| Previous changeset 3:eda5df31da55 (2019-07-17) |
|
Commit message:
Fixes |
|
modified:
qiime2/merge_feature_table_and_taxonomy.xml qiime2/qiime_alignment_mask.xml qiime2/qiime_composition_add-pseudocount.xml qiime2/qiime_composition_ancom.xml qiime2/qiime_cutadapt_demux-paired.xml qiime2/qiime_cutadapt_demux-single.xml qiime2/qiime_cutadapt_trim-paired.xml qiime2/qiime_cutadapt_trim-single.xml qiime2/qiime_dada2_denoise-paired.xml qiime2/qiime_dada2_denoise-pyro.xml qiime2/qiime_dada2_denoise-single.xml qiime2/qiime_deblur_denoise-16S.xml qiime2/qiime_deblur_denoise-other.xml qiime2/qiime_demux_emp-paired.xml qiime2/qiime_demux_emp-single.xml qiime2/qiime_demux_summarize.xml qiime2/qiime_diversity_adonis.xml qiime2/qiime_diversity_alpha-correlation.xml qiime2/qiime_diversity_alpha-group-significance.xml qiime2/qiime_diversity_alpha-rarefaction.xml qiime2/qiime_diversity_beta-correlation.xml qiime2/qiime_diversity_beta-group-significance.xml qiime2/qiime_diversity_beta-rarefaction.xml qiime2/qiime_diversity_beta.xml qiime2/qiime_diversity_bioenv.xml qiime2/qiime_diversity_core-metrics-phylogenetic.xml qiime2/qiime_diversity_core-metrics.xml qiime2/qiime_diversity_filter-distance-matrix.xml qiime2/qiime_diversity_mantel.xml qiime2/qiime_diversity_procrustes-analysis.xml qiime2/qiime_emperor_biplot.xml qiime2/qiime_emperor_plot.xml qiime2/qiime_emperor_procrustes-plot.xml qiime2/qiime_feature-classifier_classify-consensus-blast.xml qiime2/qiime_feature-classifier_classify-consensus-vsearch.xml qiime2/qiime_feature-classifier_classify-sklearn.xml qiime2/qiime_feature-classifier_extract-reads.xml qiime2/qiime_feature-classifier_fit-classifier-naive-bayes.xml qiime2/qiime_feature-table_core-features.xml qiime2/qiime_feature-table_filter-features.xml qiime2/qiime_feature-table_filter-samples.xml qiime2/qiime_feature-table_group.xml qiime2/qiime_feature-table_heatmap.xml qiime2/qiime_feature-table_merge-seqs.xml qiime2/qiime_feature-table_merge-taxa.xml qiime2/qiime_feature-table_merge.xml qiime2/qiime_feature-table_rarefy.xml qiime2/qiime_feature-table_subsample.xml qiime2/qiime_feature-table_summarize.xml qiime2/qiime_fragment-insertion_sepp.xml qiime2/qiime_gneiss_balance-taxonomy.xml qiime2/qiime_gneiss_dendrogram-heatmap.xml qiime2/qiime_gneiss_gradient-clustering.xml qiime2/qiime_gneiss_ilr-hierarchical.xml qiime2/qiime_gneiss_ilr-phylogenetic.xml qiime2/qiime_gneiss_lme-regression.xml qiime2/qiime_gneiss_ols-regression.xml qiime2/qiime_longitudinal_anova.xml qiime2/qiime_longitudinal_feature-volatility.xml qiime2/qiime_longitudinal_first-differences.xml qiime2/qiime_longitudinal_first-distances.xml qiime2/qiime_longitudinal_linear-mixed-effects.xml qiime2/qiime_longitudinal_maturity-index.xml qiime2/qiime_longitudinal_nmit.xml qiime2/qiime_longitudinal_pairwise-differences.xml qiime2/qiime_longitudinal_pairwise-distances.xml qiime2/qiime_longitudinal_plot-feature-volatility.xml qiime2/qiime_longitudinal_volatility.xml qiime2/qiime_metadata_tabulate.xml qiime2/qiime_phylogeny_align-to-tree-mafft-fasttree.xml qiime2/qiime_phylogeny_iqtree-ultrafast-bootstrap.xml qiime2/qiime_phylogeny_iqtree.xml qiime2/qiime_phylogeny_raxml-rapid-bootstrap.xml qiime2/qiime_phylogeny_raxml.xml qiime2/qiime_quality-control_evaluate-composition.xml qiime2/qiime_quality-control_evaluate-taxonomy.xml qiime2/qiime_quality-control_exclude-seqs.xml qiime2/qiime_quality-filter_q-score-joined.xml qiime2/qiime_quality-filter_q-score.xml qiime2/qiime_sample-classifier_classify-samples-from-dist.xml qiime2/qiime_sample-classifier_classify-samples-ncv.xml qiime2/qiime_sample-classifier_classify-samples.xml qiime2/qiime_sample-classifier_fit-classifier.xml qiime2/qiime_sample-classifier_fit-regressor.xml qiime2/qiime_sample-classifier_heatmap.xml qiime2/qiime_sample-classifier_regress-samples-ncv.xml qiime2/qiime_sample-classifier_regress-samples.xml qiime2/qiime_sample-classifier_scatterplot.xml qiime2/qiime_sample-classifier_split-table.xml qiime2/qiime_taxa_barplot.xml qiime2/qiime_taxa_collapse.xml qiime2/qiime_taxa_filter-seqs.xml qiime2/qiime_taxa_filter-table.xml qiime2/qiime_tools_export.xml qiime2/qiime_tools_export_collection.xml qiime2/qiime_tools_export_paired_collection.xml qiime2/qiime_tools_import.xml qiime2/qiime_vsearch_cluster-features-closed-reference.xml qiime2/qiime_vsearch_join-pairs.xml qiime2/qiime_vsearch_uchime-denovo.xml qiime2/qiime_vsearch_uchime-ref.xml |
|
added:
qiime2/qiime_demux_filter-samples.xml qiime2/qiime_diversity_alpha-phylogenetic-alt.xml qiime2/qiime_feature-classifier_classify-hybrid-vsearch-sklearn.xml qiime2/qiime_rep_set.loc qiime2/qiime_taxonomy.loc |
|
removed:
qiime2/qiime_diversity_beta-phylogenetic-alt.xml qiime2/qiime_gneiss_add-pseudocount.xml qiime2/qiime_gneiss_ilr-transform.xml qiime2/qiime_sample-classifier_maturity-index.xml tool_data/ref_classifier.loc tool_data/ref_taxnonomy.loc tool_data_table_conf.xml.sample |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/merge_feature_table_and_taxonomy.xml --- a/qiime2/merge_feature_table_and_taxonomy.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/merge_feature_table_and_taxonomy.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -7,8 +7,8 @@ <command> mkdir out; -qiime tools export --input-path --output-path out $taxonomy_qza; -qiime tools export --input-path --output-path out $biom_qza; +qiime tools export --input-path $taxonomy_qza --output-path out; +qiime tools export --input-path $biom_qza --output-path out; sed -i '1s;^;#;' out/*.tsv; sed -i 's/Confidence/confidence/g' out/*.tsv; |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_alignment_mask.xml --- a/qiime2/qiime_alignment_mask.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_alignment_mask.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -19,6 +19,7 @@ --p-min-conservation=$pminconservation #end if +; cp omaskedalignment.qza $omaskedalignment ]]></command> <inputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_composition_add-pseudocount.xml --- a/qiime2/qiime_composition_add-pseudocount.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_composition_add-pseudocount.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -10,7 +10,7 @@ --i-table=$itable --o-composition-table=ocompositiontable -#if $ppseudocount: +#if str($ppseudocount): --p-pseudocount=$ppseudocount #end if ; |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_composition_ancom.xml --- a/qiime2/qiime_composition_ancom.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_composition_ancom.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -9,15 +9,15 @@ --i-table=$itable -#def list_dict_to_string(list_dict): - #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') - #for d in list_dict[1:]: - #set $file_list = $file_list + ',' + d['additional_input'].__getattr__('file_name') - #end for - #return $file_list -#end def + ---m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) --m-metadata-column="$mmetadatacolumn" +#if $metadatafile: + --m-metadata-file=$metadatafile +#end if + + + +--m-metadata-column="$mmetadatacolumn" #if str($pdifferencefunction) != 'None': --p-difference-function=$pdifferencefunction @@ -35,9 +35,10 @@ ]]></command> <inputs> <param format="qza,no_unzip.zip" label="--i-table: FeatureTable[Composition] - The feature table to be used for ANCOM computation. [required]" name="itable" optional="False" type="data"/> - <repeat name="input_files_mmetadatafile" optional="False" title="--m-metadata-file"> - <param format="tabular" label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [required]" name="additional_input" type="data"/> - </repeat> + + <param label="--m-metadata-file METADATA" name="metadatafile" type="data" format="tabular,qza,no_unzip.zip" optional="True" /> + + <param label="--m-metadata-column: MetadataColumn[Categorical] - Column from metadata file or artifact viewable as metadata. The categorical sample metadata column to test for differential abundance across. [required]" name="mmetadatacolumn" optional="False" type="text"/> <param label="--p-difference-function: " name="pdifferencefunction" optional="True" type="select"> <option selected="True" value="None">Selection is Optional</option> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_cutadapt_demux-paired.xml --- a/qiime2/qiime_cutadapt_demux-paired.