTCGAATC +CGACTTCGTTGTGGCC +CGACTTCTCATATCGG +CGAGAAGTCTTGCATT +CGAGCACAGAAGGTTT +CGAGCACCAACGATGG +CGAGCACTCAGAAATG +CGAGCCACACCAGCAC +CGATCGGCATAACCTG +CGATGGCGTGCACGAA +CGATGGCGTGGTTTCA +CGCGGTACAGTATGCT +CGCGGTACATGGATGG +CGCTATCTCATCTGTT +CGCTGGAAGGAGCGTT +CGCTTCAAGTACGCGA +CGCTTCAAGTTCGCGC +CGCTTCACAATCAGAA +CGGACACTCTATCCCG +CGGACGTTCAGATAAG +CGGACGTTCTCATTCA +CGGACTGTCTAACTCT +CGGAGCTCACGAAGCA +CGGAGTCTCAACACCA +CGGGTCAGTCGACTAT +CGGGTCATCATCGCTC +CGGTTAAGTTCAGTAC +CGGTTAAGTTGTGGCC +CGTCACTTCGAATGGG +CGTGTCTAGACTGTAA +CGTGTCTAGATAGCAT +CGTTAGACAAGGGTCA +CGTTCTGGTACATGTC +CTAACTTGTATGCTTG +CTAACTTTCTAACCGA +CTAAGACGTTTGTGTG +CTACATTAGAAACGCC +CTACATTAGGTGACCA +CTACATTTCTCGAGTA +CTAGAGTAGACACGAC +CTAGAGTGTCGCGAAA +CTCACACCATTAACCG +CTCACACGTGCTTCTC +CTCAGAATCGGATGGA +CTCATTATCTAGAGTC +CTCCTAGTCACGCATA +CTCGGAGAGCTGAAAT +CTCGGAGTCTTAGAGC +CTCGGGACACACGCTG +CTCGGGATCGTAGGAG +CTCGTACAGGTAAACT +CTCTAATGTCCAGTTA +CTCTGGTAGAGTGACC +CTGAAGTCAATTGCTG +CTGAAGTGTATAATGG +CTGAAGTGTGTCGCTG +CTGATCCAGTAGCGGT +CTGATCCTCGTCACGG +CTGCCTAGTTCGTGAT +CTGCGGAAGACTAGAT +CTGCTGTCAAGGTTCT +CTGCTGTCATTATCTC +CTGCTGTTCAACTCTT +CTGGTCTTCATAAAGG +CTGTGCTAGCAGGTCA +CTGTGCTCATATACGC +CTGTTTAAGGGATGGG +CTTACCGGTGGACGAT +CTTAGGACAAACCTAC +CTTCTCTAGATGGCGT +CTTGGCTAGTCAAGGC +CTTTGCGAGATCCTGT +CTTTGCGGTTTAAGCC +CTTTGCGGTTTGACAC +GAAATGATCTCCTATA +GAATAAGGTCAAAGAT +GAATGAATCATCACCC +GACCAATCAGCTGGCT +GACCAATGTCATGCAT +GACGCGTTCCGATATG +GACGGCTCATGATCCA +GACGTGCCATACGCTA +GACTGCGCAATGGACG +GACTGCGCATCTACGA +GACTGCGGTCGGCACT +GATCGCGTCGTAGGTT +GATCTAGGTCTAGCGC +GATGAAATCACAACGT +GATGCTAGTATATGGA +GATTCAGCATGCGCAC +GCAAACTAGAGGGCTT +GCAAACTGTGTCAATC +GCAAACTTCTGCGTAA +GCACTCTAGCACAGGT +GCAGCCACAGGACCCT +GCAGCCATCCTCAATT +GCATGATGTCAACATC +GCATGTACACAGCGTC +GCATGTAGTTCAACCA +GCATGTAGTTGCCTCT +GCGACCACAGACAAAT +GCGAGAACAGATGGGT +GCGCAACCACCTGGTG +GCGCAACTCGTCACGG +GCGCAGTAGGAGTACC +GCGCAGTGTTCGCTAA +GCGCGATAGGATGGAA +GCGCGATGTAGCTTGT +GCGGGTTCATCCGTGG +GCGGGTTTCGTTTATC +GCTCTGTGTGCCTGGT +GCTGCAGTCTGAGTGT +GCTTCCAAGCAGGCTA +GCTTCCAGTGCAGTAG +GCTTGAAAGAAGGACA +GGAATAACACCAGGTC +GGACAAGAGTACGCCC +GGACATTCACTGCCAG +GGACATTTCACAGTAC +GGACGTCAGTGGGATC +GGATGTTTCCACTGGG +GGCAATTCACCATCCT +GGCGACTTCAACACCA +GGCTGGTTCTCGTTTA +GGGAATGAGGGTTTCT +GGGACCTCAGTCGATT +GGGACCTTCGGAGGTA +GGGATGAGTGCAGACA +GGTGCGTTCAGCTCGG +GGTGCGTTCGCTAGCG +GTACGTAGTATCAGTC +GTACTCCCACAGACAG +GTAGGCCCACTGCCAG +GTATCTTAGACGCTTT +GTATCTTTCCTCAACC +GTATTCTAGGTTCCTA +GTCACAATCTCAACTT +GTCACGGAGCACACAG +GTCATTTGTGCTTCTC +GTGCAGCTCTTCATGT +GTGCATAAGGAGCGTT +GTGCGGTAGCTACCGC +GTGCGGTAGGCCGAAT +GTGCGGTCATGCCACG +GTGCTTCAGATGAGAG +GTGGGTCCATCGGGTC +GTGGGTCGTTCGAATC +GTTAAGCAGCCACCTG +GTTAAGCAGTACATGA +GTTAAGCCAATTGCTG +GTTACAGGTCAGGACA +GTTACAGTCCAGTAGT +GTTCTCGTCTAACTGG +TAAACCGCAAGGACAC +TAAACCGCATACGCCG +TAAACCGCATGGTAGG +TAAGCGTAGCTCCTCT +TACACGATCGTGGGAA +TACAGTGAGTGTCCCG +TACAGTGCAGCTCGCA +TACGGATCAGCTATTG +TACGGGCCACAACGTT +TACGGTAAGGATGCGT +TACTTACAGGCTATCT +TACTTGTAGACTTTCG +TACTTGTCACATAACC +TAGCCGGCAGGGTTAG +TATGCCCCAATGTAAG +TATGCCCGTACTTAGC +TCAACGAAGCTAGTGG +TCAATCTAGGATGCGT +TCACAAGCATCCTTGC +TCACGAATCACTCCTG +TCAGATGTCGTTGCCT +TCAGCAATCAGCACAT +TCAGGATGTATAGGGC +TCGCGAGGTTCCAACA +TCGCGAGGTTGTCTTT +TCGTACCAGGCTCAGA +TCGTAGAGTCTTGTCC +TCTATTGCATGCCTAA +TCTCTAACAGATCCAT +TCTTTCCTCCACTCCA +TGACAACGTTGTGGCC +TGACTAGGTTCGGGCT +TGACTAGTCACATACG +TGACTTTCATTGGCGC +TGAGAGGCATGTCGAT +TGAGCCGAGCGAAGGG +TGAGCCGCAGTCACTA +TGAGGGAAGAGACTTA +TGAGGGACATCCAACA +TGCACCTCATGCAATC +TGCCAAACAAACCTAC +TGCCAAATCGAATCCA +TGCCCTAAGTGTACTC +TGCGCAGAGGAGTTTA +TGCGCAGGTGGGTATG +TGCGTGGGTCTCCACT +TGCTACCCATGACGGA +TGCTACCTCGGCTACG +TGCTGCTGTTATTCTC +TGCTGCTGTTCGGCAC +TGCTGCTTCAAAGTAG +TGGACGCAGACCACGA +TGGACGCCAGAGTGTG +TGGCGCACAGATGGGT +TGGCTGGCACCCATTC +TGGGAAGCATCCCATC +TGGTTAGTCAACACAC +TGGTTAGTCACAATGC +TGGTTCCAGTATTGGA +TGGTTCCCAAGCCGCT +TGGTTCCCATCGTCGG +TGTATTCGTAGCGTGA +TGTCCCATCAACACTG +TGTGGTAAGGGCATGT +TTAACTCCAACACCTA +TTAGGACCAGCCTTTC +TTAGGACGTCTTTCAT +TTAGTTCCAAGTAGTA +TTATGCTCACCAACCG +TTATGCTTCCACGTTC +TTATGCTTCCCTTGTG +TTCCCAGTCTTGCATT +TTCGGTCAGCTAAACA +TTCTCAAAGCTACCTA +TTCTCAATCCACGTTC +TTCTCAATCGCCTGAG +TTCTCCTTCGCCAAAT +TTCTTAGTCAGCTCGG +TTGAACGAGCTTCGCG +TTGAACGCACGAAAGC +TTGCGTCGTTATTCTC +TTGTAGGTCGGATGTT +TTTACTGAGGCTAGGT +TTTACTGCAGTGGAGT +TTTCCTCCACTTGGAT +TTTCCTCCATCTCGCT +TTTGGTTAGCACCGTC +TTTGGTTAGTGGGCTA |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c test-data/filtered3.Homo_sapiens.GRCh38.100.chr21.gtf --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/filtered3.Homo_sapiens.GRCh38.100.chr21.gtf Wed Aug 05 09:40:33 2020 -0400 |
| b |
| b'@@ -0,0 +1,461 @@\n+#!genome-build GRCh38.p13\n+#!genome-version GRCh38\n+#!genome-date 2013-12\n+#!genome-build-accession NCBI:GCA_000001405.28\n+#!genebuild-last-updated 2019-06\n+21\thavana\tgene\t1000\t6346\t.\t+\t.\tgene_id "ENSG00000279493"; gene_version "1"; gene_name "FP565260.4"; gene_source "havana"; gene_biotype "protein_coding";\n+21\thavana\ttranscript\t1000\t6346\t.\t+\t.\tgene_id "ENSG00000279493"; gene_version "1"; transcript_id "ENST00000624081"; transcript_version "1"; gene_name "FP565260.4"; gene_source "havana"; gene_biotype "protein_coding"; transcript_name "FP565260.4-201"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "cds_start_NF"; tag "mRNA_start_NF"; tag "basic"; transcript_support_level "5";\n+21\thavana\texon\t1000\t1075\t.\t+\t.\tgene_id "ENSG00000279493"; gene_version "1"; transcript_id "ENST00000624081"; transcript_version "1"; exon_number "1"; gene_name "FP565260.4"; gene_source "havana"; gene_biotype "protein_coding"; transcript_name "FP565260.4-201"; transcript_source "havana"; transcript_biotype "protein_coding"; exon_id "ENSE00003760288"; exon_version "1"; tag "cds_start_NF"; tag "mRNA_start_NF"; tag "basic"; transcript_support_level "5";\n+21\thavana\tCDS\t1000\t1075\t.