| Previous changeset 4:c47a7c52ac4f (2016-12-19) Next changeset 6:ee4be6eadd34 (2017-11-10) |
|
Commit message:
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86 |
|
modified:
cmbuild.xml cmsearch.xml cmstat.xml |
|
added:
cmalign.xml cmpress.xml cmscan.xml macros.xml test-data/cmalign_input2_tRNA5.c.cm test-data/cmalign_input_mrum_tRNAs10.fa test-data/cmalign_result_mrum-tRNAs10.out test-data/cmalignoutput test-data/cmbuild_input_tRNA5.sto test-data/cmbuild_results.cm test-data/cmcalibrate_input.cm test-data/cmpress_input_minifam.cm test-data/cmsearch_input1.cm test-data/cmsearch_input2.fa test-data/cmsearch_input2_mrum_genome.fa test-data/cmsearch_result.tabular test-data/cmsearch_result_tRNA5_mrum.out test-data/cmstat_input.cm test-data/cmstat_out.tabular test-data/metag-example.fa test-data/minifam.cm test-data/minifam.tar |
|
removed:
cmalign._x_m_l_todo tool_dependencies.xml |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd cmalign._x_m_l_todo --- a/cmalign._x_m_l_todo Mon Dec 19 15:27:06 2016 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| [ |
| b'@@ -1,256 +0,0 @@\n-<tool id="infernal_cmalign" name="Align sequences to a covariance model" version="1.1.0.2">\n- <description>against a sequence database (cmsearch)</description>\n- <parallelism method="multi" split_inputs="seqdb" split_mode="to_size" split_size="100" shared_inputs="" merge_outputs="outfile,multiple_alignment_output"></parallelism>\n- <requirements>\n- <requirement type="package">infernal</requirement>\n- <requirement type="package" version="1.1">infernal</requirement>\n- <requirement type="package" version="8.22">gnu_coreutils</requirement>\n- </requirements>\n- <command>\n-<![CDATA[\n- ## a temp file is needed, because the standard tabular output from infernal is not usefull in Galaxy\n- ## it will be converted to a tab delimited file and piped to Galaxy\n- temp_tabular_output=\\$(mktemp);\n-\n- cmsearch\n- ## Infernal Options\n- --cpu "\\${GALAXY_SLOTS:-12}"\n- -o /dev/null\n- --tformat $seqdb.ext ##target format: fasta, embl, genbank, ddbj, stockholm, pfam, a2m, afa, clustal, and phylip\n- $bottomonly\n- $toponly\n- $cyk\n- $notrunc\n- $max\n- $nohmm\n- $mid\n- ##$bitscore_thresholds\n- --tblout \\$temp_tabular_output\n- $g\n- #if $A:\n- $A $multiple_alignment_output\n- #end if\n-\n- #if $inclusion_thresholds_opts.inclusion_thresholds_selector == "--incE":\n- --incE $inclusion_thresholds_opts.incE\n- #elif $inclusion_thresholds_opts.inclusion_thresholds_selector == "--incT":\n- --incT $inclusion_thresholds_opts.incT\n- #end if\n-\n- #if $reporting_thresholds_opts.reporting_thresholds_selector == "-E":\n- -E $reporting_thresholds_opts.E\n- #elif $reporting_thresholds_opts.reporting_thresholds_selector == "-T":\n- -T $reporting_thresholds_opts.T\n- #end if\n-\n- ## CM file from the history or stored as database on disc\n-\n- #if $cm_opts.cm_opts_selector == "db":\n- $cm_opts.database.fields.path\n- #else:\n- $cm_opts.cmfile\n- #end if\n-\n- ## sequence file\n- $seqdb\n- 2>&1\n- ;\n-\n- ## 1. replace all lines starting # (comment lines)\n- ## 2. replace the first 18 spaces with tabs, 18th field is a free text field (can contain spaces)\n- sed -e \'s/#.*$//\' -e \'/^$/d\' -e \'s/ /\\t/g\' -e \'s/\\t/ /18g\' \\$temp_tabular_output > $outfile\n-\n-]]>\n- </command>\n- <inputs>\n-\n- <param name="seqdb" type="data" format="fasta" label="Sequence database"/>\n- <conditional name="cm_opts">\n- <param name="cm_opts_selector" type="select" label="Subject covariance models">\n- <option value="db" selected="True">Locally installed covariance models</option>\n- <option value="histdb">Covariance model from your history</option>\n- </param>\n- <when value="db">\n- <param name="database" type="select" label="Covariance models">\n- <options from_file="infernal.loc">\n- <column name="value" index="0"/>\n- <column name="name" index="1"/>\n- <column name="path" index="2"/>\n- </options>\n- </param>\n- </when>\n- <when value="histdb">\n- <param name="cmfile" type="data" format="txt" label="Covariance models file from the history."/>\n- </when>\n- </conditional>\n-\n- <param name="g" truevalue="-g" falsevalue="" checked="False" type="boolean"\n- label="Turn on the glocal alignment algorithm" help="... global with respect to the query model '..b'r a sequence of L residues.\n-(9) seq to (ali coord): The end of the alignment of this hit with respect to the sequence, numbered 1..L for a sequence of L residues.\n-(10) strand: The strand on which the hit occurs on the sequence. \xe2\x80\x99+\xe2\x80\x99 if the hit is on the top (Watson) strand, \xe2\x80\x99-\xe2\x80\x99 if the hit is on the bottom (Crick) strand. If on the top strand, the \xe2\x80\x9cseq from\xe2\x80\x9d value will be less than or equal to the \xe2\x80\x9cseq to\xe2\x80\x9d value, else it will be greater than or equal to it.\n-(11) trunc: Indicates if this is predicted to be a truncated CM hit or not. This will be \xe2\x80\x9cno\xe2\x80\x9d if it is a CM hit that is not predicted to be truncated by the end of the sequence, \xe2\x80\x9c5\xe2\x80\x99 \xe2\x80\x9d or \xe2\x80\x9c3\xe2\x80\x99 \xe2\x80\x9d if the hit is predicted to have one or more 5\xe2\x80\x99 or 3\xe2\x80\x99 residues missing due to a artificial truncation of the sequence, or \xe2\x80\x9c5\xe2\x80\x99&3\xe2\x80\x9d\xe2\x80\x99 if the hit is predicted to have one or more 5\xe2\x80\x99 residues missing and one or more 3\xe2\x80\x99 residues missing. If the hit is an HMM hit, this will always be \xe2\x80\x99-\xe2\x80\x99.\n-(12) pass: Indicates what \xe2\x80\x9cpass\xe2\x80\x9d of the pipeline the hit was detected on. This is probably only useful for testing and debugging. Non-truncated hits are found on the first pass, truncated hits are found on successive passes.\n-(13) gc: Fraction of G and C nucleotides in the hit.\n-(14) bias: The biased-composition correction: the bit score difference contributed by the null3 model for CM hits, or the null2 model for HMM hits. High bias scores may be a red flag for a false positive. It is difficult to correct for all possible ways in which a nonrandom but nonhomologous biological sequences can appear to be similar, such as short-period tandem repeats, so there are cases where the bias correction is not strong enough (creating false positives).\n-(15) score: The score (in bits) for this target/query comparison. It includes the biased-composition cor-rection (the \xe2\x80\x9cnull3\xe2\x80\x9d model for CM hits, or the \xe2\x80\x9cnull2\xe2\x80\x9d model for HMM hits).\n-(16) E-value: The expectation value (statistical significance) of the target. This is a per query E-value; i.e. calculated as the expected number of false positives achieving this comparison\xe2\x80\x99s score for a single query against the search space Z. For cmsearch Z is defined as the total number of nucleotides in the target dataset multiplied by 2 because both strands are searched. For cmscan Z is the total number of nucleotides in the query sequence multiplied by 2 because both strands are searched and multiplied by the number of models in the target database. If you search with multiple queries and if you want to control the overall false positive rate of that search rather than the false positive rate per query, you will want to multiply this per-query E-value by how many queries you\xe2\x80\x99re doing.\n-(17) inc: Indicates whether or not this hit achieves the inclusion threshold: \xe2\x80\x99!\xe2\x80\x99 if it does, \xe2\x80\x99?\xe2\x80\x99 if it does not (and rather only achieves the reporting threshold). By default, the inclusion threshold is an E-value of 0.01 and the reporting threshold is an E-value of 10.0, but these can be changed with command line options as described in the manual pages.\n-(18) description of target: The remainder of the line is the target\xe2\x80\x99s description line, as free text.\n-\n-\n-For further questions please refere to the Infernal `Userguide <http://selab.janelia.org/software/infernal/Userguide.pdf>`_.\n-\n-\n-]]>\n- </help>\n- \n- <citations>\n- <citation type="doi">10.1093/bioinformatics/btt509</citation>\n- <citation type="bibtex">\n- @ARTICLE{bgruening_galaxytools,\n- Author = {Bj\xc3\xb6rn Gr\xc3\xbcning, Cameron Smith, Torsten Houwaart, Nicola Soranzo, Eric Rasche},\n- keywords = {bioinformatics, ngs, galaxy, cheminformatics, rna},\n- title = {{Galaxy Tools - A collection of bioinformatics and cheminformatics tools for the Galaxy environment}},\n- url = {https://github.com/bgruening/galaxytools}\n- }\n- </citation>\n- </citations>\n- \n- \n-</tool>\n' |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd cmalign.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/cmalign.xml Sat Jan 21 17:36:57 2017 -0500 |
| [ |
| b'@@ -0,0 +1,241 @@\n+<tool id="infernal_cmalign" name="cmalign" version="@VERSION@.0">\n+ <description>Align sequences to a covariance model against a sequence database</description>\n+ <macros>\n+ <import>macros.xml</import>\n+ </macros>\n+ <expand macro="requirements" />\n+ <expand macro="stdio" />\n+ <command>\n+<![CDATA[\n+\n+ cmalign\n+ ## Infernal Options\n+ --cpu "\\${GALAXY_SLOTS:-2}"\n+ -o \'$outfile\'\n+\n+ $alignment_algorithm_cont.alignment_algorithm.alignment_algorithm_selector\n+ #if $alignment_algorithm_cont.alignment_algorithm.alignment_algorithm_selector=="--sample"\n+ --seed $alignment_algorithm_cont.alignment_algorithm.seed\n+ #end if\n+ $alignment_algorithm_cont.notrunc_opt.notrunc\n+ #if $alignment_algorithm_cont.notrunc_opt.notrunc=="--notrunc"\n+ $alignment_algorithm_cont.notrunc_opt.sub\n+ #end if\n+ $speed_memory_cont.hmm_banding.banding_selector\n+ #if $speed_memory_cont.hmm_banding.banding_selector=="--hbanded"\n+ --tau $speed_memory_cont.hmm_banding.tau\n+ --mxsize $speed_memory_cont.hmm_banding.mxsize\n+ $speed_memory_cont.hmm_banding.fixedtau\n+ --maxtau $speed_memory_cont.hmm_banding.maxtau\n+ #end if\n+ #if $speed_memory_cont.hmm_banding.banding_selector=="--nonbanded"\n+ --mxsize $speed_memory_cont.hmm_banding.mxsize\n+ #end if\n+\n+ #if $other_opts.mapali_opt.mapali_cond\n+ --mapali \'$other_opts.mapali_opt.mapali\'\n+ $other_opts.mapali_opt.mapstr\n+ #end if\n+\n+ --informat $seqdb.ext\n+ --outformat $other_opts.outformat_selector\n+ $other_opts.dnaout\n+ $other_opts.noprob\n+ $other_opts.matchonly\n+ $other_opts.ileaved\n+\n+ ##--small requirements according to cmalign.c\n+\n+ #if $alignment_algorithm_cont.alignment_algorithm.alignment_algorithm_selector=="--cyk" \\\n+ and $other_opts.noprob \\\n+ and $speed_memory_cont.hmm_banding.banding_selector=="--nonbanded" \\\n+ and $alignment_algorithm_cont.notrunc_opt.notrunc=="--notrunc"\n+ $speed_memory_cont.small\n+ #end if\n+\n+ ## CM file from the history or stored as database on disc\n+ #if $cm_opts.cm_opts_selector == "db":\n+ $cm_opts.database.fields.path\n+ #else:\n+ \'$cm_opts.cmfile\'\n+ #end if\n+ ## sequence file\n+ \'$seqdb\'\n+\n+]]>\n+ </command>\n+ <inputs>\n+\n+ <param name="seqdb" type="data" format="fasta" label="Sequence database"/>\n+\n+ <conditional name="cm_opts">\n+ <param name="cm_opts_selector" type="select" label="Subject covariance models">\n+ <option value="db" selected="True">Locally installed covariance models</option>\n+ <option value="histdb">Covariance model from your history</option>\n+ </param>\n+ <when value="db">\n+ <param name="database" type="select" label="Covariance models">\n+ <options from_file="infernal.loc">\n+ <column name="value" index="0"/>\n+ <column name="name" index="1"/>\n+ <column name="path" index="2"/>\n+ </options>\n+ </param>\n+ </when>\n+ <when value="histdb">\n+ <param name="cmfile" type="data" format="cm" label="Covariance models file from the history."/>\n+ </when>\n+ </conditional>\n+\n+ <param argument="-g" truevalue="-g" falsevalue="" checked="False" type="boolean"\n+ label="Turn on the glocal alignment algorithm" help="... global with respect to the query model and local with respect to the target database."/>\n+\n+ '..b' or \xe2\x80\x99hmm\xe2\x80\x99. A CM is used to compute the final hit scores unless the model has zero basepairs or the --hmmonly option is used, in which case a HMM will be used.\n+(6) mdl from (model coord): The start of the alignment of this hit with respect to the profile (CM or HMM), numbered 1..N for a profile of N consensus positions.\n+(7) mdl to (model coord): The end of the alignment of this hit with respect to the profile (CM or HMM), numbered 1..N for a profile of N consensus positions.\n+(8) seq from (ali coord): The start of the alignment of this hit with respect to the sequence, numbered 1..L for a sequence of L residues.\n+(9) seq to (ali coord): The end of the alignment of this hit with respect to the sequence, numbered 1..L for a sequence of L residues.\n+(10) strand: The strand on which the hit occurs on the sequence. \xe2\x80\x99+\xe2\x80\x99 if the hit is on the top (Watson) strand, \xe2\x80\x99-\xe2\x80\x99 if the hit is on the bottom (Crick) strand. If on the top strand, the \xe2\x80\x9cseq from\xe2\x80\x9d value will be less than or equal to the \xe2\x80\x9cseq to\xe2\x80\x9d value, else it will be greater than or equal to it.\n+(11) trunc: Indicates if this is predicted to be a truncated CM hit or not. This will be \xe2\x80\x9cno\xe2\x80\x9d if it is a CM hit that is not predicted to be truncated by the end of the sequence, \xe2\x80\x9c5\xe2\x80\x99 \xe2\x80\x9d or \xe2\x80\x9c3\xe2\x80\x99 \xe2\x80\x9d if the hit is predicted to have one or more 5\xe2\x80\x99 or 3\xe2\x80\x99 residues missing due to a artificial truncation of the sequence, or \xe2\x80\x9c5\xe2\x80\x99&3\xe2\x80\x9d\xe2\x80\x99 if the hit is predicted to have one or more 5\xe2\x80\x99 residues missing and one or more 3\xe2\x80\x99 residues missing. If the hit is an HMM hit, this will always be \xe2\x80\x99-\xe2\x80\x99.\n+(12) pass: Indicates what \xe2\x80\x9cpass\xe2\x80\x9d of the pipeline the hit was detected on. This is probably only useful for testing and debugging. Non-truncated hits are found on the first pass, truncated hits are found on successive passes.\n+(13) gc: Fraction of G and C nucleotides in the hit.\n+(14) bias: The biased-composition correction: the bit score difference contributed by the null3 model for CM hits, or the null2 model for HMM hits. High bias scores may be a red flag for a false positive. It is difficult to correct for all possible ways in which a nonrandom but nonhomologous biological sequences can appear to be similar, such as short-period tandem repeats, so there are cases where the bias correction is not strong enough (creating false positives).\n+(15) score: The score (in bits) for this target/query comparison. It includes the biased-composition cor-rection (the \xe2\x80\x9cnull3\xe2\x80\x9d model for CM hits, or the \xe2\x80\x9cnull2\xe2\x80\x9d model for HMM hits).\n+(16) E-value: The expectation value (statistical significance) of the target. This is a per query E-value; i.e. calculated as the expected number of false positives achieving this comparison\xe2\x80\x99s score for a single query against the search space Z. For cmsearch Z is defined as the total number of nucleotides in the target dataset multiplied by 2 because both strands are searched. For cmscan Z is the total number of nucleotides in the query sequence multiplied by 2 because both strands are searched and multiplied by the number of models in the target database. If you search with multiple queries and if you want to control the overall false positive rate of that search rather than the false positive rate per query, you will want to multiply this per-query E-value by how many queries you\xe2\x80\x99re doing.\n+(17) inc: Indicates whether or not this hit achieves the inclusion threshold: \xe2\x80\x99!\xe2\x80\x99 if it does, \xe2\x80\x99?\xe2\x80\x99 if it does not (and rather only achieves the reporting threshold). By default, the inclusion threshold is an E-value of 0.01 and the reporting threshold is an E-value of 10.0, but these can be changed with command line options as described in the manual pages.\n+(18) description of target: The remainder of the line is the target\xe2\x80\x99s description line, as free text.\n+\n+\n+For further questions please refere to the Infernal `Userguide <http://eddylab.org/infernal/Userguide.pdf>`_.\n+\n+\n+]]>\n+ </help>\n+\n+ <expand macro="citations" />\n+\n+\n+</tool>\n' |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd cmbuild.xml --- a/cmbuild.xml Mon Dec 19 15:27:06 2016 -0500 +++ b/cmbuild.xml Sat Jan 21 17:36:57 2017 -0500 |