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_cutadapt_demux-paired.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -8,28 +8,71 @@ qiime cutadapt demux-paired --i-seqs=$iseqs -#def list_dict_to_string(list_dict): - #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') - #for d in list_dict[1:]: - #set $file_list = $file_list + ',' + d['additional_input'].__getattr__('file_name') - #end for - #return $file_list + +#if $input_files_mforwardbarcodesfile: +#def list_dict_to_string_forward(list_dict): + #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') + #for d in list_dict[1:]: + #set $file_list = $file_list + ',' + d['additional_input'].__getattr__('file_name') + #end for + #return $file_list +#end def +--m-forward-barcodes-file=$list_dict_to_string_forward($input_files_mforwardbarcodesfile) +#end if + +#if $input_files_mreversebarcodesfile: +#def list_dict_to_string_reverse(list_dict): + #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') + #for d in list_dict[1:]: + #set $file_list = $file_list + ',' + d['additional_input'].__getattr__('file_name') + #end for + #return $file_list #end def +--m-reverse-barcodes-file=$list_dict_to_string_reverse($input_files_mreversebarcodesfile) +#end if ---m-forward-barcodes-file=$list_dict_to_string("$input_files_mforwardbarcodesfile") ---m-reverse-barcodes-file=$list_dict_to_string("$input_files_mreversebarcodesfile") + + + +#if '__sq__' in str($mforwardbarcodescolumn): + #set $mforwardbarcodescolumn_temp = $mforwardbarcodescolumn.replace('__sq__', "'") + #set $mforwardbarcodescolumn = $mforwardbarcodescolumn_temp +#end if + +#if '__db__' in str($mforwardbarcodescolumn): + #set $mforwardbarcodescolumn_temp = $mforwardbarcodescolumn.replace('__db__', '"') + #set $mforwardbarcodescolumn = $mforwardbarcodescolumn_temp +#end if +#if str($mforwardbarcodescolumn): --m-forward-barcodes-column="$mforwardbarcodescolumn" +#end if + + + + +#if '__sq__' in str($mreversebarcodescolumn): + #set $mreversebarcodescolumn_temp = $mreversebarcodescolumn.replace('__sq__', "'") + #set $mreversebarcodescolumn = $mreversebarcodescolumn_temp +#end if + +#if '__db__' in str($mreversebarcodescolumn): + #set $mreversebarcodescolumn_temp = $mreversebarcodescolumn.replace('__db__', '"') + #set $mreversebarcodescolumn = $mreversebarcodescolumn_temp +#end if #if str($mreversebarcodescolumn): --m-reverse-barcodes-column="$mreversebarcodescolumn" #end if + + #if $perrorrate: --p-error-rate=$perrorrate #end if + --o-per-sample-sequences=opersamplesequences --o-untrimmed-sequences=ountrimmedsequences ; |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_cutadapt_demux-single.xml --- a/qiime2/qiime_cutadapt_demux-single.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_cutadapt_demux-single.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -8,19 +8,36 @@ qiime cutadapt demux-single --i-seqs=$iseqs + + + +#if '__sq__' in str($mbarcodescolumn): + #set $mbarcodescolumn_temp = $mbarcodescolumn.replace('__sq__', "'") + #set $mbarcodescolumn = $mbarcodescolumn_temp +#end if + --m-barcodes-column="$mbarcodescolumn" + + --o-per-sample-sequences=opersamplesequences --o-untrimmed-sequences=ountrimmedsequences + + + + + +#if $input_files_mbarcodesfile: #def list_dict_to_string(list_dict): - #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') - #for d in list_dict[1:]: - #set $file_list = $file_list + ',' + d['additional_input'].__getattr__('file_name') - #end for - #return $file_list +#set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') +#for d in list_dict[1:]: + #set $file_list = $file_list + ',' + d['additional_input'].__getattr__('file_name') +#end for +#return $file_list #end def +--m-barcodes-file=$list_dict_to_string($input_files_mbarcodesfile) +#end if ---m-barcodes-file=$list_dict_to_string("$input_files_mbarcodesfile") #if $perrorrate: --p-error-rate=$perrorrate @@ -33,7 +50,7 @@ ]]></command> <inputs> <param format="qza,no_unzip.zip" label="--i-seqs: ARTIFACT MultiplexedSingleEndBarcodeInSequence The single-end sequences to be demultiplexed. [required]" name="iseqs" optional="False" type="data"/> - <repeat name="$input_files_mbarcodesfile" optional="False" title="--m-barcodes-file"> + <repeat name="input_files_mbarcodesfile" optional="False" title="--m-barcodes-file"> <param label="--m-barcodes-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [required]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> <param label="--m-barcodes-column: COLUMN MetadataColumn[Categorical] The sample metadata column listing the per-sample barcodes. [required]" name="mbarcodescolumn" optional="False" type="text"/> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_cutadapt_trim-paired.xml --- a/qiime2/qiime_cutadapt_trim-paired.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_cutadapt_trim-paired.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -14,14 +14,37 @@ --p-cores=$pcores #end if + + +#if '__sq__' in str($padapterf): + #set $padapterf_temp = $padapterf.replace('__sq__', "'") + #set $padapterf = $padapterf_temp +#end if + +#if 'X' in str($padapterf): + #set $padapterf_temp = $padapterf.replace('X', "$") + #set $padapterf = $padapterf_temp +#end if + #if str($padapterf): --p-adapter-f="$padapterf" #end if + + + +#if '__sq__' in str($pfrontf): + #set $pfrontf_temp = $pfrontf.replace('__sq__', "'") + #set $pfrontf = $pfrontf_temp +#end if + #if str($pfrontf): --p-front-f="$pfrontf" #end if + + + #if '__sq__' in str($panywheref): #set $panywheref_temp = $panywheref.replace('__sq__', "'") #set $panywheref = $panywheref_temp @@ -32,14 +55,36 @@ #end if + + + +#if '__sq__' in str($padapterr): + #set $padapterr_temp = $padapterr.replace('__sq__', "'") + #set $padapterr = $padapterr_temp +#end if + +#if 'X' in str($padapterr): + #set $padapterr_temp = $padapterr.replace('X', "$") + #set $padapterr = $padapterr_temp +#end if + #if str($padapterr): --p-adapter-r="$padapterr" #end if + + +#if '__sq__' in str($pfrontr): + #set $pfrontr_temp = $pfrontr.replace('__sq__', "'") + #set $pfrontr = $pfrontr_temp +#end if + #if str($pfrontr): --p-front-r="$pfrontr" #end if + + #if '__sq__' in str($panywherer): #set $panywherer_temp = $panywherer.replace('__sq__', "'") #set $panywherer = $panywherer_temp @@ -49,7 +94,9 @@ --p-anywhere-r="$panywherer" #end if -#if $perrorrate: + + +#if str($perrorrate): --p-error-rate=$perrorrate #end if @@ -61,7 +108,7 @@ --p-times=$ptimes #end if -#if $poverlap: +#if str($poverlap): --p-overlap=$poverlap #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_cutadapt_trim-single.xml --- a/qiime2/qiime_cutadapt_trim-single.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_cutadapt_trim-single.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -13,14 +13,38 @@ --p-cores=$pcores #end if + +#if '__sq__' in str($padapter): + #set $padapter_temp = $padapter.replace('__sq__', "'") + #set $padapter = $padapter_temp +#end if + +#if 'X' in str($padapter): + #set $padapter_temp = $padapter.replace('X', "$") + #set $padapter = $padapter_temp +#end if + #if str($padapter): --p-adapter="$padapter" #end if + + + + +#if '__sq__' in str($pfront): + #set $pfront_temp = $pfront.replace('__sq__', "'") + #set $pfront = $pfront_temp +#end if + #if str($pfront): --p-front="$pfront" #end if + + + + #if '__sq__' in str($panywhere): #set $panywhere_temp = $panywhere.replace('__sq__', "'") #set $panywhere = $panywhere_temp @@ -31,7 +55,9 @@ #end if -#if $perrorrate: + + +#if str($perrorrate): --p-error-rate=$perrorrate #end if @@ -39,11 +65,11 @@ --p-no-indels #end if -#if $ptimes: +#if str($ptimes): --p-times=$ptimes #end if -#if $poverlap: +#if str($poverlap): --p-overlap=$poverlap #end if @@ -55,7 +81,7 @@ --p-no-match-adapter-wildcards #end if -#if $pminimumlength: +#if str($pminimumlength): --p-minimum-length=$pminimumlength #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_dada2_denoise-paired.xml --- a/qiime2/qiime_dada2_denoise-paired.