\t+\t0\tgene_id "ENSG00000279493"; gene_version "1"; transcript_id "ENST00000624081"; transcript_version "1"; exon_number "1"; gene_name "FP565260.4"; gene_source "havana"; gene_biotype "protein_coding"; transcript_name "FP565260.4-201"; transcript_source "havana"; transcript_biotype "protein_coding"; protein_id "ENSP00000485664"; protein_version "1"; tag "cds_start_NF"; tag "mRNA_start_NF"; tag "basic"; transcript_support_level "5";\n+21\thavana\texon\t1749\t1888\t.\t+\t.\tgene_id "ENSG00000279493"; gene_version "1"; transcript_id "ENST00000624081"; transcript_version "1"; exon_number "2"; gene_name "FP565260.4"; gene_source "havana"; gene_biotype "protein_coding"; transcript_name "FP565260.4-201"; transcript_source "havana"; transcript_biotype "protein_coding"; exon_id "ENSE00003758404"; exon_version "1"; tag "cds_start_NF"; tag "mRNA_start_NF"; tag "basic"; transcript_support_level "5";\n+21\thavana\tCDS\t1749\t1888\t.\t+\t2\tgene_id "ENSG00000279493"; gene_version "1"; transcript_id "ENST00000624081"; transcript_version "1"; exon_number "2"; gene_name "FP565260.4"; gene_source "havana"; gene_biotype "protein_coding"; transcript_name "FP565260.4-201"; transcript_source "havana"; transcript_biotype "protein_coding"; protein_id "ENSP00000485664"; protein_version "1"; tag "cds_start_NF"; tag "mRNA_start_NF"; tag "basic"; transcript_support_level "5";\n+21\thavana\texon\t3587\t3672\t.\t+\t.\tgene_id "ENSG00000279493"; gene_version "1"; transcript_id "ENST00000624081"; transcript_version "1"; exon_number "3"; gene_name "FP565260.4"; gene_source "havana"; gene_biotype "protein_coding"; transcript_name "FP565260.4-201"; transcript_source "havana"; transcript_biotype "protein_coding"; exon_id "ENSE00003755466"; exon_version "1"; tag "cds_start_NF"; tag "mRNA_start_NF"; tag "basic"; transcript_support_level "5";\n+21\thavana\tCDS\t3587\t3672\t.\t+\t0\tgene_id "ENSG00000279493"; gene_version "1"; transcript_id "ENST00000624081"; transcript_version "1"; exon_number "3"; gene_name "FP565260.4"; gene_source "havana"; gene_biotype "protein_coding"; transcript_name "FP565260.4-201"; transcript_source "havana"; transcript_biotype "protein_coding"; protein_id "ENSP00000485664"; protein_version "1"; tag "cds_start_NF"; tag "mRNA_start_NF"; tag "basic"; transcript_support_level "5";\n+21\thavana\texon\t6136\t6346\t.\t+\t.\tgene_id "ENSG00000279493"; gene_version "1"; transcript_id "ENST00000624081"; transcript_version "1"; exon_number "4"; gene_name "FP565260.4"; gene_source "havana"; gene_biotype "protein_coding"; transcript_name "FP565260.4-201"; transcript_source "havana"; transcript_biotype "protein_coding"; exon_id "ENSE00003755385"; exon_version "1"; tag "cds_start_NF"; tag "mRNA_start_NF"; tag "basic"; transcript_support_level "5";\n+21\thavana\tCDS\t6136\t6298\t.\t+\t1\tgene_id "ENSG00000279493"; gene_'..b'\tgene\t586591\t586691\t.