| [ |
| b'@@ -1,62 +1,96 @@\n-<tool id="infernal_cmbuild" name="Build covariance models" version="1.1.0.2">\n- <description>from sequence alignments (cmbuild)</description>\n- <parallelism method="multi" split_inputs="alignment_infile" split_mode="to_size" split_size="10" shared_inputs="" merge_outputs="cmfile_outfile"></parallelism>\n- <requirements>\n- <requirement type="package">infernal</requirement>\n- <requirement type="package" version="1.1">infernal</requirement>\n- <requirement type="package" version="8.22">gnu_coreutils</requirement>\n- </requirements>\n+<tool id="infernal_cmbuild" name="cmbuild" version="@VERSION@.0">\n+ <description>Build covariance models from sequence alignments</description>\n+ <macros>\n+ <import>macros.xml</import>\n+ </macros>\n+ <parallelism method="multi" split_inputs="alignment_infile" split_mode="to_size" split_size="10" merge_outputs="cmfile_outfile"></parallelism>\n+ <expand macro="requirements" />\n+ <expand macro="stdio" />\n <command>\n <![CDATA[\n- cmbuild -F\n- #if $is_summery_output:\n- -o \'$summary_outfile\'\n- #end if\n-\n- $model_construction_opts.model_construction_opts_selector\n- #if $model_construction_opts.model_construction_opts_selector == \'--fast\':\n- --symfrac $model_construction_opts.symfrac\n+ cmbuild\n+ -F\n+ #if $is_summery_output:\n+ -o \'$summary_outfile\'\n+ #end if\n+ ## to many outputs, is that one really needed?\n+ ##-O $annotated_source_alignment_outfile\n+ $model_construction_opts.model_construction_opts_selector\n+ #if $model_construction_opts.model_construction_opts_selector == \'--fast\':\n+ --symfrac $model_construction_opts.symfrac\n+ #end if\n+ $noss\n+ $relative_weights_opts.relative_weights_opts_selector\n+ #if $relative_weights_opts.relative_weights_opts_selector == \'--wblosum\':\n+ --wid $relative_weights_opts.wid\n+ #end if\n+ --p7ere $controlling_filter_p7_hmm.p7ere\n+ $controlling_filter_p7_hmm.p7ml\n+ --EmN $controlling_filter_p7_hmm.EmN\n+ --EvN $controlling_filter_p7_hmm.EvN\n+ --ElfN $controlling_filter_p7_hmm.ElfN\n+ --EgfN $controlling_filter_p7_hmm.EgfN\n+ $effective_opts.effective_opts_selector\n+ #if str($effective_opts.effective_opts_selector) == \'--eent\':\n+ #if $effective_opts.ere\n+ --ere $effective_opts.ere\n #end if\n-\n- $noss\n-\n- $relative_weights_opts.relative_weights_opts_selector\n- #if $relative_weights_opts.relative_weights_opts_selector == \'--wblosum\':\n- --wid $relative_weights_opts.wid\n+ #if $effective_opts.eminseq\n+ --eminseq $effective_opts.eminseq\n #end if\n-\n- $effective_opts.effective_opts_selector\n- #if str($effective_opts.effective_opts_selector) == \'--eent\':\n- --ere $effective_opts.ere\n- --eminseq $effective_opts.eminseq\n+ #if $effective_opts.ehmmre\n --ehmmre $effective_opts.ehmmre\n+ #end if\n+ #if $effective_opts.eset\n --eset $effective_opts.eset\n #end if\n+ #end if\n+ #if str($refining_opts.refining_opts_selector) == \'--refine\':\n+ #if $refining_opts.refine_output:\n+ --refine \'$refined_multiple_alignment_output\'\n+ #else:\n+ --refine /dev/null\n+ #end if\n+ $refining_opts.l\n+ $refining_opts.gibbs_opts.gibbs_opts_selector\n+ #if str($refining_opts.gibbs_opts.gibbs_opts_selector) == \'--gibbs\':\n+ --seed $refining_opts.gibbs_opts.random_seed\n+ #end if\n+ $refining_opts.notrunc\n+ $refining_opts.cyk\n+ #end if\n+ \'$cmfile_outfile\'\n+ \'$alignment_infile\'\n \n- '..b' Calibrate[\'selector\'] is True and\n+ Calibrate[\'output_options_cond\'][\'selector\'] == "extra" and\n+ \'xfile\' in Calibrate[\'output_options_cond\'][\'output_options\']\n+ ))\n+ </filter>\n+ </data>\n+\n </outputs>\n+\n+ <tests>\n+ <test>\n+ <param name="alignment_infile" value="cmbuild_input_tRNA5.sto"/>\n+ <conditional name="Calibrate">\n+ <param name="selector" value="true"/>\n+ </conditional>\n+ <output name="outfile">\n+ <assert_contents>\n+ <has_text text="S 0 -1 0 1 4 0 1 88 108 -7.713 -8.959 -0.044 -5.412"/>\n+ </assert_contents>\n+ </output>\n+ </test>\n+ </tests>\n <help>\n <![CDATA[\n \n@@ -268,24 +425,17 @@\n - *Turn on the local alignment algorithm*: allows the alignment to span two or more subsequences if necessary (e.g. if the structures of the query model and target sequence are only partially shared), allowing certain large insertions and deletions in the structure to be penalized differently than normal indels. The default is to globally align the query model to the target sequences.\n - *--gibbs sampling*: Modifies the behavior of --refine so Gibbs sampling is used instead of EM. The difference is that during the alignment stage the alignment is not necessarily optimal, instead an alignment (parsetree) for each sequences is sampled from the posterior distribution of alignments as determined by the Inside algorithm. Due to this sampling step --gibbs is non- deterministic, so different runs with the same alignment may yield different results. This is not true when --refine is used without the --gibbs option, in which case the final alignment and CM will always be the same. When --gibbs is enabled, the --seed "number" option can be used to seed the random number generator predictably, making the results reproducible. The goal of the --gibbs option is to help expert RNA alignment curators refine structural alignments by allowing them to observe alternative high scoring alignments.\n - *--Random seed*: Seed the random number generator with an integer >= 0. This option can only be used in combination with --gibbs. If the given number is nonzero, stochastic sampling of alignments will be reproducible; the same command will give the same results. If the given number is 0, the random number generator is seeded arbitrarily, and stochastic samplings may vary from run to run of the same command. The default seed is 0.\n- - *--Turn off the truncated alignment algorithm*: With --refine, turn off the truncated alignment algorithm. There is more information on this in the cmalign manual page.\n+ - *--Turn off the truncated alignment algorithm*: With --refine, turn off the truncated alignment algorithm. There is more information on this in the cmalign manual page.\n - *--cyk algorithm*: With --refine, align with the CYK algorithm. By default the optimal accuracy algorithm is used. There is more information on this in the cmalign manual page.\n \n+\n For further questions please refere to the Infernal Userguide_.\n \n-.. _Userguide: http://selab.janelia.org/software/infernal/Userguide.pdf\n+.. _Userguide: http://eddylab.org/infernal/Userguide.pdf\n \n ]]>\n </help>\n- <citations>\n- <citation type="doi">10.1093/bioinformatics/btt509</citation>\n- <citation type="bibtex">\n- @ARTICLE{bgruening_galaxytools,\n- Author = {Bj\xc3\xb6rn Gr\xc3\xbcning, Cameron Smith, Torsten Houwaart, Nicola Soranzo, Eric Rasche},\n- keywords = {bioinformatics, ngs, galaxy, cheminformatics, rna},\n- title = {{Galaxy Tools - A collection of bioinformatics and cheminformatics tools for the Galaxy environment}},\n- url = {https://github.com/bgruening/galaxytools}\n- }\n- </citation>\n- </citations>\n+\n+ <expand macro="citations" />\n+\n </tool>\n' |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd cmpress.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/cmpress.xml Sat Jan 21 17:36:57 2017 -0500 |
| [ |
| @@ -0,0 +1,88 @@ +<tool id="infernal_cmpress" name="cmpress" version="@VERSION@.0"> + <description> Prepare a covariance model database for cmscan</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="stdio" /> + <command> +<![CDATA[ + ## CM file from the history or stored as database on disc + #if str($cm_opts.cm_opts_selector) == "db": + cmfile_path='$cm_opts.database.fields.path' + #else: + ##'$cm_opts.cmfile' + cmfile_path='$cmfile' + #end if + && + cmpress -F "\$cmfile_path" && + ##cmpress creates four files in the same directory of the cm file + cd `dirname "\$cmfile_path"` && + tar -cvf '$outfile' `basename "\$cmfile_path"`.i1* +]]> + </command> + <inputs> + <conditional name="cm_opts"> + <param name="cm_opts_selector" type="select" label="Subject covariance models <cmdb> "> + <option value="db" >Locally installed covariance models</option> + <option value="histdb" selected="True">Covariance model from your history</option> + </param> + <when value="db"> + <param name="database" type="select" label="Covariance models"> + <options from_file="infernal.loc"> + <column name="value" index="0"/> + <column name="name" index="1"/> + <column name="path" index="2"/> + </options> + </param> + </when> + <when value="histdb"> + <param name="cmfile" type="data" format="cm" label="Covariance models file from the history."/> + </when> + </conditional> + + </inputs> + <outputs> + <data format="tar" name="outfile" label="cmpress on ${on_string}"/> + </outputs> + + <tests> + <test> + <conditional name="cm_opts"> + <param name="cm_opts_selector" value="histdb"/> + <param name="cmfile" value="cmpress_input_minifam.cm"/> + </conditional> + <assert_stdout> + <has_text text="Working... done."/> + </assert_stdout> + + </test> + + </tests> + <help> +<![CDATA[ + + +**What it does** + +Starting from a CM database <cmfile> in standard Infernal-1.1 format, construct binary compressed datafiles for cm- +scan. The cmpress step is required for cmscan to work. + +**Input format** + +The <cmfile> must be have already been calibrated with cmcalibrate for cmpress to work. + +**Output format** + + + +For further questions please refere to the Infernal `Userguide <http://eddylab.org/infernal/Userguide.pdf>`_. + + +]]> + </help> + + <expand macro="citations" /> + + +</tool> |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd cmscan.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/cmscan.xml Sat Jan 21 17:36:57 2017 -0500 |
| [ |
| b'@@ -0,0 +1,287 @@\n+<tool id="infernal_cmscan" name="cmscan" version="@VERSION@.0">\n+ <description> Search sequences against collections of covariance models</description>\n+ <macros>\n+ <import>macros.xml</import>\n+ </macros>\n+ <expand macro="requirements"/>\n+ <expand macro="stdio"/>\n+ <command>\n+<![CDATA[\n+ ## a temp file is needed, because the standard tabular output from infernal is not usefull in Galaxy\n+ ## it will be converted to a tab delimited file and piped to Galaxy\n+ temp_tabular_output=\\$(mktemp) &&\n+\n+ #if str($cm_opts.cm_opts_selector) == "histdb":\n+ ln -s \'$cm_opts.cmfile\' cmdb.cm &&\n+ #end if\n+\n+ tar xvf \'$aux_files\' &&\n+ ln -s `find *.i1f` cmdb.cm.i1f &&\n+ ln -s `find *.i1i` cmdb.cm.i1i &&\n+ ln -s `find *.i1m` cmdb.cm.i1m &&\n+ ln -s `find *.i1p` cmdb.cm.i1p &&\n+\n+ cmscan\n+ --cpu "\\${GALAXY_SLOTS:-2}"\n+ --tblout \'\\$temp_tabular_output\'\n+ -o /dev/null\n+ $g\n+ #if $Z\n+ -Z $Z\n+ #end if\n+ $verbose\n+ $other_opts.notrunc\n+ $other_opts.anytrunc\n+ $other_opts.nonull3\n+ #if $other_opts.smxsize <> 128.0\n+ --smxsize $other_opts.smxsize\n+ #end if\n+ #if $other_opts.mxsize <> 128.0\n+ --mxsize $other_opts.mxsize\n+ #end if\n+ $other_opts.cyk\n+ $other_opts.acyk\n+ $other_opts.bottomonly\n+ $other_opts.toponly\n+ #if str($inclusion_thresholds_opts.inclusion_thresholds_selector) == "--incE":\n+ --incE $inclusion_thresholds_opts.incE\n+ #elif str($inclusion_thresholds_opts.inclusion_thresholds_selector) == "--incT":\n+ --incT $inclusion_thresholds_opts.incT\n+ #end if\n+ #if str($reporting_thresholds_opts.reporting_thresholds_selector) == "-E":\n+ -E $reporting_thresholds_opts.E\n+ #elif str($reporting_thresholds_opts.reporting_thresholds_selector) == "-T":\n+ -T $reporting_thresholds_opts.T\n+ #end if\n+ $model_thresholds.cut_ga\n+ $model_thresholds.cut_nc\n+ $model_thresholds.cut_tc\n+ #if $acceleration_huristics.acceleration_huristics_selector == "FZ"\n+ --FZ $$acceleration_huristics.FZ\n+ #else\n+ $acceleration_huristics.acceleration_huristics_selector\n+ #if $acceleration_huristics.acceleration_huristics_selector == "--mid"\n+ --Fmid $acceleration_huristics.Fmid\n+ #end if\n+ #end if\n+ ## CM file from the history or stored as database on disc\n+ #if str($cm_opts.cm_opts_selector) == "db":\n+ \'$cm_opts.database.fields.path\'\n+ #else:\n+ ##\'$cm_opts.cmfile\'\n+ cmdb.cm\n+ #end if\n+ ## sequence file\n+ \'$seqdb\'\n+ &&\n+ sed \'s/ \\+ /\\t/g\' \'\\$temp_tabular_output\' > \'$outfile\'\n+\n+]]>\n+ </command>\n+ <inputs>\n+ <param name="seqdb" type="data" format="fasta" label="Sequence database <seqfile>"/>\n+\n+ <conditional name="cm_opts">\n+ <param name="cm_opts_selector" type="select" label="Subject covariance models <cmdb> ">\n+ <option value="db" >Locally installed covariance models</option>\n+ <option value="histdb" selected="True">Covariance model from your history</option>\n+ </param>\n+ <when value="db">\n+ <param name="database" type="select" label="Covariance models">\n+ <options from_file="infernal.loc">\n+ <column name="value" index="0"/>\n+ <column name="name" index="1"/>\n+ <column name="path" index="2"/>\n+ </options>\n+ </param>\n+ </when>\n+ <when value="histdb">\n+ <param name="cmfile" type="data" format="cm" label="Covariance models file from the history."/>\n+ </when>\n+ </conditional>\n+ <param name='..b'truevalue="--notrunc" falsevalue="" checked="False" type="boolean"\n+ label="Skip truncated hit detection" help=""/>\n+ <param argument="--anytrunc" truevalue="--anytrunc" falsevalue="" checked="false" type="boolean"\n+ label="Allow full and truncated hits anywhere within sequences" help=""/>\n+ <param argument="--nonull3" truevalue="--nonull3" falsevalue="" checked="false" type="boolean"\n+ label="Turn off the null3 CM score corrections for biased composition" help="This correction is not used during the HMM filter stages."/>\n+ <param argument="--mxsize" type="float" value="128.0" min="0.1"\n+ label="Set the maximum allowable CM DP matrix size to \'x\' megabytes" help=""/>\n+ <param argument="--smxsize" type="float" value="128.0" min="0.1"\n+ label="Set the maximum allowable CM search DP matrix size to \'x\' megabytes." help=""/>\n+ <param argument="--cyk" truevalue="--cyk" falsevalue="" checked="False" type="boolean"\n+ label="Use the CYK algorithm, not Inside, to determine the final score of all hits" help=""/>\n+ <param argument="--acyk" truevalue="--cyk" falsevalue="" checked="False" type="boolean"\n+ label="Use the CYK algorithm to align hits" help="By default, the Durbin/Holmes optimal accuracy algorithm is used, which finds the alignment that maximizes the expected accuracy of all aligned residues."/>\n+ <param argument="--bottomonly" truevalue="--bottomonly" falsevalue="" checked="False" type="boolean"\n+ label="Only search the bottom (Crick) strand of target sequences" help="in the sequence database"/>\n+ <param argument="--toponly" truevalue="--toponly" falsevalue="" checked="False" type="boolean"\n+ label="Only search the top (Watson) strand of target sequences" help="in the sequence database"/>\n+\n+ </section>\n+\n+\n+\n+ </inputs>\n+ <outputs>\n+ <data format="tabular" name="outfile" label="cmscan on ${on_string}"/>\n+ </outputs>\n+ <tests>\n+ <test>\n+ <conditional name="cm_opts">\n+ <param name="cm_opts_selector" value="histdb"/>\n+ <param name="cmfile" value="minifam.cm" />\n+ </conditional>\n+ <param name="aux_files" value="minifam.tar" ftype="tar"/>\n+ <param name="seqdb" value="metag-example.fa"/>\n+ <output name="outfile">\n+ <assert_contents>\n+ <has_text text="AAGA01015927.1"/>\n+ </assert_contents>\n+ </output>\n+ </test>\n+\n+ </tests>\n+ <help>\n+<![CDATA[\n+\n+\n+**What it does**\n+\n+cmscan is used to search sequences against collections of covariance models.\n+For each sequence in <seqfile>, use that query sequence to search the target database of CMs in <cmdb>,\n+and output ranked lists of the CMs with the most significant matches to the sequence\n+\n+**Input format**\n+\n+The <seqfile> may contain more than one query sequence. It can be in FASTA format, or several other common\n+sequence file formats (genbank, embl, and among others), or in alignment file formats (stockholm, aligned fasta, and\n+others).\n+\n+The <cmdb> needs to be press\xe2\x80\x99ed using cmpress before it can be searched with cmscan. This creates four binary\n+files, suffixed .i1{fimp}. Additionally, <cmdb> must have been calibrated for E-values with cmcalibrate before being\n+press\xe2\x80\x99ed with cmpress.\n+\n+NOTE: Please provid a tar file that contains the .cm file in addition to the four binary files, suffixed .i1{fimp},\n+and specify the file type as "tar" before uploading the file. Otherwise Galaxy will not read the binary files properly.\n+\n+**Output format**\n+\n+The output format is designed to be human-readable.\n+\n+For further questions please refere to the Infernal `Userguide <http://eddylab.org/infernal/Userguide.pdf>`_.\n+\n+\n+]]>\n+ </help>\n+\n+ <expand macro="citations" />\n+\n+</tool>\n' |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd cmsearch.xml --- a/cmsearch.xml Mon Dec 19 15:27:06 2016 -0500 +++ b/cmsearch.xml Sat Jan 21 17:36:57 2017 -0500 |