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_dada2_denoise-paired.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -5,24 +5,88 @@ <requirement type="package" version="2019.4">qiime2</requirement> </requirements> <command><![CDATA[ + +#def parse_file(file): + #import csv + #set $read = csv.reader(open($file, "r")) + #set $qc = 0 + #for l in $read: + #if "50%" in l: + #set $num = 0.0 + #for i in l[1:]: + #if float(i) <= 25.0 + #set $num = i + #set $qc = l.index($num) - 1 + #break + #end if + #end for + #end if +#end for +#return $qc +#end def + +#def find_QC(file): + #set $f_file_path=str(file).split(".dat")[0] + '_files/forward-seven-number-summaries.csv' + #set $r_file_path=str(file).split(".dat")[0] + '_files/reverse-seven-number-summaries.csv' + #set $qc_f = $parse_file($f_file_path) + #set $qc_r = $parse_file($r_file_path) + #return $qc_f, $qc_r +#end def + +#def find_adapters(mapping_fp): + #import csv + #set $forward = 0 + #set $reversed = 0 + #set $reader = csv.reader(open(str(mapping_fp)), delimiter='\t') + #for row in $reader: + #if "#" not in str(row[0]): + #set $forward = len(row[2]) + #set $reversed = len(row[3]) + #break + #end if + #end for +#return int($forward), int($reversed) +#end def + +#if str($mapping_fp) != 'None' and (int($ptrimleftf) == -1 or int($ptrimleftr) == -1): + #set $both_adapters = $find_adapters($mapping_fp) + #set $ptrimleftf=$both_adapters[0] + #set $ptrimleftr=$both_adapters[1] +#end if + +#if str($sum_fp) != 'None' and (int($ptrunclenf) == -1 or int($ptrunclenr) == -1): + #set $both_qc = $find_QC($sum_fp) + #set $ptrunclenf=$both_qc[0] + #set $ptrunclenr=$both_qc[1] +#end if + + qiime dada2 denoise-paired --i-demultiplexed-seqs=$idemultiplexedseqs ---p-trunc-len-f="$ptrunclenf" ---p-trunc-len-r="$ptrunclenr" -#if $ptrimleftf: + + +#if str($ptrunclenf): + --p-trunc-len-f="$ptrunclenf" +#end if + +#if str($ptrunclenf): + --p-trunc-len-r="$ptrunclenr" +#end if + +#if str($ptrimleftf): --p-trim-left-f=$ptrimleftf #end if -#if $ptrimleftr: +#if str($ptrimleftr): --p-trim-left-r=$ptrimleftr #end if -#if $pmaxee: +#if str($pmaxee): --p-max-ee=$pmaxee #end if -#if $ptruncq: +#if str($ptruncq): --p-trunc-q=$ptruncq #end if @@ -30,7 +94,7 @@ --p-chimera-method=$pchimeramethod #end if -#if $pminfoldparentoverabundance: +#if str($pminfoldparentoverabundance): --p-min-fold-parent-over-abundance=$pminfoldparentoverabundance #end if @@ -41,7 +105,7 @@ #end if -#if $pnreadslearn: +#if str($pnreadslearn): --p-n-reads-learn=$pnreadslearn #end if @@ -58,6 +122,9 @@ cp odenoisingstats.qza $odenoisingstats ]]></command> <inputs> + <param format="tabular" label="Mapping file where 3rd and 4th columns must be forward and reverse primers respectively" name="mapping_fp" optional="True" type="data"/> + <param format="html" label="Summary file" name="sum_fp" optional="True" type="data"/> + <param format="qza,no_unzip.zip" label="--i-demultiplexed-seqs: ARTIFACT SampleData[PairedEndSequencesWithQuality] The paired-end demultiplexed sequences to be denoised. [required]" name="idemultiplexedseqs" optional="False" type="data"/> <param label="--p-trunc-len-f: INTEGER Position at which forward read sequences should be truncated due to decrease in quality. This truncates the 3' end of the of the input sequences, which will be the bases that were sequenced in the last cycles. Reads that are shorter than this value will be discarded. After this parameter is applied there must still be at least a 20 nucleotide overlap between the forward and reverse reads. If 0 is provided, no truncation or length filtering will be performed [required]" name="ptrunclenf" optional="False" value="" type="integer"/> <param label="--p-trunc-len-r: INTEGER Position at which reverse read sequences should be truncated due to decrease in quality. This truncates the 3' end of the of the input sequences, which will be the bases that were sequenced in the last cycles. Reads that are shorter than this value will be discarded. After this parameter is applied there must still be at least a 20 nucleotide overlap between the forward and reverse reads. If 0 is provided, no truncation or length filtering will be performed [required]" name="ptrunclenr" optional="False" value="" type="integer"/> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_dada2_denoise-pyro.xml --- a/qiime2/qiime_dada2_denoise-pyro.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_dada2_denoise-pyro.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -8,21 +8,24 @@ qiime dada2 denoise-pyro --i-demultiplexed-seqs=$idemultiplexedseqs ---p-trunc-len="$ptrunclen" -#if $ptrimleft: +#if str($ptrunclen): + --p-trunc-len="$ptrunclen" +#end if + +#if str($ptrimleft): --p-trim-left=$ptrimleft #end if -#if $pmaxee: +#if str($pmaxee): --p-max-ee=$pmaxee #end if -#if $ptruncq: +#if str($ptruncq): --p-trunc-q=$ptruncq #end if -#if $pmaxlen: +#if str($pmaxlen): --p-max-len=$pmaxlen #end if @@ -30,7 +33,7 @@ --p-chimera-method=$pchimeramethod #end if -#if $pminfoldparentoverabundance: +#if str($pminfoldparentoverabundance): --p-min-fold-parent-over-abundance=$pminfoldparentoverabundance #end if @@ -40,11 +43,11 @@ #end if -#if $pnreadslearn: +#if str($pnreadslearn): --p-n-reads-learn=$pnreadslearn #end if -#if $pnohashedfeatureids: +#if str($pnohashedfeatureids): --p-no-hashed-feature-ids #end if @@ -141,6 +144,7 @@ The resulting feature sequences. Each feature in the feature table will be represented by exactly one sequence. denoising_stats : SampleData[DADA2Stats] + \ ]]></help> <macros> <import>qiime_citation.xml</import> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_dada2_denoise-single.xml --- a/qiime2/qiime_dada2_denoise-single.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_dada2_denoise-single.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -8,17 +8,20 @@ qiime dada2 denoise-single --i-demultiplexed-seqs=$idemultiplexedseqs ---p-trunc-len="$ptrunclen" -#if $ptrimleft: +#if str($ptrunclen): + --p-trunc-len="$ptrunclen" +#end if + +#if str($ptrimleft): --p-trim-left=$ptrimleft #end if -#if $pmaxee: +#if str($pmaxee): --p-max-ee=$pmaxee #end if -#if $ptruncq: +#if str($ptruncq): --p-trunc-q=$ptruncq #end if @@ -26,7 +29,7 @@ --p-chimera-method=$pchimeramethod #end if -#if $pminfoldparentoverabundance: +#if str($pminfoldparentoverabundance): --p-min-fold-parent-over-abundance=$pminfoldparentoverabundance #end if @@ -36,11 +39,11 @@ #end if -#if $pnreadslearn: +#if str($pnreadslearn): --p-n-reads-learn=$pnreadslearn #end if -#if $pnohashedfeatureids: +#if str($pnohashedfeatureids): --p-no-hashed-feature-ids #end if @@ -66,7 +69,7 @@ </param> <param label="--p-min-fold-parent-over-abundance: NUMBER The minimum abundance of potential parents of a sequence being tested as chimeric, expressed as a fold-change versus the abundance of the sequence being tested. Values should be greater than or equal to 1 (i.e. parents should be more abundant than the sequence being tested). This parameter has no effect if chimera-method is 'none'. [default: 1.0]" name="pminfoldparentoverabundance" optional="True" type="float" value="1.0"/> <param label="--p-n-reads-learn: INTEGER The number of reads to use when training the error model. Smaller numbers will result in a shorter run time but a less reliable error model. [default: 1000000]" name="pnreadslearn" optional="True" type="integer" value="1000000"/> - <param label="--p-no-hashed-feature-ids: If false, the feature ids in the resulting table will be presented as hashes of the sequences defining each feature. The hash will always be the same for the same sequence so this allows feature tables to be merged across runs of this method. You should only merge tables if the exact same parameters are used for each run. [default: Fales]" name="pnohashedfeatureids" selected="False" type="boolean"/> + <param label="--p-no-hashed-feature-ids: If false, the feature ids in the resulting table will be presented as hashes of the sequences defining each feature. The hash will always be the same for the same sequence so this allows feature tables to be merged across runs of this method. You should only merge tables if the exact same parameters are used for each run. [default: False]" name="pnohashedfeatureids" selected="False" type="boolean"/> </inputs> <outputs> <data format="qza" label="${tool.name} on ${on_string}: table.qza" name="otable"/> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_deblur_denoise-16S.xml --- a/qiime2/qiime_deblur_denoise-16S.