\t+\t.\tgene_id "ENSG00000277777"; gene_version "1"; gene_name "CU633967.2"; gene_source "ensembl"; gene_biotype "misc_RNA";\n+21\tensembl\ttranscript\t586591\t586691\t.\t+\t.\tgene_id "ENSG00000277777"; gene_version "1"; transcript_id "ENST00000610788"; transcript_version "1"; gene_name "CU633967.2"; gene_source "ensembl"; gene_biotype "misc_RNA"; transcript_name "CU633967.2-201"; transcript_source "ensembl"; transcript_biotype "misc_RNA"; tag "basic"; transcript_support_level "NA";\n+21\tensembl\texon\t586591\t586691\t.\t+\t.\tgene_id "ENSG00000277777"; gene_version "1"; transcript_id "ENST00000610788"; transcript_version "1"; exon_number "1"; gene_name "CU633967.2"; gene_source "ensembl"; gene_biotype "misc_RNA"; transcript_name "CU633967.2-201"; transcript_source "ensembl"; transcript_biotype "misc_RNA"; exon_id "ENSE00003748388"; exon_version "1"; tag "basic"; transcript_support_level "NA";\n+21\thavana\tgene\t692383\t694838\t.\t-\t.\tgene_id "ENSG00000279186"; gene_version "1"; gene_name "FP236315.2"; gene_source "havana"; gene_biotype "TEC";\n+21\thavana\ttranscript\t692383\t694838\t.\t-\t.\tgene_id "ENSG00000279186"; gene_version "1"; transcript_id "ENST00000624506"; transcript_version "1"; gene_name "FP236315.2"; gene_source "havana"; gene_biotype "TEC"; transcript_name "FP236315.2-201"; transcript_source "havana"; transcript_biotype "TEC"; tag "basic"; transcript_support_level "NA";\n+21\thavana\texon\t692383\t694838\t.\t-\t.\tgene_id "ENSG00000279186"; gene_version "1"; transcript_id "ENST00000624506"; transcript_version "1"; exon_number "1"; gene_name "FP236315.2"; gene_source "havana"; gene_biotype "TEC"; transcript_name "FP236315.2-201"; transcript_source "havana"; transcript_biotype "TEC"; exon_id "ENSE00003756739"; exon_version "1"; tag "basic"; transcript_support_level "NA";\n+21\thavana\tgene\t694546\t696361\t.\t+\t.\tgene_id "ENSG00000279784"; gene_version "1"; gene_name "FP236315.3"; gene_source "havana"; gene_biotype "lncRNA";\n+21\thavana\ttranscript\t694546\t696361\t.\t+\t.\tgene_id "ENSG00000279784"; gene_version "1"; transcript_id "ENST00000623587"; transcript_version "1"; gene_name "FP236315.3"; gene_source "havana"; gene_biotype "lncRNA"; transcript_name "FP236315.3-201"; transcript_source "havana"; transcript_biotype "lncRNA"; tag "basic"; transcript_support_level "2";\n+21\thavana\texon\t694546\t694654\t.\t+\t.\tgene_id "ENSG00000279784"; gene_version "1"; transcript_id "ENST00000623587"; transcript_version "1"; exon_number "1"; gene_name "FP236315.3"; gene_source "havana"; gene_biotype "lncRNA"; transcript_name "FP236315.3-201"; transcript_source "havana"; transcript_biotype "lncRNA"; exon_id "ENSE00003758868"; exon_version "1"; tag "basic"; transcript_support_level "2";\n+21\thavana\texon\t696164\t696361\t.\t+\t.