| [ |
| b'@@ -1,193 +1,236 @@\n-<tool id="infernal_cmsearch" name="Search covariance model(s)" version="1.1.0.2">\n- <description>against a sequence database (cmsearch)</description>\n- <parallelism method="multi" split_inputs="seqdb" split_mode="to_size" split_size="500" shared_inputs="" merge_outputs="outfile,multiple_alignment_output"></parallelism>\n- <requirements>\n- <requirement type="package">infernal</requirement>\n- <requirement type="package" version="1.1">infernal</requirement>\n- <requirement type="package" version="8.22">gnu_coreutils</requirement>\n- </requirements>\n+<tool id="infernal_cmsearch" name="cmsearch" version="@VERSION@.0">\n+ <description>Search covariance model(s) against a sequence database </description>\n+ <macros>\n+ <import>macros.xml</import>\n+ </macros>\n+ <parallelism method="multi" split_inputs="seqdb" split_mode="to_size" split_size="500" merge_outputs="outfile,multiple_alignment_output"></parallelism>\n+ <expand macro="requirements"/>\n+ <expand macro="stdio" />\n <command>\n <![CDATA[\n ## a temp file is needed, because the standard tabular output from infernal is not usefull in Galaxy\n ## it will be converted to a tab delimited file and piped to Galaxy\n- temp_tabular_output=\\$(mktemp);\n+ temp_tabular_output=\\$(mktemp) &&\n \n cmsearch\n ## Infernal Options\n- --cpu "\\${GALAXY_SLOTS:-12}"\n+ --cpu "\\${GALAXY_SLOTS:-2}"\n -o /dev/null\n --tformat $seqdb.ext ##target format: fasta, embl, genbank, ddbj, stockholm, pfam, a2m, afa, clustal, and phylip\n $bottomonly\n $toponly\n $cyk\n+ $acyk\n $notrunc\n- $max\n- $nohmm\n- $mid\n- ##$bitscore_thresholds\n+ $anytrunc\n+ $nonull3\n+ #if $smxsize <> 128.0\n+ --smxsize $smxsize\n+ #end if\n+ #if $mxsize <> 128.0\n+ --mxsize $mxsize\n+ #end if\n --tblout \\$temp_tabular_output\n $g\n+ #if $Z\n+ -Z $Z\n+ #end if\n #if $A:\n- $A $multiple_alignment_output\n+ $A \'$multiple_alignment_output\'\n #end if\n-\n #if str($inclusion_thresholds_opts.inclusion_thresholds_selector) == "--incE":\n --incE $inclusion_thresholds_opts.incE\n #elif str($inclusion_thresholds_opts.inclusion_thresholds_selector) == "--incT":\n --incT $inclusion_thresholds_opts.incT\n #end if\n-\n #if str($reporting_thresholds_opts.reporting_thresholds_selector) == "-E":\n -E $reporting_thresholds_opts.E\n #elif str($reporting_thresholds_opts.reporting_thresholds_selector) == "-T":\n -T $reporting_thresholds_opts.T\n #end if\n-\n+ $model_thresholds.cut_ga\n+ $model_thresholds.cut_nc\n+ $model_thresholds.cut_tc\n+ #if $acceleration_huristics.acceleration_huristics_selector == "FZ"\n+ --FZ $$acceleration_huristics.FZ\n+ #else\n+ $acceleration_huristics.acceleration_huristics_selector\n+ #if $acceleration_huristics.acceleration_huristics_selector == "--mid"\n+ --Fmid $acceleration_huristics.Fmid\n+ #end if\n+ #end if\n ## CM file from the history or stored as database on disc\n-\n #if str($cm_opts.cm_opts_selector) == "db":\n $cm_opts.database.fields.path\n #else:\n $cm_opts.cmfile\n #end if\n-\n ## sequence file\n- $seqdb\n+ \'$seqdb\'\n 2>&1\n- ;\n-\n+ &&\n ## 1. replace all lines starting # (comment lines)\n ## 2. replace the first 18 spaces with tabs, 18th field is a free text field'..b'rn off the HMM SSV and Viterbi filter stages*:Sets remaining HMM filter thresholds to 0.02 by default. This may increase sensitivity, at a significant cost in speed.\n \n-- *Inclusion thresholds*: *Use E-value* - Use an E-value as the hit inclusion threshold. The default is 0.01, meaning that on average, about 1 false positive would be expected in every 100 searches with different\n-query sequences. *Use Bit Score* - Instead of using E-values for setting the inclusion threshold, instead use a bit score as the hit inclusion threshold. By default this option is unset.\n+- *Inclusion thresholds*: *Use E-value* - Use an E-value as the hit inclusion threshold. The default is 0.01, meaning that on average, about 1 false positive would be expected in every 100 searches with different query sequences. *Use Bit Score* - Instead of using E-values for setting the inclusion threshold, instead use a bit score as the hit inclusion threshold. By default this option is unset.\n \n \n **Output Options**\n \n-- *reporting thresholds*: Hits are ranked by statistical significance (E-value). By *default*, all hits with an E-value <= 10 are reported. The following options allow you to change the default *E-value* reporting thresholds, or to use *bit score* thresholds instead. \n-\n-\n-Output Example:\n+- *reporting thresholds*: Hits are ranked by statistical significance (E-value). By *default*, all hits with an E-value <= 10 are reported. The following options allow you to change the default *E-value* reporting thresholds, or to use *bit score* thresholds instead.\n \n \n-# cmsearch :: search CM(s) against a sequence database\n-# INFERNAL 1.1.1 (July 2014)\n-# Copyright (C) 2014 Howard Hughes Medical Institute.\n-# Freely distributed under the GNU General Public License (GPLv3).\n-# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -\n-# query CM file: tRNA5.cm\n-# target sequence database: tutorial/mrum-genome.fa\n-# number of worker threads: 8\n-# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -\n+Output columns:\n+\n+(1) rank\n+\n+(2) E-value\n+\n+(3) score\n+\n+(4) bias\n+\n+(5) sequence\n+\n+(6) start\n+\n+(7) end\n+\n+(8) mdl\n+\n+(9) trunc\n+\n+(10) gc\n+\n+(11) description\n+\n+---- --------- ------ ----- ----------- ------- ------- --- ----- ---- -----------\n+\n+! 1.3e-18 71.5 0.0 NC_013790.1 362026 361955 - cm no 0.50 Methanobrevibacter ruminantium M1\n+\n+! 3.3e-18 70.2 0.0 NC_013790.1 2585265 2585193 - cm no 0.60 Methanobrevibacter ruminantium M1\n \n \n-The second section is a list of ranked top hits (sorted by E-value, most significant hit first):\n-\n-rank E-value score bias sequence start end mdl trunc gc description\n----- --------- ------ ----- ----------- ------- ------- --- ----- ---- -----------\n-(1) ! 1.3e-18 71.5 0.0 NC_013790.1 362026 361955 - cm no 0.50 Methanobrevibacter ruminantium M1 \n-(2) ! 3.3e-18 70.2 0.0 NC_013790.1 2585265 2585193 - cm no 0.60 Methanobrevibacter ruminantium M1 \n-\n-\n-\n-For further questions please refere to the Infernal `Userguide <http://selab.janelia.org/software/infernal/Userguide.pdf>`_.\n+For further questions please refere to the Infernal `Userguide <http://eddylab.org/infernal/Userguide.pdf>`_.\n \n ]]>\n </help>\n- <citations>\n- <citation type="doi">10.1093/bioinformatics/btt509</citation>\n- <citation type="bibtex">\n- @ARTICLE{bgruening_galaxytools,\n- Author = {Bj\xc3\xb6rn Gr\xc3\xbcning, Cameron Smith, Torsten Houwaart, Nicola Soranzo, Eric Rasche},\n- keywords = {bioinformatics, ngs, galaxy, cheminformatics, rna},\n- title = {{Galaxy Tools - A collection of bioinformatics and cheminformatics tools for the Galaxy environment}},\n- url = {https://github.com/bgruening/galaxytools}\n- }\n- </citation>\n- </citations>\n- \n- \n+ <expand macro="citations" />\n+\n+\n </tool>\n' |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd cmstat.xml --- a/cmstat.xml Mon Dec 19 15:27:06 2016 -0500 +++ b/cmstat.xml Sat Jan 21 17:36:57 2017 -0500 |
| [ |
| @@ -1,30 +1,25 @@ -<tool id="infernal_cmstat" name="Summary statistics" version="1.1.0.1"> - <description>for covariance model (cmstat)</description> - <requirements> - <requirement type="package">infernal</requirement> - <requirement type="package" version="1.1">infernal</requirement> - <requirement type="package" version="8.22">gnu_coreutils</requirement> - </requirements> +<tool id="infernal_cmstat" name="cmstat" version="@VERSION@.0"> + <description>Summary statistics for covariance model </description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio" /> <command> <![CDATA[ ## a temp file is needed, because the standard tabular output from infernal is not usefull in Galaxy ## it will be converted to a tab delimited file and piped to Galaxy - temp_tabular_output=\$(mktemp); + ##temp_tabular_output=\$(mktemp); cmstat - #if str($cm_opts.cm_opts_selector) == "db": $cm_opts.database.fields.path #else: $cm_opts.cmfile #end if - > \$temp_tabular_output - ; + > $outfile - ## 1. replace all lines starting # (comment lines) - ## 2. replace the first 18 spaces with tabs, 18th field is a free text field (can contain spaces) - sed -e 's/#.*$//' -e '/^$/d' -e 's/ /\t/g' -e 's/\t/ /18g' \$temp_tabular_output > $outfile ]]> </command> @@ -51,6 +46,21 @@ <outputs> <data format="tabular" name="outfile" label="cmstat on ${on_string}"/> </outputs> + <tests> + <test> + <conditional name="cm_opts"> + <param name="cm_opts_selector" value="histdb"/> + <param name="cmfile" value="cmstat_input.cm"/> + </conditional> + <output name="outfile" > + <assert_contents> + <has_text text="idx"/> + <has_text text="accession"/> + <has_text text="nseq"/> + </assert_contents> + </output> + </test> + </tests> <help> <![CDATA[ @@ -86,21 +96,10 @@ relative entropy, the more the model will rely on structural conservation relative sequence conservation when identifying homologs. -For further questions please refere to the Infernal `Userguide <http://selab.janelia.org/software/infernal/Userguide.pdf>`_. +For further questions please refere to the Infernal `Userguide <http://eddylab.org/infernal/Userguide.pdf>`_. ]]> </help> - <citations> - <citation type="doi">10.1093/bioinformatics/btt509</citation> - <citation type="bibtex"> - @ARTICLE{bgruening_galaxytools, - Author = {Björn Grüning, Cameron Smith, Torsten Houwaart, Nicola Soranzo, Eric Rasche}, - keywords = {bioinformatics, ngs, galaxy, cheminformatics, rna}, - title = {{Galaxy Tools - A collection of bioinformatics and cheminformatics tools for the Galaxy environment}}, - url = {https://github.com/bgruening/galaxytools} - } - </citation> - </citations> - - + <expand macro="citations" /> + </tool> |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd macros.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Sat Jan 21 17:36:57 2017 -0500 |
| b |
| @@ -0,0 +1,35 @@ +<macros> + <xml name="requirements"> + <requirements> + <requirement type="package">infernal</requirement> + <requirement type="package" version="1.1.2">infernal</requirement> + <requirement type="package" version="8.22">gnu_coreutils</requirement> + </requirements> + </xml> + <token name="@VERSION@">1.1.2</token> + <xml name="stdio"> + <stdio> + <exit_code range="1:" /> + <exit_code range=":-1" /> + <regex match="Error:" /> + <regex match="Exception:" /> + </stdio> + </xml> + <xml name="citations"> + <citations> + <citation type="bibtex">@article{Nawrocki15112013, +author = {Nawrocki, Eric P. and Eddy, Sean R.}, +title = {Infernal 1.1: 100-fold faster RNA homology searches}, +volume = {29}, +number = {22}, +pages = {2933-2935}, +year = {2013}, +doi = {10.1093/bioinformatics/btt509}, +abstract ={Summary: Infernal builds probabilistic profiles of the sequence and secondary structure of an RNA family called covariance models (CMs) from structurally annotated multiple sequence alignments given as input. Infernal uses CMs to search for new family members in sequence databases and to create potentially large multiple sequence alignments. Version 1.1 of Infernal introduces a new filter pipeline for RNA homology search based on accelerated profile hidden Markov model (HMM) methods and HMM-banded CM alignment methods. This enables ∼100-fold acceleration over the previous version and ∼10 000-fold acceleration over exhaustive non-filtered CM searches.Availability: Source code, documentation and the benchmark are downloadable from http://infernal.janelia.org. Infernal is freely licensed under the GNU GPLv3 and should be portable to any POSIX-compliant operating system, including Linux and Mac OS/X. Documentation includes a user’s guide with a tutorial, a discussion of file formats and user options and additional details on methods implemented in the software.Contact: nawrockie@janelia.hhmi.org}, +URL = {http://bioinformatics.oxfordjournals.org/content/29/22/2933.abstract}, +eprint = {http://bioinformatics.oxfordjournals.org/content/29/22/2933.full.pdf+html}, +journal = {Bioinformatics} +}</citation> + </citations> + </xml> +</macros> |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd test-data/cmalign_input2_tRNA5.c.cm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmalign_input2_tRNA5.c.cm Sat Jan 21 17:36:57 2017 -0500 |
| [ |