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_deblur_denoise-16S.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -8,33 +8,38 @@ qiime deblur denoise-16S --i-demultiplexed-seqs=$idemultiplexedseqs ---p-trim-length="$ptrimlength" + + -#if $plefttrimlen: +#if str($ptrimlength): + --p-trim-length=$ptrimlength +#end if + +#if str($plefttrimlen): --p-left-trim-len=$plefttrimlen #end if -#if $psamplestats: +#if str($psamplestats): --p-sample-stats #end if -#if $pmeanerror: +#if str($pmeanerror): --p-mean-error=$pmeanerror #end if -#if $pindelprob: +#if str($pindelprob): --p-indel-prob=$pindelprob #end if -#if $pindelmax: +#if str($pindelmax): --p-indel-max=$pindelmax #end if -#if $pminreads: +#if str($pminreads): --p-min-reads=$pminreads #end if -#if $pminsize: +#if str($pminsize): --p-min-size=$pminsize #end if @@ -45,7 +50,7 @@ #end if -#if $pnohashedfeatureids: +#if str($pnohashedfeatureids): --p-no-hashed-feature-ids #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_deblur_denoise-other.xml --- a/qiime2/qiime_deblur_denoise-other.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_deblur_denoise-other.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -9,33 +9,36 @@ --i-demultiplexed-seqs=$idemultiplexedseqs --i-reference-seqs=$ireferenceseqs ---p-trim-length="$ptrimlength" -#if $plefttrimlen: +#if str($ptrimlength): + --p-trim-length="$ptrimlength" +#end if + +#if str($plefttrimlen): --p-left-trim-len=$plefttrimlen #end if -#if $psamplestats: +#if str($psamplestats): --p-sample-stats #end if -#if $pmeanerror: +#if str($pmeanerror): --p-mean-error=$pmeanerror #end if -#if $pindelprob: +#if str($pindelprob): --p-indel-prob=$pindelprob #end if -#if $pindelmax: +#if str($pindelmax): --p-indel-max=$pindelmax #end if -#if $pminreads: +#if str($pminreads): --p-min-reads=$pminreads #end if -#if $pminsize: +#if str($pminsize): --p-min-size=$pminsize #end if @@ -46,7 +49,7 @@ #end if -#if $pnohashedfeatureids: +#if str($pnohashedfeatureids): --p-no-hashed-feature-ids #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_demux_emp-paired.xml --- a/qiime2/qiime_demux_emp-paired.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_demux_emp-paired.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -11,6 +11,7 @@ --m-barcodes-column="$mbarcodescolumn" +#if $input_files_mbarcodesfile: #def list_dict_to_string(list_dict): #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') #for d in list_dict[1:]: @@ -18,8 +19,8 @@ #end for #return $file_list #end def - --m-barcodes-file=$list_dict_to_string($input_files_mbarcodesfile) +#end if #if $pnogolayerrorcorrection: |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_demux_emp-single.xml --- a/qiime2/qiime_demux_emp-single.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_demux_emp-single.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -11,6 +11,7 @@ --m-barcodes-column="$mbarcodescolumn" +#if $input_files_mbarcodesfile: #def list_dict_to_string(list_dict): #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') #for d in list_dict[1:]: @@ -18,8 +19,8 @@ #end for #return $file_list #end def - --m-barcodes-file=$list_dict_to_string($input_files_mbarcodesfile) +#end if #if $pnogolayerrorcorrection: @@ -41,8 +42,8 @@ cp oerrorcorrectiondetails.qza $oerrorcorrectiondetails ]]></command> <inputs> - <repeat name="input_files_mbarcodesfile" optional="False" title="--m-barcodes-file"> - <param label="--m-barcodes-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [required]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip"/> + <repeat name="input_files_mbarcodesfile" optional="True" title="--m-barcodes-file [optional]"> + <param label="--m-barcodes-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip"/> </repeat> <param format="qza,no_unzip.zip" label="--i-seqs: ARTIFACT RawSequences | EMPSingleEndSequences | EMPPairedEndSequences The single-end sequences to be demultiplexed. [required]" name="iseqs" optional="False" type="data"/> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_demux_filter-samples.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/qiime2/qiime_demux_filter-samples.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -0,0 +1,71 @@ +<?xml version="1.0" ?> +<tool id="qiime_demux_filter-samples" name="qiime demux filter-samples" version="2019.7"> + <description> - Filter samples out of demultiplexed data.</description> + <requirements> + <requirement type="package" version="2019.7">qiime2</requirement> + </requirements> + <command><![CDATA[ +qiime demux filter-samples + +--i-demux=$idemux + + +#if $input_files_mmetadatafile: +#def list_dict_to_string(list_dict): + #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') + #for d in list_dict[1:]: + #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') + #end for + #return $file_list +#end def + --m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) +#end if + + + +#if '__sq__' in str($pwhere): + #set $pwhere_temp = $pwhere.replace('__sq__', "'") + #set $pwhere = $pwhere_temp +#end if + + +#if str($pwhere): + --p-where="$pwhere" +#end if + + +#if $pexcludeids: + --p-exclude-ids +#end if + +#if str($citations) != 'None': + --citations=$citations +#end if + + +--o-filtered-demux=ofiltereddemux + +; +cp ofiltereddemux.qza $ofiltereddemux + ]]></command> + <inputs> + + <repeat name="input_files_mmetadatafile" optional="False" title="--m-metadata-file"> + <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. Sample metadata file containing individual_id_column. [required]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> + </repeat> + + <param format="qza,no_unzip.zip" label="--i-demux: ARTIFACT SampleData[SequencesWithQuality¹ | PairedEndSequencesWithQuality² | JoinedSequencesWithQuality³] The demultiplexed data from which samples should be filtered. [required]" name="idemux" optional="False" type="data"/> + <param label="--p-where: TEXT Optional SQLite WHERE clause specifying sample metadata criteria that must be met to be included in the filtered data. If not provided, all samples in `metadata` that are also in the demultiplexed data will be retained. [optional]" name="pwhere" optional="True" type="text"/> + <param label="--p-exclude-ids: --p-no-exclude-ids Defaults to False. If True, the samples selected by the `metadata` and optional `where` parameter will be excluded from the filtered data. [default: False]" name="pexcludeids" selected="False" type="boolean"/> + </inputs> + <outputs> + <data format="qza" label="${tool.name} on ${on_string}: filtereddemux.qza" name="ofiltereddemux"/> + </outputs> + <help><![CDATA[ + + ]]></help> +<macros> + <import>qiime_citation.xml</import> +</macros> +<expand macro="qiime_citation"/> +</tool> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_demux_summarize.xml --- a/qiime2/qiime_demux_summarize.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_demux_summarize.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -9,7 +9,7 @@ --i-data=$idata -#if $pn: +#if str($pn): --p-n=$pn #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_diversity_adonis.xml --- a/qiime2/qiime_diversity_adonis.