\tgene_id "ENSG00000279784"; gene_version "1"; transcript_id "ENST00000623587"; transcript_version "1"; exon_number "2"; gene_name "FP236315.3"; gene_source "havana"; gene_biotype "lncRNA"; transcript_name "FP236315.3-201"; transcript_source "havana"; transcript_biotype "lncRNA"; exon_id "ENSE00003757033"; exon_version "1"; tag "basic"; transcript_support_level "2";\n+21\thavana\tgene\t696205\t698657\t.\t-\t.\tgene_id "ENSG00000279064"; gene_version "1"; gene_name "FP236315.1"; gene_source "havana"; gene_biotype "lncRNA";\n+21\thavana\ttranscript\t696205\t698657\t.\t-\t.\tgene_id "ENSG00000279064"; gene_version "1"; transcript_id "ENST00000623723"; transcript_version "1"; gene_name "FP236315.1"; gene_source "havana"; gene_biotype "lncRNA"; transcript_name "FP236315.1-201"; transcript_source "havana"; transcript_biotype "lncRNA"; tag "basic"; transcript_support_level "2";\n+21\thavana\texon\t696205\t696358\t.\t-\t.\tgene_id "ENSG00000279064"; gene_version "1"; transcript_id "ENST00000623723"; transcript_version "1"; exon_number "2"; gene_name "FP236315.1"; gene_source "havana"; gene_biotype "lncRNA"; transcript_name "FP236315.1-201"; transcript_source "havana"; transcript_biotype "lncRNA"; exon_id "ENSE00003756092"; exon_version "1"; tag "basic"; transcript_support_level "2";\n' |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c test-data/filtered3.Homo_sapiens.GRCh38.dna.chromosome.21.fa.gz |
| b |
| Binary file test-data/filtered3.Homo_sapiens.GRCh38.dna.chromosome.21.fa.gz has changed |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c test-data/filtered3.bam |
| b |
| Binary file test-data/filtered3.bam has changed |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c test-data/pbmc_1k_v2_L001.R1.10k.fastq.gz |
| b |
| Binary file test-data/pbmc_1k_v2_L001.R1.10k.fastq.gz has changed |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c test-data/pbmc_1k_v2_L001.R2.10k.fastq.gz |
| b |
| Binary file test-data/pbmc_1k_v2_L001.R2.10k.fastq.gz has changed |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c test-data/rnastar_index2_versioned.loc --- a/test-data/rnastar_index2_versioned.loc Thu Nov 28 15:56:07 2019 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| b |
| @@ -1,4 +0,0 @@ -##STAR versioned indexes -#build_id dbkey display_name path with_gene_model version -000 ? test_index ${__HERE__}/test-cache/tophat-test 0 2.7.1a -001 ? test_index_with_gene_model ${__HERE__}/test-cache/tophat-test 1 2.7.1a |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c test-data/rnastar_index2x_versioned.loc --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnastar_index2x_versioned.loc Wed Aug 05 09:40:33 2020 -0400 |
| b |
| @@ -0,0 +1,4 @@ +##STAR versioned indexes +#build_id dbkey display_name path with_gene_model version +000 ? test_index ${__HERE__}/test-cache/tophat-test 0 2.7.4a +001 ? test_index_with_gene_model ${__HERE__}/test-cache/tophat-test 1 2.7.4a |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c test-data/test-cache/tophat-test/Log.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-cache/tophat-test/Log.out Wed Aug 05 09:40:33 2020 -0400 |