| b'@@ -0,0 +1,563 @@\n+INFERNAL1/a [1.1.1 | July 2014]\n+NAME tRNA5\n+STATES 230\n+NODES 61\n+CLEN 72\n+W 89\n+ALPH RNA\n+RF no\n+CONS yes\n+MAP yes\n+DATE Mon Jun 27 12:35:45 2016\n+COM [1] ./src/cmbuild tRNA5.cm tutorial/tRNA5.sto\n+COM [2] cmcalibrate tRNA5.cm\n+PBEGIN 0.05\n+PEND 0.05\n+WBETA 1e-07\n+QDBBETA1 1e-07\n+QDBBETA2 1e-15\n+N2OMEGA 1.52588e-05\n+N3OMEGA 1.52588e-05\n+ELSELF -0.08926734\n+NSEQ 5\n+EFFN 3.725586\n+CKSUM 3535941971\n+NULL 0.000 0.000 0.000 0.000 \n+EFP7GF -5.5288 0.72958\n+ECMLC 0.85563 -4.01853 2.43520 1600000 300168 0.003998\n+ECMGC 0.39437 -17.41037 -4.06685 1600000 77168 0.005183\n+ECMLI 0.73047 -3.70982 3.57712 1600000 245977 0.004879\n+ECMGI 0.44078 -12.13534 -0.86006 1600000 57603 0.006944\n+CM\n+ [ ROOT 0 ] - - - - - -\n+ S 0 -1 0 1 4 0 1 89 108 -7.419 -8.664 -0.055 -5.118 \n+ IL 1 1 2 1 4 3 28 90 110 -2.817 -4.319 -0.613 -2.698 0.000 0.000 0.000 0.000 \n+ IR 2 2 3 2 3 4 30 90 110 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 \n+ [ MATR 1 ] - 74 - a - -\n+ MR 3 2 3 5 5 4 32 89 108 -7.593 -0.028 -7.408 -7.620 -8.512 0.474 -1.199 0.305 -0.089 \n+ D 4 2 3 5 5 1 24 87 107 -5.352 -0.707 -2.978 -4.409 -2.404 \n+ IR 5 5 3 5 5 3 28 89 109 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 2 ] 1 73 g c - -\n+ MP 6 5 3 10 6 5 32 88 107 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.831 -2.997 -3.795 0.617 -3.618 -4.452 0.854 -3.918 -3.870 2.837 -4.276 -0.713 1.871 -3.843 -1.175 -2.703 \n+ ML 7 5 3 10 6 3 26 86 106 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 \n+ MR 8 5 3 10 6 3 25 86 106 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 \n+ D 9 5 3 10 6 0 21 84 103 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 \n+ IL 10 10 5 10 6 3 27 87 107 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 \n+ IR 11 11 6 11 5 3 27 87 107 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 3 ] 2 72 C G - -\n+ MP 12 11 6 16 6 5 31 86 105 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.097 -3.805 -3.998 0.021 -3.009 -4.646 3.103 -3.661 -3.977 1.529 -4.392 -1.585 0.835 -4.247 -0.625 -2.808 \n+ ML 13 11 6 16 6 2 25 84 104 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 \n+ MR 14 11 6 16 6 2 25 84 104 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 \n+ D 15 11 6 16 6 0 21 82 101 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 \n+ IL 16 16 5 16 6 3 27 85 105 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 \n+ IR 17 17 6 17 5 3 27 85 105 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 4 ] 3 71 c g - -\n+ MP 18 17 6 22 6 5 29 84 103 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.141 -2.880 -3.222 0.733 -2.762 -4.023 2.237 -3.232 -3.242 1.678 -3.747 0.537 1.616 -3.340 -0.447 -2.158 \n+ ML 19 '..b'1.46634 0.26236 1.09861 0.40547\n+ 51 1.62002 2.40165 0.60094 1.81254 53 G - - <\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 52 3.13623 4.03650 0.08313 3.98115 54 G - - <\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 53 3.41131 3.24840 3.95063 0.09549 55 U - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 54 3.41131 3.24840 3.95063 0.09549 56 U - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 55 3.81775 0.07857 4.34279 3.20425 57 C - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 56 1.55092 3.20619 0.37228 2.84263 58 G - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 57 0.06447 4.06946 3.72356 3.85378 59 A - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 58 2.58013 1.68600 3.11568 0.36438 60 U - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 59 2.39994 1.14144 2.97016 0.61874 61 U - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 60 4.11656 0.10126 3.89068 2.82057 62 C - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 61 1.95700 0.67131 2.21870 1.43159 63 C - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 62 2.18076 0.86710 1.10730 1.99196 64 c - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 63 1.27825 1.21396 1.24116 1.99945 65 c - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 64 2.19639 2.68263 0.47103 1.62938 66 G - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 65 1.68678 2.30864 2.17351 0.50798 67 U - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 66 1.21618 1.66846 0.95030 2.05201 68 g - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 67 2.09329 1.05549 1.48837 1.19416 69 c - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 68 2.26917 0.96322 1.25225 1.47369 70 c - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 69 1.53154 1.55221 1.02428 1.54664 71 g - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 70 2.18028 1.66521 0.48878 2.47139 72 G - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 71 1.37162 0.72882 2.04389 2.00766 73 c - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 72 1.04988 2.29119 1.14633 1.46503 74 a - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01418 4.26268 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd test-data/cmalign_input_mrum_tRNAs10.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmalign_input_mrum_tRNAs10.fa Sat Jan 21 17:36:57 2017 -0500 |
| b |
| @@ -0,0 +1,30 @@ +>mrum-tRNA.1 +GGAGCUAUAGCUCAAUGGCAGAGCGUUUGGCUGACAUCCAAAAGGUUAUGGGUUCGAUUC +CCUUUAGCCCCA +>mrum-tRNA.2 +GGGCCCGUAGCUCAGUUGGGAGAGCGCUGCCCUUGCAAGGCAGAGGCCCCGGGUUCAAAU +CCCGGUGGGUCCA +>mrum-tRNA.3 +GGGCCCAUAGCUUAGCCAGGUAGAGCGCUCGGCUCAUAACCGGGAUGUCAUGGGUUCGAA +UCCCAUUGGGCCCA +>mrum-tRNA.4 +AGGCUAGUGGCACAGCCUGGUCAGCGCGCACGGCUGAUAACCGUGAGGUCCUGGGUUCGA +AUCCCAGCUAGCCUA +>mrum-tRNA.5 +CCCGACUUAGCUCAAUUUGGCAGAGCGUUGGACUGUAGAUCCAAAUGUUGCUGGUUCAAG +UCCGGCAGUCGGGA +>mrum-tRNA.6 +GCUUCUAUGGGGUAAUCGGCAAACCCAUCGGACUUUCGAUCCGAUAAUCCGGGUUCAAAU +CCCGGUAGAAGCA +>mrum-tRNA.7 +GCUCCGAUGGUGUAGUCCGGCCAAUCAUUUCGGCCUUUCGAGCCGAAGACUCGGGUUCGA +AUCCCGGUCGGAGCA +>mrum-tRNA.8 +GCGGUGUUAGUCCAGCCUGGUUAAGACUCUAGCCUGCCACGUUAGAGACCCGGGUUCAAA +UCCCGGACGCCGCA +>mrum-tRNA.9 +GCCGGGGUGGCUCAGCUGGUUAGAGCGCACGGCUCAUAGGGUAACUAAGCGUGCUCUGAC +UUUUUUCCUGGGAUACCGUGAGAUCGCGGGUUCGAAUCCCGCCCCCGGCA +>mrum-tRNA.10 +GGUUCUAUAGUUUAACAGGUAAAACAACUGGCUGUUAACCGGCAGAUAGGAGUUCGAAUC +UUCUUAGAACCG |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd test-data/cmalign_result_mrum-tRNAs10.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmalign_result_mrum-tRNAs10.out Sat Jan 21 17:36:57 2017 -0500 |
| b |
| @@ -0,0 +1,26 @@ +# STOCKHOLM 1.0 +#=GF AU Infernal 1.1 + +mrum-tRNA.1 GGAGCUAUAGCUCAAU..GGC..AGAGCGUUUGGCUGACAU........................................CCAAAAGGUUAUGGGUUCGAUUCCCUUUAGCCCCA +#=GR mrum-tRNA.1 PP ****************..***..******************........................................*********************************** +mrum-tRNA.2 GGGCCCGUAGCUCAGU.uGGG..AGAGCGCUGCCCUUGCAA........................................GGCAGAGGCCCCGGGUUCAAAUCCCGGUGGGUCCA +#=GR mrum-tRNA.2 PP ****************.****..******************........................................*********************************** +mrum-tRNA.3 GGGCCCAUAGCUUAGCcaGGU..AGAGCGCUCGGCUCAUAA........................................CCGGGAUGUCAUGGGUUCGAAUCCCAUUGGGCCCA +#=GR mrum-tRNA.3 PP *********************..******************........................................*********************************** +mrum-tRNA.4 AGGCUAGUGGCACAGCcuGGU.cAGCGCGCACGGCUGAUAA........................................CCGUGAGGUCCUGGGUUCGAAUCCCAGCUAGCCUA +#=GR mrum-tRNA.4 PP ***************999***.*******************........................................*********************************** +mrum-tRNA.5 CCCGACUUAGCUCAAUuuGGC..AGAGCGUUGGACUGUAGA........................................UCCAAAUGUUGCUGGUUCAAGUCCGGCAGUCGGGA +#=GR mrum-tRNA.5 PP *********************..******************........................................*********************************** +mrum-tRNA.6 GCUUCUAUGGGGUAAU.cGGC.aAACCCAUCGGACUUUCGA........................................UCCGAUAA-UCCGGGUUCAAAUCCCGGUAGAAGCA +#=GR mrum-tRNA.6 PP ****************.****.*******************........................................********.9************************* +mrum-tRNA.7 GCUCCGAUGGUGUAGUccGGCcaAUCAUUUCGGCCUUUCGA........................................GCCGAAGA-CUCGGGUUCGAAUCCCGGUCGGAGCA +#=GR mrum-tRNA.7 PP ********************9999*****************........................................********.************************** +mrum-tRNA.8 GCGGUGUUAGUCCAGCcuGGU.uAAGACUCUAGCCUGCCAC........................................GUUAGAGA-CCCGGGUUCAAAUCCCGGACGCCGCA +#=GR mrum-tRNA.8 PP ***************999***.*******************........................................********.************************** +mrum-tRNA.9 GCCGGGGUGGCUCAGC.uGGU.uAGAGCGCACGGCUC----auaggguaacuaagcgugcucugacuuuuuuccugggauaCCGUGAGAUCGCGGGUUCGAAUCCCGCCCCCGGCA +#=GR mrum-tRNA.9 PP ****************.****.************995....678************************************************************************ +mrum-tRNA.10 GGUUCUAUAGUUUAAC.aGGU..AAAACAACUGGCUGUUAA........................................CCGGCAGA-UAGGAGUUCGAAUCUUCUUAGAACCG +#=GR mrum-tRNA.10 PP ****************.****..******************........................................********.9************************* +#=GC SS_cons (((((((,,<<<<___..___.._>>>>,<<<<<_______~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~>>>>>,,,,,<<<<<_______>>>>>))))))): +#=GC RF gCcggcAUAGcgcAgU..GGu..AgcgCgccagccUgucAa~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~gcuggAGgUCCgggGUUCGAUUCcccGUgccgGca +// |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd test-data/cmalignoutput --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmalignoutput Sat Jan 21 17:36:57 2017 -0500 |
| b |
| @@ -0,0 +1,26 @@ +# STOCKHOLM 1.0 +#=GF AU Infernal 1.1.2 + +mrum-tRNA.1 GGAGCUAUAGCUCAAU..GGC..AGAGCGUUUGGCUGACAU........................................CCAAAAGGUUAUGGGUUCGAUUCCCUUUAGCCCCA +#=GR mrum-tRNA.1 PP ****************..***..******************........................................*********************************** +mrum-tRNA.2 GGGCCCGUAGCUCAGU.uGGG..AGAGCGCUGCCCUUGCAA........................................GGCAGAGGCCCCGGGUUCAAAUCCCGGUGGGUCCA +#=GR mrum-tRNA.2 PP ****************.****..******************........................................*********************************** +mrum-tRNA.3 GGGCCCAUAGCUUAGCcaGGU..AGAGCGCUCGGCUCAUAA........................................CCGGGAUGUCAUGGGUUCGAAUCCCAUUGGGCCCA +#=GR mrum-tRNA.3 PP *********************..******************........................................*********************************** +mrum-tRNA.4 AGGCUAGUGGCACAGCcuGGU.cAGCGCGCACGGCUGAUAA........................................CCGUGAGGUCCUGGGUUCGAAUCCCAGCUAGCCUA +#=GR mrum-tRNA.4 PP ***************999***.*******************........................................*********************************** +mrum-tRNA.5 CCCGACUUAGCUCAAUuuGGC..AGAGCGUUGGACUGUAGA........................................UCCAAAUGUUGCUGGUUCAAGUCCGGCAGUCGGGA +#=GR mrum-tRNA.5 PP *********************..******************........................................*********************************** +mrum-tRNA.6 GCUUCUAUGGGGUAAU.cGGC.aAACCCAUCGGACUUUCGA........................................UCCGAUAA-UCCGGGUUCAAAUCCCGGUAGAAGCA +#=GR mrum-tRNA.6 PP ****************.****.*******************........................................********.9************************* +mrum-tRNA.7 GCUCCGAUGGUGUAGUccGGCcaAUCAUUUCGGCCUUUCGA........................................GCCGAAGA-CUCGGGUUCGAAUCCCGGUCGGAGCA +#=GR mrum-tRNA.7 PP ********************9999*****************........................................********.************************** +mrum-tRNA.8 GCGGUGUUAGUCCAGCcuGGU.uAAGACUCUAGCCUGCCAC........................................GUUAGAGA-CCCGGGUUCAAAUCCCGGACGCCGCA +#=GR mrum-tRNA.8 PP ***************999***.*******************........................................********.************************** +mrum-tRNA.9 GCCGGGGUGGCUCAGC.uGGU.uAGAGCGCACGGCUC----auaggguaacuaagcgugcucugacuuuuuuccugggauaCCGUGAGAUCGCGGGUUCGAAUCCCGCCCCCGGCA +#=GR mrum-tRNA.9 PP ****************.****.************995....678************************************************************************ +mrum-tRNA.10 GGUUCUAUAGUUUAAC.aGGU..AAAACAACUGGCUGUUAA........................................CCGGCAGA-UAGGAGUUCGAAUCUUCUUAGAACCG +#=GR mrum-tRNA.10 PP ****************.****..******************........................................********.9************************* +#=GC SS_cons (((((((,,<<<<___..___.._>>>>,<<<<<_______~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~>>>>>,,,,,<<<<<_______>>>>>))))))): +#=GC RF gCcggcAUAGcgcAgU..GGu..AgcgCgccagccUgucAa~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~gcuggAGgUCCgggGUUCGAUUCcccGUgccgGca +// |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd test-data/cmbuild_input_tRNA5.sto --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmbuild_input_tRNA5.sto Sat Jan 21 17:36:57 2017 -0500 |
| b |
| @@ -0,0 +1,16 @@ +# STOCKHOLM 1.0 + +tRNA1 GCGGAUUUAGCUCAGUUGGG.AGAGCGCCAGACUGAAGAUCUGGAGGUCC +tRNA2 UCCGAUAUAGUGUAAC.GGCUAUCACAUCACGCUUUCACCGUGGAGA.CC +tRNA3 UCCGUGAUAGUUUAAU.GGUCAGAAUGGGCGCUUGUCGCGUGCCAGA.UC +tRNA4 GCUCGUAUGGCGCAGU.GGU.AGCGCAGCAGAUUGCAAAUCUGUUGGUCC +tRNA5 GGGCACAUGGCGCAGUUGGU.AGCGCGCUUCCCUUGCAAGGAAGAGGUCA +#=GC SS_cons <<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....< + +tRNA1 UGUGUUCGAUCCACAGAAUUCGCA +tRNA2 GGGGUUCGACUCCCCGUAUCGGAG +tRNA3 GGGGUUCAAUUCCCCGUCGCGGAG +tRNA4 UUAGUUCGAUCCUGAGUGCGAGCU +tRNA5 UCGGUUCGAUUCCGGUUGCGUCCA +#=GC SS_cons <<<<.......>>>>>>>>>>>>. +// |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd test-data/cmbuild_results.cm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmbuild_results.cm Sat Jan 21 17:36:57 2017 -0500 |
| [ |
| b'@@ -0,0 +1,558 @@\n+INFERNAL1/a [1.1.2 | July 2016]\n+NAME dataset_743\n+STATES 230\n+NODES 61\n+CLEN 72\n+W 89\n+ALPH RNA\n+RF no\n+CONS yes\n+MAP yes\n+DATE Wed Nov 2 15:35:29 2016\n+COM [1] cmbuild -F --fast --symfrac 0.5 --wpb --p7ere 0.38 --EmN 200 --EvN 200 --ElfN 200 --EgfN 200 --eent --refine /dev/null /home/wanli/galaxy/database/files/000/dataset_750.dat /home/wanli/galaxy/database/files/000/dataset_743.dat\n+PBEGIN 0.05\n+PEND 0.05\n+WBETA 1e-07\n+QDBBETA1 1e-07\n+QDBBETA2 1e-15\n+N2OMEGA 1.52588e-05\n+N3OMEGA 1.52588e-05\n+ELSELF -0.08926734\n+NSEQ 5\n+EFFN 3.725586\n+CKSUM 3535941971\n+NULL 0.000 0.000 0.000 0.000 \n+EFP7GF -5.5288 0.72958\n+CM\n+ [ ROOT 0 ] - - - - - -\n+ S 0 -1 0 1 4 0 1 89 108 -7.419 -8.664 -0.055 -5.118 \n+ IL 1 1 2 1 4 3 28 90 110 -2.817 -4.319 -0.613 -2.698 0.000 0.000 0.000 0.000 \n+ IR 2 2 3 2 3 4 30 90 110 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 \n+ [ MATR 1 ] - 74 - a - -\n+ MR 3 2 3 5 5 4 32 89 108 -7.593 -0.028 -7.408 -7.620 -8.512 0.474 -1.199 0.305 -0.089 \n+ D 4 2 3 5 5 1 24 87 107 -5.352 -0.707 -2.978 -4.409 -2.404 \n+ IR 5 5 3 5 5 3 28 89 109 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 2 ] 1 73 g c - -\n+ MP 6 5 3 10 6 5 32 88 107 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.831 -2.997 -3.795 0.617 -3.618 -4.452 0.854 -3.918 -3.870 2.837 -4.276 -0.713 1.871 -3.843 -1.175 -2.703 \n+ ML 7 5 3 10 6 3 26 86 106 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 \n+ MR 8 5 3 10 6 3 25 86 106 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 \n+ D 9 5 3 10 6 0 21 84 103 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 \n+ IL 10 10 5 10 6 3 27 87 107 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 \n+ IR 11 11 6 11 5 3 27 87 107 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 3 ] 2 72 C G - -\n+ MP 12 11 6 16 6 5 31 86 105 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.097 -3.805 -3.998 0.021 -3.009 -4.646 3.103 -3.661 -3.977 1.529 -4.392 -1.585 0.835 -4.247 -0.625 -2.808 \n+ ML 13 11 6 16 6 2 25 84 104 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 \n+ MR 14 11 6 16 6 2 25 84 104 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 \n+ D 15 11 6 16 6 0 21 82 101 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 \n+ IL 16 16 5 16 6 3 27 85 105 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 \n+ IR 17 17 6 17 5 3 27 85 105 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 4 ] 3 71 c g - -\n+ MP 18 17 6 22 6 5 29 84 103 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.141 -2.880 -3.222 0.733 -2.762 -4.023 2.237 -3.232 -3.242 1.678 -3.747 0.537 1.616 -3.340 -0.447 -2.158 \n+ ML 19 17 6 22 6 2 25 82 102 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 \n+ MR 20 17 6 22 '..b'1.46634 0.26236 1.09861 0.40547\n+ 51 1.62002 2.40165 0.60094 1.81254 53 G - - <\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 52 3.13623 4.03650 0.08313 3.98115 54 G - - <\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 53 3.41131 3.24840 3.95063 0.09549 55 U - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 54 3.41131 3.24840 3.95063 0.09549 56 U - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 55 3.81775 0.07857 4.34279 3.20425 57 C - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 56 1.55092 3.20619 0.37228 2.84263 58 G - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 57 0.06447 4.06946 3.72356 3.85378 59 A - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 58 2.58013 1.68600 3.11568 0.36438 60 U - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 59 2.39994 1.14144 2.97016 0.61874 61 U - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 60 4.11656 0.10126 3.89068 2.82057 62 C - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 61 1.95700 0.67131 2.21870 1.43159 63 C - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 62 2.18076 0.86710 1.10730 1.99196 64 c - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 63 1.27825 1.21396 1.24116 1.99945 65 c - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 64 2.19639 2.68263 0.47103 1.62938 66 G - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 65 1.68678 2.30864 2.17351 0.50798 67 U - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 66 1.21618 1.66846 0.95030 2.05201 68 g - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 67 2.09329 1.05549 1.48837 1.19416 69 c - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 68 2.26917 0.96322 1.25225 1.47369 70 c - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 69 1.53154 1.55221 1.02428 1.54664 71 g - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 70 2.18028 1.66521 0.48878 2.47139 72 G - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 71 1.37162 0.72882 2.04389 2.00766 73 c - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 72 1.04988 2.29119 1.14633 1.46503 74 a - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01418 4.26268 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd test-data/cmcalibrate_input.cm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmcalibrate_input.cm Sat Jan 21 17:36:57 2017 -0500 |