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_diversity_adonis.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -10,22 +10,29 @@ --i-distance-matrix=$idistancematrix +#if $input_files_mmetadatafile: #def list_dict_to_string(list_dict): #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') #for d in list_dict[1:]: - #set $file_list = $file_list + ',' + d['additional_input'].__getattr__('file_name') + #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') #end for #return $file_list #end def - ---m-metadata-file=$list_dict_to_string("$input_files_mmetadatafile") +--m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) +#end if +#if '__sq__' in str($pformula): + #set $pformula_temp = $pformula.replace('__sq__', "'") + #set $pformula = $pformula_temp +#end if --p-formula="$pformula" -#if $ppermutations: + + +#if str($ppermutations): --p-permutations=$ppermutations #end if @@ -45,7 +52,7 @@ <param label="--p-formula: TEXT Model formula containing only independent terms contained in the sample metadata. These can be continuous variables or factors, and they can have interactions as in a typical R formula. E.g., the formula 'treatment+block' would test whether the input distance matrix partitions based on 'treatment' and 'block' sample metadata. The formula 'treatment*block' would test both of those effects as well as their interaction. Enclose formulae in quotes to avoid unpleasant surprises. [required]" name="pformula" optional="False" type="text"/> <param label="--p-permutations: INTEGER Range(1, None) The number of permutations to be run when computing p-values. [default: 999]" name="ppermutations" optional="True" min="1" type="integer" value="999"/> - <repeat name="input_files_mmetadatafile" optional="False" title="--m-metadata-file"> + <repeat name="input_files_mmetadatafile" optional="False" title="--m-metadata-file [required]"> <param format="tabular" label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [required]" name="additional_input" type="data"/> </repeat> </inputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_diversity_alpha-correlation.xml --- a/qiime2/qiime_diversity_alpha-correlation.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_diversity_alpha-correlation.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -38,12 +38,11 @@ <option value="pearson">pearson</option> </param> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> + <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file [required]"> <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> </inputs> <outputs> - <data format="qza" label="${tool.name} on ${on_string}: metadatafile.qza" name="mmetadatafile"/> <data format="html" label="${tool.name} on ${on_string}: visualization.qzv" name="ovisualization"/> </outputs> <help><![CDATA[ |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_diversity_alpha-group-significance.xml --- a/qiime2/qiime_diversity_alpha-group-significance.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_diversity_alpha-group-significance.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -10,15 +10,17 @@ --i-alpha-diversity=$ialphadiversity +#if $input_files_mmetadatafile: #def list_dict_to_string(list_dict): #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') #for d in list_dict[1:]: - #set $file_list = $file_list + ',' + d['additional_input'].__getattr__('file_name') + #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') #end for #return $file_list #end def +--m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) +#end if ---m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) --o-visualization=ovisualization ; @@ -29,7 +31,7 @@ <inputs> <param format="qza,no_unzip.zip" label="--i-alpha-diversity: ARTIFACT SampleData[AlphaDiversity] Vector of alpha diversity values by sample. [required]" name="ialphadiversity" optional="False" type="data"/> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> + <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file [required]"> <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> </inputs> @@ -37,26 +39,16 @@ <data format="html" label="${tool.name} on ${on_string}: visualization.qzv" name="ovisualization"/> </outputs> <help><![CDATA[ -Beta diversity group significance -################################# +Alpha diversity comparisons -Determine whether groups of samples are significantly different from one -another using a permutation-based statistical test. +Visually and statistically compare groups of alpha diversity values. Parameters ---------- -distance_matrix : DistanceMatrix - Matrix of distances between pairs of samples. -metadata : MetadataColumn[Categorical] - Categorical sample metadata column. -method : Str % Choices('permanova', 'anosim', 'permdisp'), optional - The group significance test to be applied. -pairwise : Bool, optional - Perform pairwise tests between all pairs of groups in addition to the - test across all groups. This can be very slow if there are a lot of - groups in the metadata column. -permutations : Int, optional - The number of permutations to be run when computing p-values. +alpha_diversity : SampleData[AlphaDiversity] + Vector of alpha diversity values by sample. +metadata : Metadata + The sample metadata. Returns ------- |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_diversity_alpha-phylogenetic-alt.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/qiime2/qiime_diversity_alpha-phylogenetic-alt.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -0,0 +1,37 @@ +<?xml version="1.0" ?> +<tool id="qiime_diversity_alpha-phylogenetic-alt" name="qiime diversity alpha-phylogenetic-alt" version="2019.7"> + <description> - Alpha diversity (phylogenetic) - alternative implementation</description> + <requirements> + <requirement type="package" version="2019.7">qiime2</requirement> + </requirements> + <command><![CDATA[ +qiime diversity alpha-phylogenetic-alt + +--i-table=$itable +--i-phylogeny=$iphylogeny + +--p-metric=$pmetric + +--o-alpha-diversity=oalphadiversity + +; +cp oalphadiversity.qza $oalphadiversity + ]]></command> + <inputs> + <param format="qza,no_unzip.zip" label="--i-table: ARTIFACT FeatureTable[Frequency] The feature table containing the samples for which alpha diversity should be computed. [required]" name="itable" optional="False" type="data"/> + <param format="qza,no_unzip.zip" label="--i-phylogeny: ARTIFACT Phylogenetic tree containing tip identifiers that Phylogeny[Rooted] correspond to the feature identifiers in the table. This tree can contain tip ids that are not present in the table, but all feature ids in the table must be present in this tree. [required]" name="iphylogeny" optional="False" type="data"/> + <param label="--p-metric: " name="pmetric" optional="False" type="select"> + <option value="faith_pd">faith_pd</option> + </param> + </inputs> + <outputs> + <data format="qza" label="${tool.name} on ${on_string}: alphadiversity.qza" name="oalphadiversity"/> + </outputs> + <help><![CDATA[ + + ]]></help> +<macros> + <import>qiime_citation.xml</import> +</macros> +<expand macro="qiime_citation"/> +</tool> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_diversity_alpha-rarefaction.xml --- a/qiime2/qiime_diversity_alpha-rarefaction.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_diversity_alpha-rarefaction.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -8,7 +8,11 @@ qiime diversity alpha-rarefaction --i-table=$itable ---p-max-depth="$pmaxdepth" + + +#if str($pmaxdepth): + --p-max-depth="$pmaxdepth" +#end if #if str($iphylogeny) != 'None': --i-phylogeny=$iphylogeny @@ -19,15 +23,15 @@ #end if -#if $pmindepth: +#if str($pmindepth): --p-min-depth=$pmindepth #end if -#if $psteps: +#if str($psteps): --p-steps=$psteps #end if -#if $piterations: +#if str($piterations): --p-iterations=$piterations #end if @@ -35,7 +39,7 @@ #def list_dict_to_string(list_dict): #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') #for d in list_dict[1:]: - #set $file_list = $file_list + ',' + d['additional_input'].