| b |
| @@ -0,0 +1,50 @@ +STAR version=2.7.5a +STAR compilation time,server,dir=Tue Jun 16 12:17:16 EDT 2020 vega:/home/dobin/data/STAR/STARcode/STAR.master/source +##### Command Line: +STAR --runMode genomeGenerate --genomeDir tempstargenomedir --genomeFastaFiles tools/rgrnastar/test-data/tophat_test.fa --genomeSAindexNbases 5 +##### Initial USER parameters from Command Line: +###### All USER parameters from Command Line: +runMode genomeGenerate ~RE-DEFINED +genomeDir tempstargenomedir ~RE-DEFINED +genomeFastaFiles tools/rgrnastar/test-data/tophat_test.fa ~RE-DEFINED +genomeSAindexNbases 5 ~RE-DEFINED +##### Finished reading parameters from all sources + +##### Final user re-defined parameters-----------------: +runMode genomeGenerate +genomeDir tempstargenomedir +genomeFastaFiles tools/rgrnastar/test-data/tophat_test.fa +genomeSAindexNbases 5 + +------------------------------- +##### Final effective command line: +STAR --runMode genomeGenerate --genomeDir tempstargenomedir --genomeFastaFiles tools/rgrnastar/test-data/tophat_test.fa --genomeSAindexNbases 5 +---------------------------------------- + +Number of fastq files for each mate = 1 +Finished loading and checking parameters +--genomeDir directory created: tempstargenomedir/ +Jul 29 17:04:16 ... starting to generate Genome files +tools/rgrnastar/test-data/tophat_test.fa : chr # 0 "test_chromosome" chrStart: 0 +Estimated genome size=201262144 = 262144 + 201000000 +GstrandBit=32 +Number of SA indices: 1300 +Jul 29 17:04:16 ... starting to sort Suffix Array. This may take a long time... +Number of chunks: 1; chunks size limit: 18599685304 bytes +Jul 29 17:04:16 ... sorting Suffix Array chunks and saving them to disk... +Writing 10400 bytes into tempstargenomedir//SA_0 ; empty space on disk = 66320359424 bytes ... done +Jul 29 17:04:16 ... loading chunks from disk, packing SA... +Jul 29 17:04:16 ... finished generating suffix array +Jul 29 17:04:16 ... generating Suffix Array index +Jul 29 17:04:16 ... completed Suffix Array index +Jul 29 17:04:16 ... writing Genome to disk ... +Writing 262144 bytes into tempstargenomedir//Genome ; empty space on disk = 66320355328 bytes ... done +SA size in bytes: 5366 +Jul 29 17:04:16 ... writing Suffix Array to disk ... +Writing 5366 bytes into tempstargenomedir//SA ; empty space on disk = 66320093184 bytes ... done +Jul 29 17:04:16 ... writing SAindex to disk +Writing 8 bytes into tempstargenomedir//SAindex ; empty space on disk = 66320084992 bytes ... done +Writing 48 bytes into tempstargenomedir//SAindex ; empty space on disk = 66320084992 bytes ... done +Writing 5971 bytes into tempstargenomedir//SAindex ; empty space on disk = 66320084992 bytes ... done +Jul 29 17:04:16 ..... finished successfully +DONE: Genome generation, EXITING |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c test-data/test-cache/tophat-test/genomeParameters.txt --- a/test-data/test-cache/tophat-test/genomeParameters.txt Thu Nov 28 15:56:07 2019 -0500 +++ b/test-data/test-cache/tophat-test/genomeParameters.txt Wed Aug 05 09:40:33 2020 -0400 |