| [ |
| b'@@ -0,0 +1,570 @@\n+INFERNAL1/a [1.1.2 | July 2016]\n+NAME dataset_838\n+STATES 233\n+NODES 62\n+CLEN 73\n+W 90\n+ALPH RNA\n+RF no\n+CONS yes\n+MAP yes\n+DATE Thu Dec 15 13:43:26 2016\n+COM [1] cmbuild -F --fast --symfrac 0.5 --wpb --p7ere 0.38 --EmN 200 --EvN 200 --ElfN 200 --EgfN 200 --eent /home/wanli/galaxy/database/files/000/dataset_839.dat /home/wanli/galaxy/database/files/000/dataset_838.dat\n+COM [2] cmcalibrate Downloads/download.cm\n+PBEGIN 0.05\n+PEND 0.05\n+WBETA 1e-07\n+QDBBETA1 1e-07\n+QDBBETA2 1e-15\n+N2OMEGA 1.52588e-05\n+N3OMEGA 1.52588e-05\n+ELSELF -0.08926734\n+NSEQ 2\n+EFFN 1.902344\n+CKSUM 1256650105\n+NULL 0.000 0.000 0.000 0.000 \n+EFP7GF -2.8151 0.73715\n+ECMLC 0.80543 -3.96449 2.80237 1600000 279383 0.004295\n+ECMGC 0.42297 -15.07779 -2.84171 1600000 70757 0.005653\n+ECMLI 0.67085 -3.93573 3.92167 1600000 233559 0.005138\n+ECMGI 0.43319 -10.87224 0.43591 1600000 53640 0.007457\n+CM\n+ [ ROOT 0 ] - - - - - -\n+ S 0 -1 0 1 4 0 1 90 110 -6.854 -8.100 -0.081 -4.553 \n+ IL 1 1 2 1 4 3 27 91 111 -2.817 -4.319 -0.613 -2.698 0.000 0.000 0.000 0.000 \n+ IR 2 2 3 2 3 4 29 92 112 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 \n+ [ MATR 1 ] - 74 - a - -\n+ MR 3 2 3 5 5 5 30 90 110 -7.084 -0.039 -6.900 -7.112 -8.004 0.711 -1.386 0.490 -0.798 \n+ D 4 2 3 5 5 1 23 88 109 -5.352 -0.707 -2.978 -4.409 -2.404 \n+ IR 5 5 3 5 5 3 27 90 110 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 2 ] 1 73 g c - -\n+ MP 6 5 3 10 6 6 31 89 109 -9.103 -9.042 -0.021 -7.819 -8.099 -8.494 -3.271 -2.721 -3.286 0.880 -2.952 -4.020 1.406 -3.346 -3.336 2.423 -3.790 -0.527 1.874 -3.393 -0.601 -2.220 \n+ ML 7 5 3 10 6 3 25 87 107 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 \n+ MR 8 5 3 10 6 3 25 87 107 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 \n+ D 9 5 3 10 6 0 20 85 105 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 \n+ IL 10 10 5 10 6 3 26 88 109 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 \n+ IR 11 11 6 11 5 3 27 88 108 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 3 ] 2 72 C G - -\n+ MP 12 11 6 16 6 5 30 87 107 -9.103 -9.042 -0.021 -7.819 -8.099 -8.494 -4.534 -4.439 -4.227 -0.672 -2.948 -4.641 3.546 -3.756 -4.276 -0.430 -4.538 -2.386 0.568 -4.605 -0.654 -3.116 \n+ ML 13 11 6 16 6 3 24 85 105 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 \n+ MR 14 11 6 16 6 2 24 85 105 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 \n+ D 15 11 6 16 6 0 20 83 103 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 \n+ IL 16 16 5 16 6 3 26 86 107 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 \n+ IR 17 17 6 17 5 3 26 86 106 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 4 ] 3 71 g c - -\n+ MP 18 17 6 22 6 5 29 '..b'1.46634 0.26236 1.09861 0.40547\n+ 52 1.94038 1.65192 0.97323 1.24894 53 g - - <\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 53 2.34693 2.84383 0.24235 2.79106 54 G - - <\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 54 2.26593 2.29030 2.76601 0.31181 55 U - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 55 2.26593 2.29030 2.76601 0.31181 56 U - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 56 2.39558 0.32068 2.95885 2.02994 57 C - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 57 2.30534 3.12204 0.23733 2.69597 58 G - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 58 0.23431 2.86460 2.62614 2.53179 59 A - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 59 1.81039 1.10283 2.34106 0.89586 60 u - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 60 1.81068 1.09350 2.34184 0.90321 61 u - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 61 3.00308 0.28386 2.67186 2.05286 62 C - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 62 1.40018 1.07245 1.48219 1.69206 63 c - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 63 2.99483 0.28498 2.66860 2.05124 64 C - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 64 1.39930 1.07371 1.48229 1.69078 65 c - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 65 2.09668 2.70224 0.31051 2.56386 66 G - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 66 1.29468 1.69346 1.37752 1.23812 67 u - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 67 0.53113 2.46484 1.46640 2.34049 68 A - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 68 2.52828 1.78440 2.16542 0.45004 69 U - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 69 2.54850 0.71164 2.25714 1.11990 70 c - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 70 1.88844 1.08198 1.08743 1.75627 71 c - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 71 2.11092 2.71850 0.30443 2.58552 72 G - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 72 1.40959 1.06246 1.48726 1.69195 73 c - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547\n+ 73 0.90952 2.28340 1.07370 1.87338 74 a - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02469 3.71357 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd test-data/cmpress_input_minifam.cm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmpress_input_minifam.cm Sat Jan 21 17:36:57 2017 -0500 |
| [ |
| b'@@ -0,0 +1,2830 @@\n+INFERNAL1/a [1.1rc1 | June 2012]\n+NAME tRNA5\n+STATES 230\n+NODES 61\n+CLEN 72\n+W 89\n+ALPH RNA\n+RF no\n+CONS yes\n+MAP yes\n+DATE Tue Jun 12 17:22:37 2012\n+COM [1] ./cmbuild tRNA5.cm ../tutorial/tRNA5.sto\n+COM [2] ./cmcalibrate ./tRNA5.cm\n+PBEGIN 0.05\n+PEND 0.05\n+WBETA 1e-07\n+QDBBETA1 1e-07\n+QDBBETA2 1e-15\n+N2OMEGA 1.52588e-05\n+N3OMEGA 1.52588e-05\n+ELSELF -0.08926734\n+NSEQ 5\n+EFFN 3.725586\n+CKSUM 3535941971\n+NULL 0.000 0.000 0.000 0.000 \n+EFP7GF -5.5288 0.72958\n+ECMLC 0.85563 -4.01853 2.43520 1600000 300168 0.003998\n+ECMGC 0.39437 -17.41037 -4.06685 1600000 77168 0.005183\n+ECMLI 0.73047 -3.70982 3.57712 1600000 245977 0.004879\n+ECMGI 0.44078 -12.13534 -0.86006 1600000 57603 0.006944\n+CM\n+ [ ROOT 0 ] - - - - - -\n+ S 0 -1 0 1 4 0 1 89 108 -7.419 -8.664 -0.055 -5.118 \n+ IL 1 1 2 1 4 3 28 90 110 -2.817 -4.319 -0.613 -2.698 0.000 0.000 0.000 0.000 \n+ IR 2 2 3 2 3 4 30 90 110 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 \n+ [ MATR 1 ] - 74 - a - -\n+ MR 3 2 3 5 5 4 32 89 108 -7.593 -0.028 -7.408 -7.620 -8.512 0.474 -1.199 0.305 -0.089 \n+ D 4 2 3 5 5 1 24 87 107 -5.352 -0.707 -2.978 -4.409 -2.404 \n+ IR 5 5 3 5 5 3 28 89 109 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 2 ] 1 73 g c - -\n+ MP 6 5 3 10 6 5 32 88 107 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.831 -2.997 -3.795 0.617 -3.618 -4.452 0.854 -3.918 -3.870 2.837 -4.276 -0.713 1.871 -3.843 -1.175 -2.703 \n+ ML 7 5 3 10 6 3 26 86 106 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 \n+ MR 8 5 3 10 6 3 25 86 106 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 \n+ D 9 5 3 10 6 0 21 84 103 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 \n+ IL 10 10 5 10 6 3 27 87 107 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 \n+ IR 11 11 6 11 5 3 27 87 107 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 3 ] 2 72 C G - -\n+ MP 12 11 6 16 6 5 31 86 105 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.097 -3.805 -3.998 0.021 -3.009 -4.646 3.103 -3.661 -3.977 1.529 -4.392 -1.585 0.835 -4.247 -0.625 -2.808 \n+ ML 13 11 6 16 6 2 25 84 104 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 \n+ MR 14 11 6 16 6 2 25 84 104 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 \n+ D 15 11 6 16 6 0 21 82 101 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 \n+ IL 16 16 5 16 6 3 27 85 105 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 \n+ IR 17 17 6 17 5 3 27 85 105 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 4 ] 3 71 c g - -\n+ MP 18 17 6 22 6 5 29 84 103 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.141 -2.880 -3.222 0.733 -2.762 -4.023 2.237 -3.232 -3.242 1.678 -3.747 0.537 1.616 -3.340 -0.447 -2.158 \n+ ML '..b'1.46634 0.26236 1.09861 0.40547\n+ 170 1.83247 1.54414 1.46722 0.92654 420 u - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02769 4.29360 4.29360 1.46634 0.26236 0.78025 0.61303\n+ 171 1.92483 2.45259 0.39512 2.35988 421 G - - ]\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 172 3.31990 0.21477 3.08295 2.19556 422 C - - ]\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 173 2.71639 0.42788 2.38356 1.66192 423 C - - ]\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 174 1.25076 1.81371 1.23869 1.34361 424 g - - ]\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 175 1.54434 1.70196 1.17488 1.21954 425 g - - ]\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 176 1.40798 1.46982 1.27683 1.40050 426 g - - ]\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 177 1.18394 1.69593 1.51954 1.23206 427 a - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 178 1.27564 1.49766 1.31220 1.47900 428 a - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 179 1.31428 1.47326 1.53565 1.24883 429 u - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 180 1.38664 1.52439 1.37112 1.27829 430 u - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 181 1.35245 1.43180 1.49281 1.28095 431 u - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 182 1.29898 1.51481 1.69904 1.12553 432 u - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 183 1.25000 1.66010 1.46572 1.22942 433 u - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 184 1.28242 1.69982 1.29083 1.32849 434 a - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 185 1.17156 1.68621 1.44410 1.31327 435 a - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 186 1.22009 1.28821 1.81175 1.32553 436 a - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 187 1.30308 1.39524 1.62633 1.25919 437 u - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 188 1.34275 1.28056 1.58864 1.35950 438 c - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 189 1.31677 1.65824 1.41232 1.21084 439 u - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 190 1.43270 1.22474 1.77469 1.21077 440 u - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 191 1.51542 1.17791 1.56046 1.33817 441 c - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01381 4.28939 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd test-data/cmsearch_input1.cm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmsearch_input1.cm Sat Jan 21 17:36:57 2017 -0500 |
| [ |
| b'@@ -0,0 +1,563 @@\n+INFERNAL1/a [1.1.1 | July 2014]\n+NAME tRNA5\n+STATES 230\n+NODES 61\n+CLEN 72\n+W 89\n+ALPH RNA\n+RF no\n+CONS yes\n+MAP yes\n+DATE Mon Jun 27 12:35:45 2016\n+COM [1] ./src/cmbuild tRNA5.cm tutorial/tRNA5.sto\n+COM [2] cmcalibrate tRNA5.cm\n+PBEGIN 0.05\n+PEND 0.05\n+WBETA 1e-07\n+QDBBETA1 1e-07\n+QDBBETA2 1e-15\n+N2OMEGA 1.52588e-05\n+N3OMEGA 1.52588e-05\n+ELSELF -0.08926734\n+NSEQ 5\n+EFFN 3.725586\n+CKSUM 3535941971\n+NULL 0.000 0.000 0.000 0.000 \n+EFP7GF -5.5288 0.72958\n+ECMLC 0.85563 -4.01853 2.43520 1600000 300168 0.003998\n+ECMGC 0.39437 -17.41037 -4.06685 1600000 77168 0.005183\n+ECMLI 0.73047 -3.70982 3.57712 1600000 245977 0.004879\n+ECMGI 0.44078 -12.13534 -0.86006 1600000 57603 0.006944\n+CM\n+ [ ROOT 0 ] - - - - - -\n+ S 0 -1 0 1 4 0 1 89 108 -7.419 -8.664 -0.055 -5.118 \n+ IL 1 1 2 1 4 3 28 90 110 -2.817 -4.319 -0.613 -2.698 0.000 0.000 0.000 0.000 \n+ IR 2 2 3 2 3 4 30 90 110 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 \n+ [ MATR 1 ] - 74 - a - -\n+ MR 3 2 3 5 5 4 32 89 108 -7.593 -0.028 -7.408 -7.620 -8.512 0.474 -1.199 0.305 -0.089 \n+ D 4 2 3 5 5 1 24 87 107 -5.352 -0.707 -2.978 -4.409 -2.404 \n+ IR 5 5 3 5 5 3 28 89 109 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 2 ] 1 73 g c - -\n+ MP 6 5 3 10 6 5 32 88 107 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.831 -2.997 -3.795 0.617 -3.618 -4.452 0.854 -3.918 -3.870 2.837 -4.276 -0.713 1.871 -3.843 -1.175 -2.703 \n+ ML 7 5 3 10 6 3 26 86 106 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 \n+ MR 8 5 3 10 6 3 25 86 106 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 \n+ D 9 5 3 10 6 0 21 84 103 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 \n+ IL 10 10 5 10 6 3 27 87 107 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 \n+ IR 11 11 6 11 5 3 27 87 107 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 3 ] 2 72 C G - -\n+ MP 12 11 6 16 6 5 31 86 105 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.097 -3.805 -3.998 0.021 -3.009 -4.646 3.103 -3.661 -3.977 1.529 -4.392 -1.585 0.835 -4.247 -0.625 -2.808 \n+ ML 13 11 6 16 6 2 25 84 104 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 \n+ MR 14 11 6 16 6 2 25 84 104 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 \n+ D 15 11 6 16 6 0 21 82 101 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 \n+ IL 16 16 5 16 6 3 27 85 105 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 \n+ IR 17 17 6 17 5 3 27 85 105 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 4 ] 3 71 c g - -\n+ MP 18 17 6 22 6 5 29 84 103 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.141 -2.880 -3.222 0.733 -2.762 -4.023 2.237 -3.232 -3.242 1.678 -3.747 0.537 1.616 -3.340 -0.447 -2.158 \n+ ML 19 '..b'1.46634 0.26236 1.09861 0.40547\n+ 51 1.62002 2.40165 0.60094 1.81254 53 G - - <\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 52 3.13623 4.03650 0.08313 3.98115 54 G - - <\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 53 3.41131 3.24840 3.95063 0.09549 55 U - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 54 3.41131 3.24840 3.95063 0.09549 56 U - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 55 3.81775 0.07857 4.34279 3.20425 57 C - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 56 1.55092 3.20619 0.37228 2.84263 58 G - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 57 0.06447 4.06946 3.72356 3.85378 59 A - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 58 2.58013 1.68600 3.11568 0.36438 60 U - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 59 2.39994 1.14144 2.97016 0.61874 61 U - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 60 4.11656 0.10126 3.89068 2.82057 62 C - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 61 1.95700 0.67131 2.21870 1.43159 63 C - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 62 2.18076 0.86710 1.10730 1.99196 64 c - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 63 1.27825 1.21396 1.24116 1.99945 65 c - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 64 2.19639 2.68263 0.47103 1.62938 66 G - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 65 1.68678 2.30864 2.17351 0.50798 67 U - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 66 1.21618 1.66846 0.95030 2.05201 68 g - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 67 2.09329 1.05549 1.48837 1.19416 69 c - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 68 2.26917 0.96322 1.25225 1.47369 70 c - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 69 1.53154 1.55221 1.02428 1.54664 71 g - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 70 2.18028 1.66521 0.48878 2.47139 72 G - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 71 1.37162 0.72882 2.04389 2.00766 73 c - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 72 1.04988 2.29119 1.14633 1.46503 74 a - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01418 4.26268 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd test-data/cmsearch_input2.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmsearch_input2.fa Sat Jan 21 17:36:57 2017 -0500 |