__getattr__('file_name') + #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') #end for #return $file_list #end def |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_diversity_beta-correlation.xml --- a/qiime2/qiime_diversity_beta-correlation.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_diversity_beta-correlation.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -8,39 +8,62 @@ qiime diversity beta-correlation --i-distance-matrix=$idistancematrix + + + +#if '__sq__' in str($mmetadatacolumn): + #set $mmetadatacolumn_temp = $mmetadatacolumn.replace('__sq__', "'") + #set $mmetadatacolumn = $mmetadatacolumn_temp +#end if + --m-metadata-column="$mmetadatacolumn" + + #if str($pmethod) != 'None': --p-method=$pmethod #end if -#if $ppermutations: +#if str($ppermutations): --p-permutations=$ppermutations #end if -#if $pintersectids: +#if str($pintersectids): --p-intersect-ids #end if + + + +#if '__sq__' in str($plabel1): + #set $plabel1_temp = $plabel1.replace('__sq__', "'") + #set $plabel1 = $plabel1_temp +#end if + #if str($plabel1): --p-label1="$plabel1" #end if + + +#if '__sq__' in str($plabel2): + #set $plabel2_temp = $plabel2.replace('__sq__', "'") + #set $plabel2 = $plabel2_temp +#end if + #if str($plabel2): --p-label2="$plabel2" #end if -#if $input_files_mmetadatafile: -#def list_dict_to_string(list_dict): -#set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') -#for d in list_dict[1:]: - #set $file_list = $file_list + ',' + d['additional_input'].__getattr__('file_name') -#end for -#return $file_list -#end def ---m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) + + +#if $metadatafile: + --m-metadata-file=$metadatafile #end if + + + --o-metadata-distance-matrix=ometadatadistancematrix --o-mantel-scatter-visualization=omantelscattervisualization ; @@ -59,11 +82,11 @@ </param> <param label="--p-permutations: INTEGER Range(0, None) The number of permutations to be run when computing p-values. Supplying a value of zero will disable permutation testing and p-values will not be calculated (this results in *much* quicker execution time if p-values are not desired). [default: 999]" name="ppermutations" optional="True" type="integer" min="0" value="999"/> <param label="--p-intersect-ids: --p-no-intersect-ids If supplied, IDs that are not found in both distance matrices will be discarded before applying the Mantel test. Default behavior is to error on any mismatched IDs. [default: False]" name="pintersectids" selected="False" type="boolean"/> - <param label="--p-label1: TEXT Label for `distance-matrix` in the output visualization. [default: 'Metadata']" name="plabel1" optional="True" type="text" value="'Metadata'"/> - <param label="--p-label2: TEXT Label for `metadata-distance-matrix` in the output visualization. [default: 'Distance Matrix']" name="plabel2" optional="True" type="text" value="'Distance Matrix'"/> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> - <param label="--m-metadata-file" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> - </repeat> + <param label="--p-label1: TEXT Label for `distance-matrix` in the output visualization. [default: 'Metadata']" name="plabel1" optional="True" type="text" value="Metadata"/> + <param label="--p-label2: TEXT Label for `metadata-distance-matrix` in the output visualization. [default: 'Distance Matrix']" name="plabel2" optional="True" type="text" value="Distance Matrix"/> + + <param label="--m-metadata-file METADATA" name="metadatafile" type="data" format="tabular,qza,no_unzip.zip" optional="True" /> + </inputs> <outputs> <data format="qza" label="${tool.name} on ${on_string}: metadatadistancematrix.qza" name="ometadatadistancematrix"/> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_diversity_beta-group-significance.xml --- a/qiime2/qiime_diversity_beta-group-significance.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_diversity_beta-group-significance.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -12,19 +12,11 @@ -#if $input_files_mmetadatafile: -#def list_dict_to_string(list_dict): - #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') - #for d in list_dict[1:]: - #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') - #end for - #return $file_list -#end def - --m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) +#if $metadatafile: + --m-metadata-file=$metadatafile #end if - #if str($pmethod) != 'None': --p-method=$pmethod #end if @@ -33,7 +25,7 @@ --p-pairwise #end if -#if $ppermutations: +#if str($ppermutations): --p-permutations=$ppermutations #end if @@ -55,9 +47,7 @@ <param label="--p-pairwise: --p-no-pairwise Perform pairwise tests between all pairs of groups in addition to the test across all groups. This can be very slow if there are a lot of groups in the metadata column. [default: False]" name="ppairwise" selected="False" type="boolean"/> <param label="--p-permutations: INTEGER The number of permutations to be run when computing p-values. [default: 999]" name="ppermutations" optional="True" type="integer" value="999"/> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> - <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> - </repeat> + <param label="--m-metadata-file METADATA [required]" name="metadatafile" type="data" format="tabular,qza,no_unzip.zip" optional="False" /> </inputs> <outputs> <data format="html" label="${tool.name} on ${on_string}: visualization.qzv" name="ovisualization"/> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_diversity_beta-phylogenetic-alt.xml --- a/qiime2/qiime_diversity_beta-phylogenetic-alt.xml Wed Jul 17 01:53:11 2019 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| [ |
| @@ -1,112 +0,0 @@ -<?xml version="1.0" ?> -<tool id="qiime_diversity_beta-phylogenetic-alt" name="qiime diversity beta-phylogenetic-alt" version="2018.4"> - <description> - Beta diversity (phylogenetic) - High Performance Computation</description> - <requirements> - <requirement type="package" version="2018.4">qiime2</requirement> - </requirements> - <command><![CDATA[ - - qiime diversity beta-phylogenetic-alt --i-table=$itable --i-phylogeny=$iphylogeny --p-metric=$pmetric - - #if str($cmdconfig) != 'None': - --cmd-config=$cmdconfig - #end if - - #if $pbypasstips: - --p-bypass-tips - #else - --p-no-bypass-tips - #end if - - #set $pnjobs = '${GALAXY_SLOTS:-4}' - - #if str($pnjobs): - --p-n-jobs="$pnjobs" - #end if - - --o-distance-matrix=odistancematrix - - #if $pvarianceadjusted: - --p-variance-adjusted - #else - --p-no-variance-adjusted - #end if - - #if str($palpha): - --p-alpha="$palpha" - #end if - ; - cp odistancematrix.qza $odistancematrix; - ]]></command> - <inputs> - <param format="qza,no_unzip.zip" label="--i-table: FeatureTable[Frequency] The feature table containing the samples over which beta diversity should be computed. [required]" name="itable" optional="False" type="data"/> - <param format="qza,no_unzip.zip" label="--i-phylogeny: Phylogeny[Rooted] Phylogenetic tree containing tip identifiers that correspond to the feature identifiers in the table. This tree can contain tip ids that are not present in the table, but all feature ids in the table must be present in this tree. [required]" name="iphylogeny" optional="False" type="data"/> - <param label="--p-metric: The beta diversity metric to be computed. - [required]" name="pmetric" optional="False" type="select"> - <option selected="True" value="generalized_unifrac">generalized_unifrac</option> - <option value="weighted_unifrac">weighted_unifrac</option> - <option value="weighted_normalized_unifrac">weighted_normalized_unifrac</option> - <option value="unweighted_unifrac">unweighted_unifrac</option> - </param> - <param label="--p-variance-adjusted: --p-no-variance-adjusted Perform variance adjustment based on Chang et al. BMC Bioinformatics 2011. Weights distances based on the proportion of the relative abundance represented between the samples at a given node under evaluation. [default: False]" name="pvarianceadjusted" checked="False" type="boolean"/> - <param label="--p-alpha: This parameter is only used when the choice of metric is generalized_unifrac. The value of alpha controls importance of sample proportions. 