| b |
| @@ -1,10 +1,13 @@ -### STAR --runMode genomeGenerate --genomeDir test-cache/tophat_test/ --genomeFastaFiles tophat_test.fa --genomeSAindexNbases 5 +### STAR --runMode genomeGenerate --genomeDir tempstargenomedir --genomeFastaFiles tools/rgrnastar/test-data/tophat_test.fa --genomeSAindexNbases 5 ### GstrandBit 32 -versionGenome 2.7.1a -genomeFastaFiles tophat_test.fa +versionGenome 2.7.4a +genomeType Full +genomeFastaFiles tools/rgrnastar/test-data/tophat_test.fa genomeSAindexNbases 5 genomeChrBinNbits 18 genomeSAsparseD 1 +genomeTransformType None +genomeTransformVCF - sjdbOverhang 0 sjdbFileChrStartEnd - sjdbGTFfile - |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c tool-data/rnastar_index2_versioned.loc.sample --- a/tool-data/rnastar_index2_versioned.loc.sample Thu Nov 28 15:56:07 2019 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| b |
| @@ -1,26 +0,0 @@ -#This is a sample file distributed with Galaxy that enables tools -#to use a directory of rna-star indexed sequences data files. You will -#need to create these data files and then create a rnastar_index2.loc -#file similar to this one (store it in this directory) that points to -#the directories in which those files are stored. The rnastar_index2.loc -#file has this format (longer white space characters are TAB characters): -# -#<unique_build_id> <dbkey> <display_name> <file_base_path> <with_gene_model> <version> -# -#The <with_gene_model> column should be 1 or 0, indicating whether the index -#was built with annotations (i.e., --sjdbGTFfile and --sjdbOverhang were used) -#or not. -# -#The <version> column indicates the STAR version that introduced the format of -#the index, i.e., the oldest STAR version that could make use of the index. -# -#Note that STAR indices can become quite large. Consequently, it is only -#advisable to create indices with annotations if it's known ahead of time that -#(A) the annotations won't be frequently updated and (B) the read lengths used -#will also rarely vary. If either of these is not the case, it's advisable to -#create indices without annotations and then specify an annotation file and -#maximum read length (minus 1) when running STAR. -# -#hg19 hg19 hg19 full /mnt/galaxyIndices/genomes/hg19/rnastar 0 2.7.1a -#hg19Ensembl hg19Ensembl hg19 full with Ensembl annotation /mnt/galaxyIndices/genomes/hg19Ensembl/rnastar 1 2.7.1a - |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c tool-data/rnastar_index2x_versioned.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/rnastar_index2x_versioned.loc.sample Wed Aug 05 09:40:33 2020 -0400 |