| b |
| b'@@ -0,0 +1,41963 @@\n+>NC_013790.1 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ATGACTAATATTTTTGAGGATTTACAGGAAGAAAGCGTGGGAGTGAGTATTTTTAAAGATAAAAAACCTT\n+TAGATCATCGTTTTTTACCTGAAAATTTGCCTCATAGAAAGAAACAGATTACTGAAATTGCTAAACATTG\n+GATTGAAGCATTAAATGGAAACACCCCTTCAAACATTACAATTTATGGTAAGACAGGAACTGGAAAGACT\n+GCTGCTGCTAAATTCGCTAAAGAGCAGCTTATTGAAGCATCTAGAGATAAAAATGTCTTCATTAAAGTCG\n+AATATATCAGATGTACAGACTTCACTACAGAATACCAGGTCCTTACCTATCTTTGTCAAAGGCTAGGCCG\n+TGATGTTCCTAACCGTGGATGGACCAAGGGGGAGATTGTAAACACCTTTAGAGACATTTTAAGAAGAAAT\n+GCCTTTGGCAGAAATCTTATTTTAATTGTCATTTTAGATGAGATCGATATTCTTCTTGAAAAGGACGGCG\n+ACGGAATCTTATACACCCTTACAAGAACTGATAATATTGCCATTCTTTCAATAAGTAATTATCTTGACTT\n+TAAGCAATTCATTAAGCCAAGGGTTGCAAGCAGCTTAAGGGATAAAGAAATAGTGTTCCCGCCTTATGAT\n+GCAGAGCAATTAGCTGATATTTTACATGAACGTTCTGAATTGGCATTTGAAGAAAATACACTTGAAGAAA\n+GCGTTATTCCATTATGTTCAGCTATGGCTGCTAAGGAAGAAGGTGATGCAAGATATGCTCTTGACCTATT\n+GGAGAACGCTGGAGACATTGCTGTTGAAGAAGGATCTGAAATCGTTAAGGGAAAATATGTGCGTCAAGCT\n+AAGGATGTCATTGAGTATAATAAGGTTAAAGACGTTATTATTACACTTCCAACCCAACAGCAAAGGGTTC\n+TTGCAGCTATAATGAAATTAACTCAAGACAATGAGGAAATCACTTCAGGTAAGCTCTTTGAAGTCTATAA\n+AGATATTTCTAAAGGAGACAGTGTTACCTATAGAAGAATCTTTGATTTCATTAACGAATTGGAGATGTTA\n+GGAATTATCTCTACCAACACCATATCCAGGGGCAGAGGTAAAGGCAGGACCAATATTATTAAGTTGCAGA\n+CTGATTCTAAGTTGATTCAAGATAACTTATCTGCTGTTCTTTATTAGATAGATTCCTTATAATCTGGTAT\n+AATACTTATTTTGATTTTTTTTTATTATATCAGGTTTTTTCTTTTTTTTTAATTATTTTTTCTTATTATT\n+TTTGTTTTTCTTTTTTTTGGATGATTTTCATCTTTTTTTGTTTTTTATTGTTTTTGTGTGGTTTTCAATT\n+TGTATTCTTTTCTTTTTTTGTTTTTTTTTTTAATTTTTCCCATTTTTTAACATCTTAATATTTTTCTTTT\n+TCTTTTTTAGACACTCACCATCATAGATAATTATCCTAAAACTTAATGTTTGTAAATAAATCACAAATAA\n+TTTAATAAAAAATGAACATATATTATAATATTTGTATAAATAATCAATTATCGGTTTTTCATATTACTAA\n+TAACTTAAATATATTAAGATTAATCATTTTTTAAGATATCACTTTATTAATTAGCTATTTTTGTCTAGAA\n+TGAGAGGGTATTTTGAATTAATAGTAAAAAATTATTGAGGAAATTTAAATGACTAGACTTATTGAGTTTA\n+AGAATGTGAACAAGGAGTATAAATCTGGAGATTACATTTTAAAAGCTATGGATAATGTGAACTTTACAAT\n+AGATGAAGGAGAGTTTGTAGTAATTCTTGGACCTTCAGGTGCAGGTAAGTCCACCCTTCTAAACCTTTTA\n+GGAGGCCTTGATTCAGTTAGCTCAGGTGAAATAATCGTAAATGGCAGTCATATTGAATCATTCGATGACG\n+ATCAGCTTACAAACTATAGAGCCCGTAATGTAGGCTTTGTTTTCCAGTTCTATAACCTTATTCCTAACTT\n+GACAGCCTTGGAAAACATTGAATTGATGAAGGACGTTGTTGATTTTGACATCAATGGATTGGCTGTATTG\n+GATGCTGTTGGGCTAAAGGATCATGCCGATCATTTTCCAGCACAATTGTCCGGTGGAGAGCAACAAAGGG\n+TGTCAATTGCAAGGGCAATTGCTAAGAGACCTAGTATGCTTTTGTGTGATGAGCCAACAGGAGCTCTTGA\n+TTCAAAAACAGGGGCTTTGATATTGGCTTTGCTTCAGGACATGTGCGAAAAGCTCAATACAACTGTTGTC\n+ATAGTTACTCATAATGCAATTCTATCAGAAGCTGCCAATAAGGTTATTAGGATAAAGAATGGACAGATTG\n+AAAGTGTAATTGTAAATGAGATGCCTAAAAAGGTCTCTGAATTAGAATTGTGATTTTTATACTTTTAACT\n+AGAAAGAAATCATGATTAAAAGTGCTTATGAATAATTTATTTGATTTATTTGATGATTTATTATTATTTT\n+TATTGTAGTTAGTTTGGTATAAGCCGTAAATGTTTCTTGATTGGGATTTGTGATTATATGCTTAAAAGAA\n+AGATGCTAAGAGATATTTGGAATTATAAAGTTCAATTTATATCCATTTTCATAATTGCATTCATAGGCGT\n+ATTTGTATTTGCCGGACTGACTGCAGAGGCAGATGGTTTTGAAGCCTCCATAGACTCATTTTACCAGAGG\n+AGCAATTTAGCTGACGGATGGATATACTCAAACTATCTTGTTGATGACTTTCTAAAGCAGGTCTACTTGC\n+TTGGCGCAACCACTAGTATGGAGAGACAGTTGGTTGTAGATTCCCAAGCTGAATTAGATGGCAAGCCCGA\n+TATTACGCTGCATTTTGTTGAAAACAACACCATATCTAAATATTATCCTCTTGAAGGCAATGAATTAAAT\n+ATAAGCGATTCTGAAGGTGTATGGTTAGATAAAACTTTCGCTGATGCTCGAAATCTGAAGATAGGGGACA\n+CCATTGCATTTGAAAGCAATGGAATTAAAATAGAAAAGAAGATTAGGGGATTAGGCTATTCTCCAGAGAA\n+TGTTTATAGCTTAGTTCCCACTCAAACAGTTCCAAATTATACGGCAAGGGGCTTTGCTTATATGTCCTAT\n+AAGGCATTTCCATCAGACAATATAACTTATAATGTTCTTAATGTTAAGTTTGATGGACGCCCTGAAATCT\n+TCTCAGAGCTATTGTCCTATCGTTTAGATGGATATTATGAATTGTATCTGCCCCAATCAAATCAATATAG\n+CGTAAATGCGGTTTCAGATTCAATCGCTCATCAAAGTTCATTAAACGCTGTTTTCCCAATTCTTTTCACT\n+TTGATTTCAATGCTGATGCTTTCAGTGACTATGAAAAGAATCATCTCTAATCAAAGAACTCAAATCGGTG\n+TTCTTAAGGCTAATGGATTTAGCAATAGGTCAATAGCTATCCATTATATGTCCTTTGGCTTTTTATTAGT\n+CACATCAGGGTCAATATTAGGTGCAATTTTAGGGCCGATCGTATTCCATTTCGTTGTTCATGAATCCAGA\n+ATTTATTATTTTAAGTTCCCTGTTTGGGCTTATGTGGGACTTGAGAGATTCATATTTGTAATTGTTATAA\n+TATCATTGATTTCACTTATTGTTTCATATCTTTCAATTAAAAGCATTGTCAATGAGCCTCCATCTCAAAT\n+AATAAAGCCTAAGCCTCCAAAAATGGTCAGTTCTGGTTTCATTGAAAAGCTAGCAATCTGGAAAAGGCTT\n+TCATTTAACATAAGGTGGAATTATAGGGATATCAAAAGAAACAGGTTCAAATCACTAATGACAATCGTTG\n+GCGTGATGGGATGC'..b'GAGAGAATTCCAACATTCTGATTATTCCCTT\n+AACTTCGAAAGCAGAAGAATCAAGTCAATTGCAAGAAACGAATGCAGAGACTATCAATCTGATGTATGGA\n+GTCATATAAGCGATCTTGAAGACAGACATTCCTTTAGATCAAGGACAAGCTCAATGAACGACAATTACGA\n+GCATTCTAAAACCGCTCAAGATGACTATATAAAGAATTTAATGATTGCAGATGGAGCTAATGGTCTCATT\n+TGCTTTATAAACGGTGAATTTAAGGGATTAGAGTTATTCTATAATCATAGCATCTATAAGGAATATTATG\n+AAAAGACATTAAGAAGCTATATTATTGAAGCCATTTCTTATGGAGGAAATAATACAGTTGGCGAAGAATT\n+ATTTAGAGTGATTAATGGTGAAATGAATGATTTATCTTCATCTGAATTTATAGAATATGAAACCGTTGGC\n+CTTGGAAAGAATATAAGATTCGCAACTAAAGGAGGATCAGGTTCTGGCCTTATATTTGAAGATGAATTAG\n+TTCATATGACTTACTTCAAAGAGGATTCCAATAAAAACTATGAAATTTTATAGATTTAGACTTTTCTAAA\n+TCTAATTTCTCTTTTTTTTAAAAAAATTGGATTTAATATGATAAACTCGTTTTAGATAAGAATAAGATTT\n+TTTACTTATTAAAGCATTAAAAGAATTAAATCCATAAATACAAACATGAAGAATATTGTAACTAAAAATA\n+TGGTCAGTCTTGCTAGATCCACTGCCTTTTCAATGCAATCAACATTTATTGGATTTATATTATCCCCTAA\n+GGTATAAACTCCTTCCTTTTCTAGCTGAATGTTTAATGCTCCAGCTACTGTTGCCATCGTATATCCTGAA\n+TTAGGACTGTCACAATTGTTTGCATCCCTTCTCATAATAAACAATGCATTTTTCCAATTTAAACGTAGAA\n+ACATAGCAGATACAACAATCAAAGCTCCAGAAAACCTTGCAGGTATGTAATTTAAAGCATCATCCAAATG\n+CGCTGGAATAAAACCGATATTGTAGAGTTCCTTAGTCTTGTATCCTACCATGGAATCCATTGTATCAACA\n+ACCCTATGGATAAATGCAGCAAGAACAGCAAGTATTATGACATCAAAGTCTCCAATTCCACATAGGCTAG\n+CTATTATTCCAACAATTGAATAGTAGAATACAGTTGAAACATAGGAGTCAGGTATGTTTTCACTTAGAGT\n+CTCTATTACAGCGGATATGACATGCTCCTTATTCAATTCATTAGTGTCACGGCTAACCAGATAGCTAACG\n+GCCTGACGTGCCTTATTTAAGTTATTGTTCCTTAAGTCCTTTTCAACATCACGGGCAGAATCCAACAACA\n+GCTTGACTGAAAATGTTGAAGTAAGAAGCAAAATCGCTATCAGCTTGAATAGATAAATCATCATATCATT\n+ATATGGCAATAGATACCTTGCTATAGCCATTGGAATTAGAACAATAAGTGATGAAACAATTATTACAGCA\n+ATTGAGAGAATCAATCCAGCTATCTTATTGTCGTATTTGATTAGGATATTCTTAAAAAAGCTTATTATTT\n+TTCCAATCCATACTACAGGATGTATCTGCATTGGAAACTCACCTAGAAGAAGATCTACTGCAAGTGAAAA\n+TAGCAAGATTGTAAGTAACATATAAATTGAATTGGAGTAAAGTTCAGTTATCATTAAAATTAAATATATT\n+AGGAAACTATATATAATTTATTGATAAGTAAAAATTTTTATTCATCAAAACTTAAAAAGAAAATATAATG\n+GTGAATTAAAAATAAAATGAATTGATCATTAATTGATTAATTCATTAAATAATAAAAAAAAAAATTATTT\n+TTAAAATTAGACAAAATGTCTAAATTAATGAACTAATTATTCAAAACGTGATAATATGGCTGTAATAGAT\n+GAAGAACAAGTAAGAGAATGGTTAATGGAAGAAGACATGATTAGAGAAAAGATTTATGATGAAAATGCTA\n+ATTTCCATTATATTATCAATTTCCCAAATAACAATGCAATGGATGTAATTCAGCCTAGAACAAAAGAAGA\n+CGTTCTCCTTATAGGCTGTGCAACAGAAGTCTCACAAGTAGAGCAAGACATGATAAAAAACACTGATAAG\n+GCAATAAATCAGGAGTTTATATGGAACGTAAGATTTGCCTTAAACGAAATGCTTCTAGACTTTGAGTTGG\n+AACATCCGGATGATCAATTGAAACGTTTTATCATAACTGAAGACATATTTTCTGATGGGCTTACAAAACA\n+TGTCCTTGTTAAATCAATTAAAAAGGTATTTAAAGCAAAATTACAATGTATTTGGTTGTTAGGTAAAACA\n+TATGGAACAGTCCAGATGAAAAAAGAATAAATATCTTTATATTTTTTTATATTCATTTTTTTTTTTATTT\n+TTATTTTTATTTATTTTATTATTAGCTTTTTTTTAATTTTGATTATTATCTAATCTATATATCGATTTTA\n+TATATTATTTTATATTTACATTATTTTATTAATCTATTATTTTATTATTAAATTTATTTGTTTATTTTAT\n+TTCTGTTTTTAATATTTGTTTCAAATGTTTTTTCATTGATTAATTTTGATGAAATTCAAGGATCTTATGT\n+TTAATTTGATGATATTTTTTATTGATTTTAGTATTACTTTTCATGTTTCATTCATCCTGGAAAAATAGTG\n+AAATTTTGGCAATTTTTTGTAAATTTTTTGGTGAAAATTGGTGATTTTTAGAGTGAGAGAGGTATGTTTC\n+CAGTGAAACGCAAACGAAGGTCTTGAAAAGTTAGACAGGTCTATTTCCACTGTAACTTTTTGAAATTGAC\n+CTCTCTATAATTTTTGAAAAATTTTGATAAAAAACCTTTTAAAAATGCTTTATTTAACGATTTAAGCTCG\n+TAAAAATGTTTATTAAATTTCGTTAAATTTTTTTGTTTAAGTTTTACACTTGAAATAAATCCCTTCATTT\n+TCGTTTCTTGCATATTTTTATTTCACTTGAAACGCACCTCTCTCTCAGAAAATTCTTTTAATCTATAATT\n+TTTTGGTTCAAATTTTCATATTTATCATTGTTTTTTAATTTTGATGGTCAAATTCATTTATTTTTTATTT\n+ATTTATGTTATTTTTTATTATTTTTTAAAAATATCATATTTATTTTCGATTTATATATTTTCTGACTTAA\n+AAAAGTTTTAATTTTTAAAAAGACATCAATTTCGACTGTAAAATTATTTTAAAAAATATTTTATTAAAGT\n+TTTACACTTGAAATGGTACTCTCTCTTATTTGTTTTGTTTAATAAGAACGTTCTTATGTTATAAAACAAT\n+AATAAACTTTAAATATTTCAAGAAATAAATTATAGAAATACAGTTGAAATTTTACTATTGTAGATGAAAA\n+TTTTTACATAATTTTTATTACTTTTAGATCATGAAAAGTAAATGGAATTTTTTGGCACATTTCTTATGAC\n+TTTCATGACTTCATATGAAAATTAATTTACTAATTTTTTATAATTACAATTTTAATATTTTAATTGAATT\n+GCATTGCTAGCATCAAATTTAATTAAAATATAAATTTAGTTGAATCTATATTAGATTTTAGTTCATTCTT\n+GGGAAAAATATAAATGTTCTGATTTCTGGATTTGTTCTGGATTTTAGTTTGTTCTGAGATTTGTTCTAAA\n+TTAAGATCTATTTAGATTTGTTTTTACTTTGATAATTTATCAATTAATAAAGAATTACATAAGTTTTTAT\n+AAGTTCATTAAAAAAAACTTTATGATAATTTATGATTCTTTATGGTATTTTTTGGTACTTTTTGGTACTT\n+TTTGGTACTTTTTGGTACTTTATGATAACTTTATGATTATAACTATACTTTTTAAGCTATGTGAGATGAA\n+ACT\n+\n' |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd test-data/cmsearch_input2_mrum_genome.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmsearch_input2_mrum_genome.fa Sat Jan 21 17:36:57 2017 -0500 |
| b |
| b'@@ -0,0 +1,41963 @@\n+>NC_013790.1 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ATGACTAATATTTTTGAGGATTTACAGGAAGAAAGCGTGGGAGTGAGTATTTTTAAAGATAAAAAACCTT\n+TAGATCATCGTTTTTTACCTGAAAATTTGCCTCATAGAAAGAAACAGATTACTGAAATTGCTAAACATTG\n+GATTGAAGCATTAAATGGAAACACCCCTTCAAACATTACAATTTATGGTAAGACAGGAACTGGAAAGACT\n+GCTGCTGCTAAATTCGCTAAAGAGCAGCTTATTGAAGCATCTAGAGATAAAAATGTCTTCATTAAAGTCG\n+AATATATCAGATGTACAGACTTCACTACAGAATACCAGGTCCTTACCTATCTTTGTCAAAGGCTAGGCCG\n+TGATGTTCCTAACCGTGGATGGACCAAGGGGGAGATTGTAAACACCTTTAGAGACATTTTAAGAAGAAAT\n+GCCTTTGGCAGAAATCTTATTTTAATTGTCATTTTAGATGAGATCGATATTCTTCTTGAAAAGGACGGCG\n+ACGGAATCTTATACACCCTTACAAGAACTGATAATATTGCCATTCTTTCAATAAGTAATTATCTTGACTT\n+TAAGCAATTCATTAAGCCAAGGGTTGCAAGCAGCTTAAGGGATAAAGAAATAGTGTTCCCGCCTTATGAT\n+GCAGAGCAATTAGCTGATATTTTACATGAACGTTCTGAATTGGCATTTGAAGAAAATACACTTGAAGAAA\n+GCGTTATTCCATTATGTTCAGCTATGGCTGCTAAGGAAGAAGGTGATGCAAGATATGCTCTTGACCTATT\n+GGAGAACGCTGGAGACATTGCTGTTGAAGAAGGATCTGAAATCGTTAAGGGAAAATATGTGCGTCAAGCT\n+AAGGATGTCATTGAGTATAATAAGGTTAAAGACGTTATTATTACACTTCCAACCCAACAGCAAAGGGTTC\n+TTGCAGCTATAATGAAATTAACTCAAGACAATGAGGAAATCACTTCAGGTAAGCTCTTTGAAGTCTATAA\n+AGATATTTCTAAAGGAGACAGTGTTACCTATAGAAGAATCTTTGATTTCATTAACGAATTGGAGATGTTA\n+GGAATTATCTCTACCAACACCATATCCAGGGGCAGAGGTAAAGGCAGGACCAATATTATTAAGTTGCAGA\n+CTGATTCTAAGTTGATTCAAGATAACTTATCTGCTGTTCTTTATTAGATAGATTCCTTATAATCTGGTAT\n+AATACTTATTTTGATTTTTTTTTATTATATCAGGTTTTTTCTTTTTTTTTAATTATTTTTTCTTATTATT\n+TTTGTTTTTCTTTTTTTTGGATGATTTTCATCTTTTTTTGTTTTTTATTGTTTTTGTGTGGTTTTCAATT\n+TGTATTCTTTTCTTTTTTTGTTTTTTTTTTTAATTTTTCCCATTTTTTAACATCTTAATATTTTTCTTTT\n+TCTTTTTTAGACACTCACCATCATAGATAATTATCCTAAAACTTAATGTTTGTAAATAAATCACAAATAA\n+TTTAATAAAAAATGAACATATATTATAATATTTGTATAAATAATCAATTATCGGTTTTTCATATTACTAA\n+TAACTTAAATATATTAAGATTAATCATTTTTTAAGATATCACTTTATTAATTAGCTATTTTTGTCTAGAA\n+TGAGAGGGTATTTTGAATTAATAGTAAAAAATTATTGAGGAAATTTAAATGACTAGACTTATTGAGTTTA\n+AGAATGTGAACAAGGAGTATAAATCTGGAGATTACATTTTAAAAGCTATGGATAATGTGAACTTTACAAT\n+AGATGAAGGAGAGTTTGTAGTAATTCTTGGACCTTCAGGTGCAGGTAAGTCCACCCTTCTAAACCTTTTA\n+GGAGGCCTTGATTCAGTTAGCTCAGGTGAAATAATCGTAAATGGCAGTCATATTGAATCATTCGATGACG\n+ATCAGCTTACAAACTATAGAGCCCGTAATGTAGGCTTTGTTTTCCAGTTCTATAACCTTATTCCTAACTT\n+GACAGCCTTGGAAAACATTGAATTGATGAAGGACGTTGTTGATTTTGACATCAATGGATTGGCTGTATTG\n+GATGCTGTTGGGCTAAAGGATCATGCCGATCATTTTCCAGCACAATTGTCCGGTGGAGAGCAACAAAGGG\n+TGTCAATTGCAAGGGCAATTGCTAAGAGACCTAGTATGCTTTTGTGTGATGAGCCAACAGGAGCTCTTGA\n+TTCAAAAACAGGGGCTTTGATATTGGCTTTGCTTCAGGACATGTGCGAAAAGCTCAATACAACTGTTGTC\n+ATAGTTACTCATAATGCAATTCTATCAGAAGCTGCCAATAAGGTTATTAGGATAAAGAATGGACAGATTG\n+AAAGTGTAATTGTAAATGAGATGCCTAAAAAGGTCTCTGAATTAGAATTGTGATTTTTATACTTTTAACT\n+AGAAAGAAATCATGATTAAAAGTGCTTATGAATAATTTATTTGATTTATTTGATGATTTATTATTATTTT\n+TATTGTAGTTAGTTTGGTATAAGCCGTAAATGTTTCTTGATTGGGATTTGTGATTATATGCTTAAAAGAA\n+AGATGCTAAGAGATATTTGGAATTATAAAGTTCAATTTATATCCATTTTCATAATTGCATTCATAGGCGT\n+ATTTGTATTTGCCGGACTGACTGCAGAGGCAGATGGTTTTGAAGCCTCCATAGACTCATTTTACCAGAGG\n+AGCAATTTAGCTGACGGATGGATATACTCAAACTATCTTGTTGATGACTTTCTAAAGCAGGTCTACTTGC\n+TTGGCGCAACCACTAGTATGGAGAGACAGTTGGTTGTAGATTCCCAAGCTGAATTAGATGGCAAGCCCGA\n+TATTACGCTGCATTTTGTTGAAAACAACACCATATCTAAATATTATCCTCTTGAAGGCAATGAATTAAAT\n+ATAAGCGATTCTGAAGGTGTATGGTTAGATAAAACTTTCGCTGATGCTCGAAATCTGAAGATAGGGGACA\n+CCATTGCATTTGAAAGCAATGGAATTAAAATAGAAAAGAAGATTAGGGGATTAGGCTATTCTCCAGAGAA\n+TGTTTATAGCTTAGTTCCCACTCAAACAGTTCCAAATTATACGGCAAGGGGCTTTGCTTATATGTCCTAT\n+AAGGCATTTCCATCAGACAATATAACTTATAATGTTCTTAATGTTAAGTTTGATGGACGCCCTGAAATCT\n+TCTCAGAGCTATTGTCCTATCGTTTAGATGGATATTATGAATTGTATCTGCCCCAATCAAATCAATATAG\n+CGTAAATGCGGTTTCAGATTCAATCGCTCATCAAAGTTCATTAAACGCTGTTTTCCCAATTCTTTTCACT\n+TTGATTTCAATGCTGATGCTTTCAGTGACTATGAAAAGAATCATCTCTAATCAAAGAACTCAAATCGGTG\n+TTCTTAAGGCTAATGGATTTAGCAATAGGTCAATAGCTATCCATTATATGTCCTTTGGCTTTTTATTAGT\n+CACATCAGGGTCAATATTAGGTGCAATTTTAGGGCCGATCGTATTCCATTTCGTTGTTCATGAATCCAGA\n+ATTTATTATTTTAAGTTCCCTGTTTGGGCTTATGTGGGACTTGAGAGATTCATATTTGTAATTGTTATAA\n+TATCATTGATTTCACTTATTGTTTCATATCTTTCAATTAAAAGCATTGTCAATGAGCCTCCATCTCAAAT\n+AATAAAGCCTAAGCCTCCAAAAATGGTCAGTTCTGGTTTCATTGAAAAGCTAGCAATCTGGAAAAGGCTT\n+TCATTTAACATAAGGTGGAATTATAGGGATATCAAAAGAAACAGGTTCAAATCACTAATGACAATCGTTG\n+GCGTGATGGGATGC'..b'GAGAGAATTCCAACATTCTGATTATTCCCTT\n+AACTTCGAAAGCAGAAGAATCAAGTCAATTGCAAGAAACGAATGCAGAGACTATCAATCTGATGTATGGA\n+GTCATATAAGCGATCTTGAAGACAGACATTCCTTTAGATCAAGGACAAGCTCAATGAACGACAATTACGA\n+GCATTCTAAAACCGCTCAAGATGACTATATAAAGAATTTAATGATTGCAGATGGAGCTAATGGTCTCATT\n+TGCTTTATAAACGGTGAATTTAAGGGATTAGAGTTATTCTATAATCATAGCATCTATAAGGAATATTATG\n+AAAAGACATTAAGAAGCTATATTATTGAAGCCATTTCTTATGGAGGAAATAATACAGTTGGCGAAGAATT\n+ATTTAGAGTGATTAATGGTGAAATGAATGATTTATCTTCATCTGAATTTATAGAATATGAAACCGTTGGC\n+CTTGGAAAGAATATAAGATTCGCAACTAAAGGAGGATCAGGTTCTGGCCTTATATTTGAAGATGAATTAG\n+TTCATATGACTTACTTCAAAGAGGATTCCAATAAAAACTATGAAATTTTATAGATTTAGACTTTTCTAAA\n+TCTAATTTCTCTTTTTTTTAAAAAAATTGGATTTAATATGATAAACTCGTTTTAGATAAGAATAAGATTT\n+TTTACTTATTAAAGCATTAAAAGAATTAAATCCATAAATACAAACATGAAGAATATTGTAACTAAAAATA\n+TGGTCAGTCTTGCTAGATCCACTGCCTTTTCAATGCAATCAACATTTATTGGATTTATATTATCCCCTAA\n+GGTATAAACTCCTTCCTTTTCTAGCTGAATGTTTAATGCTCCAGCTACTGTTGCCATCGTATATCCTGAA\n+TTAGGACTGTCACAATTGTTTGCATCCCTTCTCATAATAAACAATGCATTTTTCCAATTTAAACGTAGAA\n+ACATAGCAGATACAACAATCAAAGCTCCAGAAAACCTTGCAGGTATGTAATTTAAAGCATCATCCAAATG\n+CGCTGGAATAAAACCGATATTGTAGAGTTCCTTAGTCTTGTATCCTACCATGGAATCCATTGTATCAACA\n+ACCCTATGGATAAATGCAGCAAGAACAGCAAGTATTATGACATCAAAGTCTCCAATTCCACATAGGCTAG\n+CTATTATTCCAACAATTGAATAGTAGAATACAGTTGAAACATAGGAGTCAGGTATGTTTTCACTTAGAGT\n+CTCTATTACAGCGGATATGACATGCTCCTTATTCAATTCATTAGTGTCACGGCTAACCAGATAGCTAACG\n+GCCTGACGTGCCTTATTTAAGTTATTGTTCCTTAAGTCCTTTTCAACATCACGGGCAGAATCCAACAACA\n+GCTTGACTGAAAATGTTGAAGTAAGAAGCAAAATCGCTATCAGCTTGAATAGATAAATCATCATATCATT\n+ATATGGCAATAGATACCTTGCTATAGCCATTGGAATTAGAACAATAAGTGATGAAACAATTATTACAGCA\n+ATTGAGAGAATCAATCCAGCTATCTTATTGTCGTATTTGATTAGGATATTCTTAAAAAAGCTTATTATTT\n+TTCCAATCCATACTACAGGATGTATCTGCATTGGAAACTCACCTAGAAGAAGATCTACTGCAAGTGAAAA\n+TAGCAAGATTGTAAGTAACATATAAATTGAATTGGAGTAAAGTTCAGTTATCATTAAAATTAAATATATT\n+AGGAAACTATATATAATTTATTGATAAGTAAAAATTTTTATTCATCAAAACTTAAAAAGAAAATATAATG\n+GTGAATTAAAAATAAAATGAATTGATCATTAATTGATTAATTCATTAAATAATAAAAAAAAAAATTATTT\n+TTAAAATTAGACAAAATGTCTAAATTAATGAACTAATTATTCAAAACGTGATAATATGGCTGTAATAGAT\n+GAAGAACAAGTAAGAGAATGGTTAATGGAAGAAGACATGATTAGAGAAAAGATTTATGATGAAAATGCTA\n+ATTTCCATTATATTATCAATTTCCCAAATAACAATGCAATGGATGTAATTCAGCCTAGAACAAAAGAAGA\n+CGTTCTCCTTATAGGCTGTGCAACAGAAGTCTCACAAGTAGAGCAAGACATGATAAAAAACACTGATAAG\n+GCAATAAATCAGGAGTTTATATGGAACGTAAGATTTGCCTTAAACGAAATGCTTCTAGACTTTGAGTTGG\n+AACATCCGGATGATCAATTGAAACGTTTTATCATAACTGAAGACATATTTTCTGATGGGCTTACAAAACA\n+TGTCCTTGTTAAATCAATTAAAAAGGTATTTAAAGCAAAATTACAATGTATTTGGTTGTTAGGTAAAACA\n+TATGGAACAGTCCAGATGAAAAAAGAATAAATATCTTTATATTTTTTTATATTCATTTTTTTTTTTATTT\n+TTATTTTTATTTATTTTATTATTAGCTTTTTTTTAATTTTGATTATTATCTAATCTATATATCGATTTTA\n+TATATTATTTTATATTTACATTATTTTATTAATCTATTATTTTATTATTAAATTTATTTGTTTATTTTAT\n+TTCTGTTTTTAATATTTGTTTCAAATGTTTTTTCATTGATTAATTTTGATGAAATTCAAGGATCTTATGT\n+TTAATTTGATGATATTTTTTATTGATTTTAGTATTACTTTTCATGTTTCATTCATCCTGGAAAAATAGTG\n+AAATTTTGGCAATTTTTTGTAAATTTTTTGGTGAAAATTGGTGATTTTTAGAGTGAGAGAGGTATGTTTC\n+CAGTGAAACGCAAACGAAGGTCTTGAAAAGTTAGACAGGTCTATTTCCACTGTAACTTTTTGAAATTGAC\n+CTCTCTATAATTTTTGAAAAATTTTGATAAAAAACCTTTTAAAAATGCTTTATTTAACGATTTAAGCTCG\n+TAAAAATGTTTATTAAATTTCGTTAAATTTTTTTGTTTAAGTTTTACACTTGAAATAAATCCCTTCATTT\n+TCGTTTCTTGCATATTTTTATTTCACTTGAAACGCACCTCTCTCTCAGAAAATTCTTTTAATCTATAATT\n+TTTTGGTTCAAATTTTCATATTTATCATTGTTTTTTAATTTTGATGGTCAAATTCATTTATTTTTTATTT\n+ATTTATGTTATTTTTTATTATTTTTTAAAAATATCATATTTATTTTCGATTTATATATTTTCTGACTTAA\n+AAAAGTTTTAATTTTTAAAAAGACATCAATTTCGACTGTAAAATTATTTTAAAAAATATTTTATTAAAGT\n+TTTACACTTGAAATGGTACTCTCTCTTATTTGTTTTGTTTAATAAGAACGTTCTTATGTTATAAAACAAT\n+AATAAACTTTAAATATTTCAAGAAATAAATTATAGAAATACAGTTGAAATTTTACTATTGTAGATGAAAA\n+TTTTTACATAATTTTTATTACTTTTAGATCATGAAAAGTAAATGGAATTTTTTGGCACATTTCTTATGAC\n+TTTCATGACTTCATATGAAAATTAATTTACTAATTTTTTATAATTACAATTTTAATATTTTAATTGAATT\n+GCATTGCTAGCATCAAATTTAATTAAAATATAAATTTAGTTGAATCTATATTAGATTTTAGTTCATTCTT\n+GGGAAAAATATAAATGTTCTGATTTCTGGATTTGTTCTGGATTTTAGTTTGTTCTGAGATTTGTTCTAAA\n+TTAAGATCTATTTAGATTTGTTTTTACTTTGATAATTTATCAATTAATAAAGAATTACATAAGTTTTTAT\n+AAGTTCATTAAAAAAAACTTTATGATAATTTATGATTCTTTATGGTATTTTTTGGTACTTTTTGGTACTT\n+TTTGGTACTTTTTGGTACTTTATGATAACTTTATGATTATAACTATACTTTTTAAGCTATGTGAGATGAA\n+ACT\n+\n' |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd test-data/cmsearch_result.tabular --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmsearch_result.tabular Sat Jan 21 17:36:57 2017 -0500 |