1.0 is weighted normalized UniFrac. 0.0 is close to unweighted UniFrac, but only if the sample proportions are dichotomized. [optional]" name="palpha" optional="True" type="text"/> - <param label="--p-bypass-tips: --p-no-bypass-tips In a bifurcating tree, the tips make up about 50% of the nodes in a tree. By ignoring them, specificity can be traded for reduced compute time. This has the effect of collapsing the phylogeny, and is analogous (in concept) to moving from 99% to 97% OTUs [default: False]" name="pbypasstips" checked="False" type="boolean"/> - <param label="--cmd-config: Use config file for command options" name="cmdconfig" optional="True" type="data"/> - </inputs> - <outputs> - <data format="qza" label="${tool.name} on ${on_string}: distance-matrix.qza" name="odistancematrix"/> - </outputs> - <help> - <![CDATA[ -Beta diversity (phylogenetic) - High Performance Computation -------------------------------------------------------------- - -Computes a user-specified phylogenetic beta diversity metric for all pairs -of samples in a feature table. This implementation is recommended for large -datasets, otherwise the results are identical to beta_phylogenetic. This -method is an implementation of the Strided State UniFrac algorithm. -Multiple variants of the UniFrac metric are available, including -Generalized UniFrac (Chen et al. 2012), Variance Adjusted UniFrac (Chang et -al. 2011), as well as Weighted normalized and unnormalized UniFrac -(Lozupone et al. 2007) and unweighted UniFrac (Lozupone et al. 2005) - -Parameters ----------- -table : FeatureTable[Frequency] - The feature table containing the samples over which beta diversity - should be computed. -phylogeny : Phylogeny[Rooted] - Phylogenetic tree containing tip identifiers that correspond to the - feature identifiers in the table. This tree can contain tip ids that - are not present in the table, but all feature ids in the table must be - present in this tree. -metric : Str % Choices({'generalized_unifrac', 'unweighted_unifrac', 'weighted_normalized_unifrac', 'weighted_unifrac'}) - The beta diversity metric to be computed. -variance_adjusted : Bool, optional - Perform variance adjustment based on Chang et al. BMC Bioinformatics - 2011. Weights distances based on the proportion of the relative - abundance represented between the samples at a given node under - evaluation. -alpha : Float % Range(0, 1, inclusive_end=True), optional - This parameter is only used when the choice of metric is - generalized_unifrac. The value of alpha controls importance of sample - proportions. 1.0 is weighted normalized UniFrac. 0.0 is close to - unweighted UniFrac, but only if the sample proportions are - dichotomized. -bypass_tips : Bool, optional - In a bifurcating tree, the tips make up about 50% of the nodes in a - tree. By ignoring them, specificity can be traded for reduced compute - time. This has the effect of collapsing the phylogeny, and is analogous - (in concept) to moving from 99% to 97% OTUs - -Returns -------- -distance_matrix : DistanceMatrix % Properties(['phylogenetic']) - The resulting distance matrix. - ]]> - </help> -<macros> - <import>qiime_citation.xml</import> -</macros> -<expand macro="qiime_citation" /> -</tool> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_diversity_beta-rarefaction.xml --- a/qiime2/qiime_diversity_beta-rarefaction.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_diversity_beta-rarefaction.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -8,15 +8,20 @@ qiime diversity beta-rarefaction --i-table=$itable + --p-metric=$pmetric + --p-clustering-method=$pclusteringmethod ---p-sampling-depth="$psamplingdepth" + +#if str($psamplingdepth): + --p-sampling-depth="$psamplingdepth" +#end if #if str($iphylogeny) != 'None': --i-phylogeny=$iphylogeny #end if -#if $piterations: +#if str($piterations): --p-iterations=$piterations #end if @@ -28,20 +33,19 @@ --p-color-scheme=$pcolorscheme #end if +#if $input_files_mmetadatafile: #def list_dict_to_string(list_dict): #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') #for d in list_dict[1:]: - #set $file_list = $file_list + ',' + d['additional_input'].__getattr__('file_name') + #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') #end for #return $file_list #end def - --m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) - +#end if --o-visualization=ovisualization ; -cp mmetadatafile.qza $mmetadatafile; qiime tools export --input-path ovisualization.qzv --output-path out && mkdir -p '$ovisualization.files_path' && cp -r out/* '$ovisualization.files_path' && mv '$ovisualization.files_path/index.html' '$ovisualization'; @@ -109,7 +113,7 @@ <option value="RdYlGn_r">RdYlGn_r</option> </param> - <repeat name="input_files_mmetadatafile" optional="False" title="--m-metadata-file"> + <repeat name="input_files_mmetadatafile" optional="False" title="--m-metadata-file [required]"> <param label="--m-metadata-file: METADATA... (multiple arguments will be merged) The sample metadata used for the Emperor jackknifed PCoA plot. [required]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_diversity_beta.xml --- a/qiime2/qiime_diversity_beta.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_diversity_beta.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -8,9 +8,10 @@ qiime diversity beta --i-table=$itable + --p-metric=$pmetric -#if $ppseudocount: +#if str($ppseudocount): --p-pseudocount=$ppseudocount #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_diversity_bioenv.xml --- a/qiime2/qiime_diversity_bioenv.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_diversity_bioenv.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -24,7 +24,6 @@ --o-visualization=ovisualization ; -cp mmetadatafile.qza $mmetadatafile; qiime tools export --input-path ovisualization.qzv --output-path out && mkdir -p '$ovisualization.files_path' && cp -r out/* '$ovisualization.files_path' && mv '$ovisualization.files_path/index.html' '$ovisualization'; @@ -32,7 +31,7 @@ <inputs> <param format="qza,no_unzip.zip" label="--i-distance-matrix: ARTIFACT DistanceMatrix Matrix of distances between pairs of samples. [required]" name="idistancematrix" optional="False" type="data"/> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> + <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file [required]"> <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_diversity_core-metrics-phylogenetic.xml --- a/qiime2/qiime_diversity_core-metrics-phylogenetic.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_diversity_core-metrics-phylogenetic.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -9,22 +9,28 @@ --i-table=$itable --i-phylogeny=$iphylogeny ---p-sampling-depth="$psamplingdepth" + +#if str($psamplingdepth): + --p-sampling-depth="$psamplingdepth" +#end if #set $pnjobs = '${GALAXY_SLOTS:-4}' #if str($pnjobs): --p-n-jobs="$pnjobs" #end if + +#if $input_files_mmetadatafile: #def list_dict_to_string(list_dict): #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') #for d in list_dict[1:]: - #set $file_list = $file_list + ',' + d['additional_input'].