| b |
| @@ -0,0 +1,27 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of rna-star indexed sequences data files. +#You will need to create these data files and then create a +#rnastar_index2x_versioned.loc file similar to this one (store it in this +directory) that points to the directories in which those files are stored. +#The rnastar_index2x_versioned.loc file has this format (longer white space +#characters are TAB characters): +# +#<unique_build_id> <dbkey> <display_name> <file_base_path> <with_gene_model> <version> +# +#The <with_gene_model> column should be 1 or 0, indicating whether the index +#was built with annotations (i.e., --sjdbGTFfile and --sjdbOverhang were used) +#or not. +# +#The <version> column indicates the STAR version that introduced the format of +#the index, i.e., the oldest STAR version that could make use of the index. +# +#Note that STAR indices can become quite large. Consequently, it is only +#advisable to create indices with annotations if it's known ahead of time that +#(A) the annotations won't be frequently updated and (B) the read lengths used +#will also rarely vary. If either of these is not the case, it's advisable to +#create indices without annotations and then specify an annotation file and +#maximum read length (minus 1) when running STAR. +# +#hg19 hg19 hg19 full /mnt/galaxyIndices/genomes/hg19/rnastar 0 2.7.1a +#hg19Ensembl hg19Ensembl hg19 full with Ensembl annotation /mnt/galaxyIndices/genomes/hg19Ensembl/rnastar 1 2.7.1a + |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c tool_data_table_conf.xml.sample --- a/tool_data_table_conf.xml.sample Thu Nov 28 15:56:07 2019 -0500 +++ b/tool_data_table_conf.xml.sample Wed Aug 05 09:40:33 2020 -0400 |
| b |
| @@ -1,6 +1,6 @@ <tables> - <table name="rnastar_index2_versioned" comment_char="#" allow_duplicate_entries="False"> + <table name="rnastar_index2x_versioned" comment_char="#" allow_duplicate_entries="False"> <columns>value, dbkey, name, path, with_gene_model, version</columns> - <file path="tool-data/rnastar_index2_versioned.loc" /> + <file path="tool-data/rnastar_index2x_versioned.loc" /> </table> </tables> |
| b |
| diff -r b9e04854e2bb -r 5ec75f5dae3c tool_data_table_conf.xml.test --- a/tool_data_table_conf.xml.test Thu Nov 28 15:56:07 2019 -0500 +++ b/tool_data_table_conf.xml.test Wed Aug 05 09:40:33 2020 -0400 |
| b |
| @@ -1,7 +1,7 @@ <tables> <!-- Location of rnastar indexes for testing --> - <table name="rnastar_index2_versioned" comment_char="#" allow_duplicate_entries="False"> + <table name="rnastar_index2x_versioned" comment_char="#" allow_duplicate_entries="False"> <columns>value, dbkey, name, path, with_gene_model, version</columns> - <file path="${__HERE__}/test-data/rnastar_index2_versioned.loc" /> + <file path="${__HERE__}/test-data/rnastar_index2x_versioned.loc" /> </table> </tables> |