| b |
| @@ -0,0 +1,56 @@ +NC_013790.1 - tRNA5 - cm 1 72 362026 361955 - no 1 0.50 0.0 71.5 1.3e-18 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2585265 2585193 - no 1 0.60 0.0 70.2 3.3e-18 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 762490 762562 + no 1 0.67 0.0 68.8 9e-18 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2041704 2041632 - no 1 0.67 0.0 68.8 9e-18 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2351254 2351181 - no 1 0.62 0.0 67.4 2.5e-17 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 735136 735208 + no 1 0.59 0.0 67.2 3e-17 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2186013 2185941 - no 1 0.53 0.0 66.4 5.2e-17 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2350593 2350520 - no 1 0.66 0.0 64.8 1.6e-16 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2585187 2585114 - no 1 0.59 0.0 64.1 2.8e-16 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 662185 662259 + no 1 0.61 0.0 62.5 9.1e-16 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 360887 360815 - no 1 0.55 0.0 62.1 1.2e-15 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2350984 2350911 - no 1 0.53 0.0 61.7 1.6e-15 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2186090 2186019 - no 1 0.54 0.0 60.7 3.3e-15 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2680159 2680233 + no 1 0.67 0.0 60.4 4.1e-15 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2749945 2749874 - no 1 0.53 0.0 59.5 7.9e-15 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2749839 2749768 - no 1 0.53 0.0 59.5 7.9e-15 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 361676 361604 - no 1 0.51 0.0 59.2 9.8e-15 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2585073 2584999 - no 1 0.60 0.0 59.2 1e-14 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2130422 2130349 - no 1 0.59 0.0 59.1 1.1e-14 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 546056 545947 - no 1 0.61 0.0 58.9 1.2e-14 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 361915 361844 - no 1 0.42 0.0 57.3 3.9e-14 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 97724 97795 + no 1 0.49 0.0 57.0 5.1e-14 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2350717 2350646 - no 1 0.68 0.0 56.7 6.1e-14 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 1873887 1873815 - no 1 0.64 0.0 56.3 8e-14 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 360730 360659 - no 1 0.40 0.0 55.6 1.4e-13 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2680310 2680384 + no 1 0.52 0.0 54.3 3.5e-13 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2664806 2664732 - no 1 0.60 0.0 54.3 3.6e-13 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 361061 360989 - no 1 0.41 0.0 54.3 3.6e-13 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2130335 2130262 - no 1 0.55 0.0 53.3 7.5e-13 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2151672 2151745 + no 1 0.65 0.0 53.3 7.6e-13 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 319297 319370 + no 1 0.62 0.0 51.4 2.9e-12 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 361753 361679 - no 1 0.55 0.0 51.1 3.7e-12 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 360983 360912 - no 1 0.50 0.0 51.1 3.8e-12 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 361456 361383 - no 1 0.50 0.0 50.5 5.9e-12 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 362798 362727 - no 1 0.51 0.0 50.1 7.4e-12 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 917722 917793 + no 1 0.61 0.0 49.9 8.7e-12 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2583869 2583798 - no 1 0.51 0.0 49.7 1.1e-11 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 362324 362252 - no 1 0.51 0.0 49.4 1.3e-11 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 360811 360740 - no 1 0.42 0.0 49.3 1.3e-11 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 1160526 1160609 + no 1 0.60 0.0 47.7 4.3e-11 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 362403 362331 - no 1 0.49 0.0 46.6 9.8e-11 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2327124 2327042 - no 1 0.63 0.0 46.5 1.1e-10 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 995344 995263 - no 1 0.49 0.0 46.4 1.2e-10 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 256772 256696 - no 1 0.57 0.0 45.5 2.3e-10 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2584830 2584758 - no 1 0.64 0.0 45.3 2.5e-10 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2351071 2350997 - no 1 0.59 0.0 44.1 6.1e-10 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 362552 362482 - no 1 0.55 0.0 44.0 6.5e-10 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 1064775 1064858 + no 1 0.63 0.0 41.2 5.2e-09 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 361222 361150 - no 1 0.45 0.0 40.0 1.2e-08 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 361369 361297 - no 1 0.60 0.0 40.0 1.2e-08 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 361596 361513 - no 1 0.61 0.0 38.1 4.8e-08 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 1913310 1913227 - no 1 0.64 0.0 35.5 3.2e-07 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 363464 363381 - no 1 0.51 0.0 32.7 2.6e-06 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 2584954 2584872 - no 1 0.58 0.0 32.5 3e-06 ! Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 363803 363716 - no 1 0.50 0.0 20.0 0.027 ? Methanobrevibacter ruminantium M1 chromosome, complete genome +NC_013790.1 - tRNA5 - cm 1 72 984373 984304 - no 1 0.53 0.0 13.4 3.4 ? Methanobrevibacter ruminantium M1 chromosome, complete genome |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd test-data/cmsearch_result_tRNA5_mrum.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmsearch_result_tRNA5_mrum.out Sat Jan 21 17:36:57 2017 -0500 |
| [ |
| b'@@ -0,0 +1,767 @@\n+# cmsearch :: search CM(s) against a sequence database\n+# INFERNAL 1.1 (June 2012)\n+# Copyright (C) 2012 Howard Hughes Medical Institute.\n+# Freely distributed under the GNU General Public License (GPLv3).\n+# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -\n+# query CM file: tRNA5.c.cm\n+# target sequence database: mrum-genome.fa\n+# number of worker threads: 2\n+# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -\n+\n+Query: tRNA5 [CLEN=72]\n+Hit scores:\n+ rank E-value score bias sequence start end mdl trunc gc description\n+ ---- --------- ------ ----- ----------- ------- ------- --- ----- ---- -----------\n+ (1) ! 1.3e-18 71.5 0.0 NC_013790.1 362026 361955 - cm no 0.50 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (2) ! 3.3e-18 70.2 0.0 NC_013790.1 2585265 2585193 - cm no 0.60 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (3) ! 9e-18 68.8 0.0 NC_013790.1 762490 762562 + cm no 0.67 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (4) ! 9e-18 68.8 0.0 NC_013790.1 2041704 2041632 - cm no 0.67 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (5) ! 2.5e-17 67.4 0.0 NC_013790.1 2351254 2351181 - cm no 0.62 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (6) ! 3e-17 67.2 0.0 NC_013790.1 735136 735208 + cm no 0.59 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (7) ! 5.2e-17 66.4 0.0 NC_013790.1 2186013 2185941 - cm no 0.53 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (8) ! 1.6e-16 64.8 0.0 NC_013790.1 2350593 2350520 - cm no 0.66 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (9) ! 2.8e-16 64.1 0.0 NC_013790.1 2585187 2585114 - cm no 0.59 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (10) ! 9.1e-16 62.5 0.0 NC_013790.1 662185 662259 + cm no 0.61 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (11) ! 1.2e-15 62.1 0.0 NC_013790.1 360887 360815 - cm no 0.55 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (12) ! 1.6e-15 61.7 0.0 NC_013790.1 2350984 2350911 - cm no 0.53 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (13) ! 3.3e-15 60.7 0.0 NC_013790.1 2186090 2186019 - cm no 0.54 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (14) ! 4.1e-15 60.4 0.0 NC_013790.1 2680159 2680233 + cm no 0.67 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (15) ! 7.9e-15 59.5 0.0 NC_013790.1 2749839 2749768 - cm no 0.53 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (16) ! 7.9e-15 59.5 0.0 NC_013790.1 2749945 2749874 - cm no 0.53 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (17) ! 9.8e-15 59.2 0.0 NC_013790.1 361676 361604 - cm no 0.51 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (18) ! 1e-14 59.2 0.0 NC_013790.1 2585073 2584999 - cm no 0.60 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (19) ! 1.1e-14 59.1 0.0 NC_013790.1 2130422 2130349 - cm no 0.59 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (20) ! 1.2e-14 58.9 0.0 NC_013790.1 546056 545947 - cm no 0.61 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (21) ! 3.9e-14 57.3 0.0 NC_013790.1 361915 361844 - cm no 0.42 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (22) ! 5.1e-14 57.0 0.0 NC_013790.1 97724 97795 + cm no 0.49 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ (23) ! 6.1e-14 56.7 0.0 NC_013790.1 2350717 2350646 - cm no 0.68 Methanobrevibacter ruminantium M1 chromosome, complete genome'..b'.58\n+\n+ v v NC\n+ (((((((,,<<<<______.._>>>>,<<<<<_______>>>>>,,,,.........,<<<<<_______>>>>>))))))): CS\n+ tRNA5 1 gCcggcAUAGcgcAgUGGu..AgcgCgccagccUgucAagcuggAGgU.........CCgggGUUCGAUUCcccGUgccgGca 72 \n+ GC::G :U+ C: AG GG A :G G:CAG:CU++ +A:CUG: G+U CC:GGGUUCGA UCCC:G: C::GCA\n+ NC_013790.1 2584954 GCGAGGGUGUCCGAGAGGCcaAAGGAGACAGGCUUAGGACCUGUUGAUgcagaucuaCCAGGGUUCGAAUCCCUGCUCUCGCA 2584872\n+ ******************9999************************98888888888************************** PP\n+\n+>> NC_013790.1 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ rank E-value score bias mdl mdl from mdl to seq from seq to acc trunc gc\n+ ---- --------- ------ ----- --- -------- -------- ----------- ----------- ---- ----- ----\n+ (55) ? 0.027 20.0 0.0 cm 1 72 [] 363803 363716 - .. 0.71 no 0.50\n+\n+ vvvvv vvvvv NC\n+ (((((((,,<~~~~~~>,<<<<<_~~~~~~>>>>>,,,,,<<<<<_______>>>>>))))))): CS\n+ tRNA5 1 gCcggcAUAG*[13]*Cgccagcc*[ 6]*gcuggAGgUCCgggGUUCGAUUCcccGUgccgGca 72 \n+ ::C:G::UAG C +C + +UC::GGGUUC A UCCC::::C:G::A\n+ NC_013790.1 363803 AGCUGUGUAG*[22]*C---GGAC*[17]*-AGUCUCAUCAUGGGUUCAAAUCCCAUCGCAGCUA 363716\n+ ********96...5..3...3333...5...34456679************************** PP\n+\n+>> NC_013790.1 Methanobrevibacter ruminantium M1 chromosome, complete genome\n+ rank E-value score bias mdl mdl from mdl to seq from seq to acc trunc gc\n+ ---- --------- ------ ----- --- -------- -------- ----------- ----------- ---- ----- ----\n+ (56) ? 3.4 13.4 0.0 cm 1 72 [] 984373 984304 - .. 0.95 no 0.53\n+\n+ vvv vv vv vvv NC\n+ (((((((,,<<<<___..____>>>>,<<<<<_______>>>>>,,,,,<<<<<_______>>>>>))))))): CS\n+ tRNA5 1 gCcggcAUAGcgcAgU..GGuAgcgCgccagccUgucAagcuggAGgUCCgggGUUCGAUUCcccGUgccgGca 72 \n+ : ::GC U+:C:CA U GG AG:G:GC G:+U U AA:C G G CG: G UC A UC :CG :: :A\n+ NC_013790.1 984373 CUGAGCGUGGCUCACUauGGCAGAGUGCUUGGUUCUUAACCUUGUUG-UCGAGGGUCCAAUCUUCG---UCGGA 984304\n+ **************9999*****************************.899999999999999999...799** PP\n+\n+\n+\n+Internal CM pipeline statistics summary:\n+----------------------------------------\n+Query model(s): 1 (72 consensus positions)\n+Target sequences: 1 (5874406 residues searched)\n+Target sequences re-searched for truncated hits: 1 (360 residues re-searched)\n+Windows passing local HMM SSV filter: 11197 (0.2108); expected (0.35)\n+Windows passing local HMM Viterbi filter: (off)\n+Windows passing local HMM Viterbi bias filter: (off)\n+Windows passing local HMM Forward filter: 140 (0.002747); expected (0.005)\n+Windows passing local HMM Forward bias filter: 139 (0.002728); expected (0.005)\n+Windows passing glocal HMM Forward filter: 88 (0.001973); expected (0.005)\n+Windows passing glocal HMM Forward bias filter: 88 (0.001973); expected (0.005)\n+Envelopes passing glocal HMM envelope defn filter: 101 (0.001358); expected (0.005)\n+Envelopes passing local CM CYK filter: 60 (0.0007629); expected (0.0001)\n+Total CM hits reported: 56 (0.0007205); includes 0 truncated hit(s)\n+\n+# CPU time: 2.66u 0.04s 00:00:02.70 Elapsed: 00:00:01.77\n+//\n+[ok]\n' |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd test-data/cmstat_input.cm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmstat_input.cm Sat Jan 21 17:36:57 2017 -0500 |
| [ |
| b'@@ -0,0 +1,563 @@\n+INFERNAL1/a [1.1.1 | July 2014]\n+NAME tRNA5\n+STATES 230\n+NODES 61\n+CLEN 72\n+W 89\n+ALPH RNA\n+RF no\n+CONS yes\n+MAP yes\n+DATE Mon Jun 27 12:35:45 2016\n+COM [1] ./src/cmbuild tRNA5.cm tutorial/tRNA5.sto\n+COM [2] cmcalibrate tRNA5.cm\n+PBEGIN 0.05\n+PEND 0.05\n+WBETA 1e-07\n+QDBBETA1 1e-07\n+QDBBETA2 1e-15\n+N2OMEGA 1.52588e-05\n+N3OMEGA 1.52588e-05\n+ELSELF -0.08926734\n+NSEQ 5\n+EFFN 3.725586\n+CKSUM 3535941971\n+NULL 0.000 0.000 0.000 0.000 \n+EFP7GF -5.5288 0.72958\n+ECMLC 0.85563 -4.01853 2.43520 1600000 300168 0.003998\n+ECMGC 0.39437 -17.41037 -4.06685 1600000 77168 0.005183\n+ECMLI 0.73047 -3.70982 3.57712 1600000 245977 0.004879\n+ECMGI 0.44078 -12.13534 -0.86006 1600000 57603 0.006944\n+CM\n+ [ ROOT 0 ] - - - - - -\n+ S 0 -1 0 1 4 0 1 89 108 -7.419 -8.664 -0.055 -5.118 \n+ IL 1 1 2 1 4 3 28 90 110 -2.817 -4.319 -0.613 -2.698 0.000 0.000 0.000 0.000 \n+ IR 2 2 3 2 3 4 30 90 110 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 \n+ [ MATR 1 ] - 74 - a - -\n+ MR 3 2 3 5 5 4 32 89 108 -7.593 -0.028 -7.408 -7.620 -8.512 0.474 -1.199 0.305 -0.089 \n+ D 4 2 3 5 5 1 24 87 107 -5.352 -0.707 -2.978 -4.409 -2.404 \n+ IR 5 5 3 5 5 3 28 89 109 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 2 ] 1 73 g c - -\n+ MP 6 5 3 10 6 5 32 88 107 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.831 -2.997 -3.795 0.617 -3.618 -4.452 0.854 -3.918 -3.870 2.837 -4.276 -0.713 1.871 -3.843 -1.175 -2.703 \n+ ML 7 5 3 10 6 3 26 86 106 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 \n+ MR 8 5 3 10 6 3 25 86 106 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 \n+ D 9 5 3 10 6 0 21 84 103 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 \n+ IL 10 10 5 10 6 3 27 87 107 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 \n+ IR 11 11 6 11 5 3 27 87 107 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 3 ] 2 72 C G - -\n+ MP 12 11 6 16 6 5 31 86 105 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.097 -3.805 -3.998 0.021 -3.009 -4.646 3.103 -3.661 -3.977 1.529 -4.392 -1.585 0.835 -4.247 -0.625 -2.808 \n+ ML 13 11 6 16 6 2 25 84 104 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 \n+ MR 14 11 6 16 6 2 25 84 104 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 \n+ D 15 11 6 16 6 0 21 82 101 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 \n+ IL 16 16 5 16 6 3 27 85 105 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 \n+ IR 17 17 6 17 5 3 27 85 105 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 4 ] 3 71 c g - -\n+ MP 18 17 6 22 6 5 29 84 103 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.141 -2.880 -3.222 0.733 -2.762 -4.023 2.237 -3.232 -3.242 1.678 -3.747 0.537 1.616 -3.340 -0.447 -2.158 \n+ ML 19 '..b'1.46634 0.26236 1.09861 0.40547\n+ 51 1.62002 2.40165 0.60094 1.81254 53 G - - <\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 52 3.13623 4.03650 0.08313 3.98115 54 G - - <\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 53 3.41131 3.24840 3.95063 0.09549 55 U - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 54 3.41131 3.24840 3.95063 0.09549 56 U - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 55 3.81775 0.07857 4.34279 3.20425 57 C - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 56 1.55092 3.20619 0.37228 2.84263 58 G - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 57 0.06447 4.06946 3.72356 3.85378 59 A - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 58 2.58013 1.68600 3.11568 0.36438 60 U - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 59 2.39994 1.14144 2.97016 0.61874 61 U - - _\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 60 4.11656 0.10126 3.89068 2.82057 62 C - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 61 1.95700 0.67131 2.21870 1.43159 63 C - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 62 2.18076 0.86710 1.10730 1.99196 64 c - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 63 1.27825 1.21396 1.24116 1.99945 65 c - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 64 2.19639 2.68263 0.47103 1.62938 66 G - - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 65 1.68678 2.30864 2.17351 0.50798 67 U - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 66 1.21618 1.66846 0.95030 2.05201 68 g - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 67 2.09329 1.05549 1.48837 1.19416 69 c - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 68 2.26917 0.96322 1.25225 1.47369 70 c - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 69 1.53154 1.55221 1.02428 1.54664 71 g - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 70 2.18028 1.66521 0.48878 2.47139 72 G - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 71 1.37162 0.72882 2.04389 2.00766 73 c - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547\n+ 72 1.04988 2.29119 1.14633 1.46503 74 a - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01418 4.26268 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd test-data/cmstat_out.tabular --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmstat_out.tabular Sat Jan 21 17:36:57 2017 -0500 |
| b |
| @@ -0,0 +1,1 @@ + 1 tRNA5 - 5 3.73 72 89 21 2 cm 0.783 0.489 |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd test-data/metag-example.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/metag-example.fa Sat Jan 21 17:36:57 2017 -0500 |
| b |
| @@ -0,0 +1,86 @@ +>AAGA01015927.1 Metagenome sequence AHAI1002.g1, whole genome shotgun sequence +TTTCCCCATGGGTCAGAATTAATCAGAACGCAGAAGCGGTCTGATGAAACAGAATTTGCCTGGCGGCCGT +AGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGTGTGG +GGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATTAAGCAGTAAGCCGGTCATAAAACCGGTG +GTTGTAAAAGAATTCGGTGGAGCGGTAGTTCAGTCGGTTAGAATACCTGCCTGTCACGCAGGGGGTTGCG +GGTTCGAGTCCCGTCCGTTCCGCCACCCTAATTAGGGGCGTAGTTCAATTGGTAGAGCACCGGTCTCCAA +AACCGGGTGTTGGGAGTTCGAGTCTCTCCGCCCCTGCCAGAAATCATCCTTAGCGAAAGCTAAGGATTTT +TTTTATCTGAAATAACCCTCTCCGAAGTAAATCCTTCTACCGGCATCCTTGCCAGCCATTCATATTAATA +CACTTCATCCAGCACGTTAATTTTCAAAAGATCGCGAATCAACGCATTTTTATCGCTATTTTGCAGCCAT +ATGGCATAAAGCGGCCGTGAAAGTGTTGTGCTATCGACAACGGTATGCAGGCCGCCTTTTTTACGCGCCC +AGCTGACGGGTAGCCAGGTGCAACCATTAAGCATCGCAATCTGTTGCTGTGCCAGTTCAGCAGAACTGGT +TGTCAGAATGGGCACTTCGTCAGCACCGATCAAACCTGCCTCATGCTGTTGAAAATCTGGCCCCCACTCA +AGTCGCAGATAATTAAGATCTCCCTTTAGTTTTGAAGGGGCACTGGTATAAAGCGCTAAAGTGAAATATC +CCAGCAACTGACTACTAAATTCGTCCATTTTGGGCGCTTCAGTGGTAATAAAAAGATCAAGCTGGCGTTC +ATGCAGCTGTTTTACCAGAAACTGCCGTTGGGC +>AAFY01022046.1 Metagenome sequence AGZO15064.g2, whole genome shotgun sequence +ATTCGGCTCGAGTCAGCACTGGAAGCTGACAAAACGTTGCTATCATCGCGCTACTAGAAGAAGTATTACC +AATACCCATATCGCCAGTACCAAATAAATCAACAGAATCGGCAAAACTATGGGCAACCTGTATTCCTGCC +TCTATTGCAGTTACCGCTTGCTCTTTGGTCATAGCTGCACCAGTAGCAAAATTTTTGGTTCCGGCAGCAA +TATTGTGATCAATGATATCGCCCCCGCGTGCCAACTCGGTCAAATCACCAGCCACACCCATATCAACAAT +TTTAACCTGAGCACCAGCCTGCCTTGCCAGAACGTTTATCCCCGCAACACCACTAACAAAACCCCGCACC +ATCTCTACAGTTACTTCTTGTGGATACAGACTTACCCCAGACTCAACAATCCCATGATCTGCCGCCATCA +CCACAATCATTTTTCGTTTGATTTGTGGCTTGATAGACCCACAAATACCAGCCAAGTCCAGCGCCAAATC +CATCATTTGCCCTAATGCCCAGTGGGGCATTATCAGTTGCTCCAGACGCTCTTTAGCTTGCGCACGAGCA +GTTTGACTTTGACCCGTAATTGAACTCAGGGTTTCTTGCAATAAAGACATTGGGTATTCCCTTCAAATTG +ATTAAATTGATTTTCTAGAAAGCAATGAAATCGTCACATTGTTACGGAGTATAGTTATTTTCGTTTTCTC +TGTGCTTCCGTGGTAAATCCTTAAACCTTACTGTCTACACAAAAAATCCCGGAGCATTAAATTAAATGCT +CCGGGATACCGTATATTATCCATGGATATAACCACCCAAATTCTTATTCCACGAAGTCCGAGTAGTTTCC +GCCTTAATAGAAGAGTATCTGACTTCCAAAAATCTGGTTACAGTGGCCGGGCCCGTGAAGGATTTCCACC +ATCCTTCCTCTTCCTTTTGCCTAC +>AAFZ01000086.1 Metagenome sequence AHAA11662.x1, whole genome shotgun sequence +AAGAGATGACAAGCTGATGAGATGTGAGAGTAAAGTCAAAGGAGCGTAAAAGAAATTGCGGAGCGCAGAT +GGAGGAAGAAGTCGACAAAGGAGTGAGCAAGGACAGGGAAGAGTCTGATAATAGGAAGGAGAATGAGAGA +GGGCGAGAGGTAATTAGGGAGAGCGAGTGCGTGAAGACGGCGTACAGGGAGCGATAGAAGTGAAATAGGC +GACAGAGTACTCAAGCAGACAGAGGAACGTAGAGGAGGAGAGAAGGTCACATGGTAGAGGAAGCAAGAGT +GCGGGAGCAAGGACAGGGTGAGAGAAGAGGAGATTACGAGAAAGAAGGCGGGAATTGAATTGAAGGCAAT +AGAAGTAAACGCGAACGGAACTGAGAGCGGTAGGACACGGATGAGATGCCAACAGAGGAGGACGAGGAAG +ACGAGAGCGCTATACATTCCNNNNNCGACCCTGCTCTCGTCCTCTTCCGTCTCCTCTGGTGTCGAGGACN +CNTTTTCCGGGAAACCCGTTGCCGTAGTGNNCANTGCCACCGCGCAAACCAAACCCCNNTNNTTGGGGGC +CCTCTCGTTAAAACAACCTNCCGCNNNCACAAGGGTAGGTCACTTTACCGGACNCTTNCACATCNNTCTC +CNTCCCCCGTCNTGGGCAGGCGGGGTGGCTCGTTTATNACNAANNTCATACTCNNCCTTTGGCCNCCTTG +GGANTTTACAACCTTTTGCAACCTTCCCTTGTCTTTCTGGCGCTTATTCGGGAAACGGACAAGCGCACCC +GCGGAGCNTTGTGAGCGCTTAACACTCTTAAACCGTTACGCGTGAGCGACAAACCACGGAGCAGCGGCGA +CCNGCTTTATAGCCGCACCGCTCTTAAACCTTAATGCGGTCTCTCTCGTGCACCCTTTAAACAACCAACT +CTTNCTCTTTAATCATTAACCCTACATCCAAGCATACTGCCCCCCTGGAGAGTATAACAATTATACACAC +CGTCTACCCGACTGGGCCCTTCGGCTCTCCAATTTCTTAAAACACAGAAACAAACCAAGGAAACACTACA +CATATAACCAATCTCTTCCTTCTACACTAGAAGCAAGTGAGCCNCTATCCTTTNAGTATGCGTCAACGAC +GATAACTGTNCTTNTATCCCTTNCAACTCACACTTCTACGCACACTTCCCAACTCTAACTATTATTTGCC +TTCTCCCCCCCCTTGATCCAGGAAGGACNCGCGCNCCCCGGCGNCCCTCCCCTTTTCCCCTTTATATCTA +GCACTCTAACCCTCNCGCGTTCGCCGGACGCCAATNTAACGTTTATGACGACCCAACCAACCCTTTGTCC +CTGGGCGTTATAAGTACACTTTACCTCAACCTCAAATATTTGTTTACGCGCAATATACCCTTTATTTCAA +AGTAGATCATTATAAAGCCATANACCGCGAGCACCGACCAGCAATCTCCAGTTATTTTANTGTGAGTATA +GACCAGGAGCGTGAAACTTGCACGCAGGCACACACAGCCACNGAAANNACAGGAACAGGTCTCCACTTCA +CACACACATCACGGTGCCGGACCAAGGCAGCGGTCGCCCCCAACACAGGGCATCTGGTGATTCCCACACC +TCATTAACAGGTTGGGGGATATTNACCACACCCAGATTACAACGCCCCGTTTCATTAGTGTGGCTCTGGA +GGGTGATGGGCCTTCACCACACACACAAGATTTACTTGCGTGCAGTACGTTCCTTCCATGCACAGCACGA +CAGAGGCACACTTTACTGTACCCCCCCCGCCCGCCCTAGCCCGGAAGGGAAAGAGAACGACCAGTACAGG +TTTGGGGNACAACTGGTTAGGGGCCGACTGGTNTCTTCACCCTCCTCGCCCTGGGTGTGTTATTTTACCT +TCGCCGCGGGGNGTTTCTTTTACACCAAAGCANTATATTTCTTCCAACGAACCGGGCGGGCGGGGGCGGC +GCTTTACACCAAAGCGGCGAGTCCAAACCACGCCCGCGGTGGNTTTTATCTCTTTCGAGCGGAGCCAAAT +CTTTCTTTCACATTGAAGCGGGGGCCTTCCTCTCCANCGGAACGGACAGAAAGCAAACCAAACCCTCGTC +TCCCGCCCCNGCCCCAGTAGAGGTTNTGGACAGCAACNCTACAGTTTCTTGCCATTCGCGACGTGNCGTA +TTCGCACCGGGGCGCAAACCAAACCAAGCCCCCGGGAANCGGAGCCCAACCCATCCGAAGTGTTAGATTG +GATTGCTTCAGAGTTGCCAACACAAGACGGAAACAGGTGCTGTATACTTACGTTTNCCTTCGCGTTACGC +TTTGCCCGNCGGGGGGCCTTGTCTTTGAGACACACAGCGCGAGTCCCTGTCTCTCCCANGCGAAAGGGCG +AGGGGGCCAAAAATTTAGAAGACAACCCCCCCCTAGGTTTGGGNNCGGTGCGCTTNCGGGCCTACTACCA +TCTTCCATCTGCATTCACAAGTTCTGCGCCGCTTACATCTCAATTGCCACGCGAGAGCAAACTAACACTT +TGCGAAGCGGCAAAAAANTCTCCCNCACGGCCGCCCGGGTGGTCTTTTCAACGCAAACTTGATCACACTC +TCCCCTGCTTTCCTTTCACCCACAAAGCAAAGCAATCCCAGACAAAACCAAACCGCGCAAAACACCAGGA +ACTTTTGATTTCCCACACCCGGCCCCACGGGANGGGCACGTGAGATTACACTACCCGGTTNAAGTATGCG +CGGGCCGCGCGGCCCTGTTAGATTTACCCTGTTTTCGCTGCCCCCAGTTTGTGTCTGAACCGCAACAGCT +CGGGACGTTTTTCCATCCCCCCAGTTTTNTGGGCGATCAGCATAGTTTTTGCACACGAAAGCGCGAGCCA +AGCGCAGGCCAAAACCTATGAATATTTGCCCGCGCAAACCAAGGGCAAAGCCGCATTCTGGCATCGCGAA +GTCTTNCNGTCGCAGACGAGCGNGTGTTTCCACACTCGCNTGCTTNCCAAACGCACGGCGGNNGGTTCCG +GGCGCAGAATCTAAGTTTTCCCCACNCGAACTGAAGTGTTTGTGTTCCCCCCCGCCAGGAGAGGNAAACA +ATATTCTCTTCGTCGGCGCGAGCACACCCAGAGCCTGTGGGCGCCCCCCCCCGAGAAAAGCTGCGCTTTG +GCGCACATTTGACTGCGATACGCGTCGATCTGAGTAGACAAAGCCCCNCCTCTGCGTTTTGGGGGNTGTT +CTCTGCCCCCACGAAGAGAGCGGNTCNTGTTTTAGCACAACGACGNCGCTACCGAAGGGGGNCGGGGCCG +GCNCGAACCCCAAGCGCCCGGGTCCGGGGANTCTNTAATAATGTTATCCCGCCCCGGGGAATGTGANTGC +TTCGCGAAATGCGTATGTTGTCAGCTAGGGGATTNCAATCTGATTTGTGTGAAAGAATGGGGCCCAAAGA +AAANGCGGGACGCCGTTTTCAGAACTTTTCNTCAGAGGGGATGTATACTAAATAAGGGGACGGGGAGCTA +TCAAACATATAATTACGGTTCCGGGCCGAACACTATGTTTCCAACCGCCGCCTACTGTTGTTATCCCCAA +CCACNACGGACCAAAACTGGGGTTTTTCTGACGACCCCCNNTTTTGGTTTTGGGGCGCCTCATCTTCCCC +CCCATTAATGAAATTTTTGTGTGATTCGCCCCCCAAAAGTAATGTTTTCACAAGCCGCTTTGACAGAAGC +CTNTTTCAAAAAAAGGGCCCCCTCAAATGTTTGGGGTTTTACAACCAACTCTCTGCCCCTGGGGAAAAAA +GGGTGGGGGGCGATAAAACGTCTTGTTATATTTCTCACACAGGGCCAAAA |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd test-data/minifam.cm --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/minifam.cm Sat Jan 21 17:36:57 2017 -0500 |
| [ |
| b'@@ -0,0 +1,2830 @@\n+INFERNAL1/a [1.1rc1 | June 2012]\n+NAME tRNA5\n+STATES 230\n+NODES 61\n+CLEN 72\n+W 89\n+ALPH RNA\n+RF no\n+CONS yes\n+MAP yes\n+DATE Tue Jun 12 17:22:37 2012\n+COM [1] ./cmbuild tRNA5.cm ../tutorial/tRNA5.sto\n+COM [2] ./cmcalibrate ./tRNA5.cm\n+PBEGIN 0.05\n+PEND 0.05\n+WBETA 1e-07\n+QDBBETA1 1e-07\n+QDBBETA2 1e-15\n+N2OMEGA 1.52588e-05\n+N3OMEGA 1.52588e-05\n+ELSELF -0.08926734\n+NSEQ 5\n+EFFN 3.725586\n+CKSUM 3535941971\n+NULL 0.000 0.000 0.000 0.000 \n+EFP7GF -5.5288 0.72958\n+ECMLC 0.85563 -4.01853 2.43520 1600000 300168 0.003998\n+ECMGC 0.39437 -17.41037 -4.06685 1600000 77168 0.005183\n+ECMLI 0.73047 -3.70982 3.57712 1600000 245977 0.004879\n+ECMGI 0.44078 -12.13534 -0.86006 1600000 57603 0.006944\n+CM\n+ [ ROOT 0 ] - - - - - -\n+ S 0 -1 0 1 4 0 1 89 108 -7.419 -8.664 -0.055 -5.118 \n+ IL 1 1 2 1 4 3 28 90 110 -2.817 -4.319 -0.613 -2.698 0.000 0.000 0.000 0.000 \n+ IR 2 2 3 2 3 4 30 90 110 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 \n+ [ MATR 1 ] - 74 - a - -\n+ MR 3 2 3 5 5 4 32 89 108 -7.593 -0.028 -7.408 -7.620 -8.512 0.474 -1.199 0.305 -0.089 \n+ D 4 2 3 5 5 1 24 87 107 -5.352 -0.707 -2.978 -4.409 -2.404 \n+ IR 5 5 3 5 5 3 28 89 109 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 2 ] 1 73 g c - -\n+ MP 6 5 3 10 6 5 32 88 107 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.831 -2.997 -3.795 0.617 -3.618 -4.452 0.854 -3.918 -3.870 2.837 -4.276 -0.713 1.871 -3.843 -1.175 -2.703 \n+ ML 7 5 3 10 6 3 26 86 106 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 \n+ MR 8 5 3 10 6 3 25 86 106 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 \n+ D 9 5 3 10 6 0 21 84 103 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 \n+ IL 10 10 5 10 6 3 27 87 107 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 \n+ IR 11 11 6 11 5 3 27 87 107 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 3 ] 2 72 C G - -\n+ MP 12 11 6 16 6 5 31 86 105 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.097 -3.805 -3.998 0.021 -3.009 -4.646 3.103 -3.661 -3.977 1.529 -4.392 -1.585 0.835 -4.247 -0.625 -2.808 \n+ ML 13 11 6 16 6 2 25 84 104 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 \n+ MR 14 11 6 16 6 2 25 84 104 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 \n+ D 15 11 6 16 6 0 21 82 101 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 \n+ IL 16 16 5 16 6 3 27 85 105 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 \n+ IR 17 17 6 17 5 3 27 85 105 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 \n+ [ MATP 4 ] 3 71 c g - -\n+ MP 18 17 6 22 6 5 29 84 103 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.141 -2.880 -3.222 0.733 -2.762 -4.023 2.237 -3.232 -3.242 1.678 -3.747 0.537 1.616 -3.340 -0.447 -2.158 \n+ ML '..b'1.46634 0.26236 1.09861 0.40547\n+ 170 1.83247 1.54414 1.46722 0.92654 420 u - - )\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02769 4.29360 4.29360 1.46634 0.26236 0.78025 0.61303\n+ 171 1.92483 2.45259 0.39512 2.35988 421 G - - ]\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 172 3.31990 0.21477 3.08295 2.19556 422 C - - ]\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 173 2.71639 0.42788 2.38356 1.66192 423 C - - ]\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 174 1.25076 1.81371 1.23869 1.34361 424 g - - ]\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 175 1.54434 1.70196 1.17488 1.21954 425 g - - ]\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 176 1.40798 1.46982 1.27683 1.40050 426 g - - ]\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 177 1.18394 1.69593 1.51954 1.23206 427 a - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 178 1.27564 1.49766 1.31220 1.47900 428 a - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 179 1.31428 1.47326 1.53565 1.24883 429 u - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 180 1.38664 1.52439 1.37112 1.27829 430 u - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 181 1.35245 1.43180 1.49281 1.28095 431 u - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 182 1.29898 1.51481 1.69904 1.12553 432 u - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 183 1.25000 1.66010 1.46572 1.22942 433 u - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 184 1.28242 1.69982 1.29083 1.32849 434 a - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 185 1.17156 1.68621 1.44410 1.31327 435 a - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 186 1.22009 1.28821 1.81175 1.32553 436 a - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 187 1.30308 1.39524 1.62633 1.25919 437 u - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 188 1.34275 1.28056 1.58864 1.35950 438 c - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 189 1.31677 1.65824 1.41232 1.21084 439 u - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 190 1.43270 1.22474 1.77469 1.21077 440 u - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547\n+ 191 1.51542 1.17791 1.56046 1.33817 441 c - - :\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.01381 4.28939 * 1.46634 0.26236 0.00000 *\n+//\n' |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd test-data/minifam.tar |
| b |
| Binary file test-data/minifam.tar has changed |
| b |
| diff -r c47a7c52ac4f -r 6e18e0b098cd tool_dependencies.xml --- a/tool_dependencies.xml Mon Dec 19 15:27:06 2016 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| b |
| @@ -1,9 +0,0 @@ -<?xml version="1.0"?> -<tool_dependency> - <package name="infernal" version="1.1"> - <repository changeset_revision="2bac556aa73f" name="package_infernal_1_1" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> - </package> - <package name="gnu_coreutils" version="8.22"> - <repository changeset_revision="ac64dfe4b1fb" name="package_gnu_coreutils_8_22" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> - </package> -</tool_dependency> |