__getattr__('file_name') + #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') #end for #return $file_list #end def +--m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) +#end if ---m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) --o-rarefied-table=orarefiedtable @@ -76,8 +82,8 @@ <param format="qza,no_unzip.zip" label="--i-phylogeny: ARTIFACT Phylogenetic tree containing tip identifiers that Phylogeny[Rooted] correspond to the feature identifiers in the table. This tree can contain tip ids that are not present in the table, but all feature ids in the table must be present in this tree. [required]" name="iphylogeny" optional="False" type="data"/> <param label="--p-sampling-depth: INTEGER Range(1, None) The total frequency that each sample should be rarefied to prior to computing diversity metrics. [required]" name="psamplingdepth" optional="False" min="1" value="" type="integer"/> - <repeat name="input_files_mmetadatafile" optional="False" title="--m-metadata-file"> - <param label="--m-metadata-file: (multiple arguments will be merged) The sample metadata to use in the emperor plots. [required]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> + <repeat name="input_files_mmetadatafile" optional="False" title="--m-metadata-file [required]"> + <param label="--m-metadata-file: (multiple arguments will be merged) The sample metadata to use in the emperor plots. [required]" name="additional_input" optional="False" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> </inputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_diversity_core-metrics.xml --- a/qiime2/qiime_diversity_core-metrics.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_diversity_core-metrics.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -8,23 +8,26 @@ qiime diversity core-metrics --i-table=$itable ---p-sampling-depth="$psamplingdepth" + +#if str($psamplingdepth): + --p-sampling-depth="$psamplingdepth" +#end if #set $pnjobs = '${GALAXY_SLOTS:-4}' #if str($pnjobs): --p-n-jobs="$pnjobs" #end if +#if $input_files_mmetadatafile: #def list_dict_to_string(list_dict): #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') #for d in list_dict[1:]: - #set $file_list = $file_list + ',' + d['additional_input'].__getattr__('file_name') + #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') #end for #return $file_list #end def - --m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) - +#end if --o-rarefied-table=orarefiedtable --o-observed-otus-vector=oobservedotusvector @@ -56,7 +59,7 @@ <param format="qza,no_unzip.zip" label="--i-table: ARTIFACT FeatureTable[Frequency] The feature table containing the samples over which diversity metrics should be computed. [required]" name="itable" optional="False" type="data"/> <param label="--p-sampling-depth: INTEGER Range(1, None) The total frequency that each sample should be rarefied to prior to computing diversity metrics. [required]" name="psamplingdepth" optional="False" min="1" value="" type="integer"/> - <repeat name="input_files_mmetadatafile" optional="False" title="--m-metadata-file"> + <repeat name="input_files_mmetadatafile" optional="False" title="--m-metadata-file [required]"> <param label="--m-metadata-file: METADATA... (multiple arguments will be merged) The sample metadata to use in the emperor plots. [required]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_diversity_filter-distance-matrix.xml --- a/qiime2/qiime_diversity_filter-distance-matrix.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_diversity_filter-distance-matrix.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -45,7 +45,7 @@ <param label="--p-where: TEXT SQLite WHERE clause specifying sample metadata criteria that must be met to be included in the filtered distance matrix. If not provided, all samples in `metadata` that are also in the input distance matrix will be retained. [optional]" name="pwhere" optional="True" type="text"/> <param label="--p-exclude-ids: --p-no-exclude-ids If `True`, the samples selected by `metadata` or `where` parameters will be excluded from the filtered distance matrix instead of being retained. [default: False]" name="pexcludeids" selected="False" type="boolean"/> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> + <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file [required]"> <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_diversity_mantel.xml --- a/qiime2/qiime_diversity_mantel.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_diversity_mantel.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -14,7 +14,7 @@ --p-method=$pmethod #end if -#if $ppermutations: +#if str($ppermutations): --p-permutations=$ppermutations #end if @@ -22,14 +22,30 @@ --p-intersect-ids #end if + + +#if '__sq__' in str($plabel1): + #set $plabel1_temp = $plabel1.replace('__sq__', "'") + #set $plabel1 = $plabel1_temp +#end if + #if str($plabel1): --p-label1="$plabel1" #end if + + +#if '__sq__' in str($plabel2): + #set $plabel2_temp = $plabel2.replace('__sq__', "'") + #set $plabel2 = $plabel2_temp +#end if + #if str($plabel2): --p-label2="$plabel2" #end if + + --o-visualization=ovisualization ; qiime tools export --input-path ovisualization.qzv --output-path out && mkdir -p '$ovisualization.files_path' @@ -46,8 +62,8 @@ </param> <param label="--p-permutations: INTEGER Range(0, None) The number of permutations to be run when computing p-values. Supplying a value of zero will disable permutation testing and p-values will not be calculated (this results in *much* quicker execution time if p-values are not desired). [default: 999]" name="ppermutations" optional="True" type="integer" min="0" value="999"/> <param label="--p-intersect-ids: --p-no-intersect-ids If supplied, IDs that are not found in both distance matrices will be discarded before applying the Mantel test. Default behavior is to error on any mismatched IDs. [default: False]" name="pintersectids" selected="False" type="boolean"/> - <param label="--p-label1: TEXT Label for `dm1` in the output visualization. [default: 'Distance Matrix 1']" name="plabel1" optional="True" type="text" value="'Distance Matrix 1'"/> - <param label="--p-label2: TEXT Label for `dm2` in the output visualization. [default: 'Distance Matrix 2']" name="plabel2" optional="True" type="text" value="'Distance Matrix 2'"/> + <param label="--p-label1: TEXT Label for `dm1` in the output visualization. [default: 'Distance Matrix 1']" name="plabel1" optional="True" type="text" value="Distance Matrix 1"/> + <param label="--p-label2: TEXT Label for `dm2` in the output visualization. [default: 'Distance Matrix 2']" name="plabel2" optional="True" type="text" value="Distance Matrix 2"/> </inputs> <outputs> <data format="html" label="${tool.name} on ${on_string}: visualization.qzv" name="ovisualization"/> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_diversity_procrustes-analysis.xml --- a/qiime2/qiime_diversity_procrustes-analysis.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_diversity_procrustes-analysis.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -10,7 +10,7 @@ --i-reference=$ireference --i-other=$iother -#if $pdimensions: +#if str($pdimensions): --p-dimensions=$pdimensions #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_emperor_biplot.xml --- a/qiime2/qiime_emperor_biplot.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_emperor_biplot.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -10,23 +10,37 @@ --i-biplot=$ibiplot -#def list_dict_to_string(list_dict): +#if $m_sample_metadatafile: +#def list_dict_to_string_sample_mdata(list_dict): #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') #for d in list_dict[1:]: - #set $file_list = $file_list + ',' + d['additional_input'].__getattr__('file_name') + #set $file_list = $file_list + ' --m-sample-metadata-file=' + d['additional_input'].__getattr__('file_name') #end for #return $file_list #end def +--m-sample-metadata-file=$list_dict_to_string_sample_mdata($m_sample_metadatafile) +#end if ---m-sample-metadata-file=$list_dict_to_string($m_sample_metadatafile) ---m-feature-metadata-file=$list_dict_to_string($m_feature_metadatafile) + + +#if $m_feature_metadatafile: +#def list_dict_to_string_feature_mdata(list_dict): +#set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') +#for d in list_dict[1:]: + #set $file_list = $file_list + ' --m-feature-metadata-file=' + d['additional_input'].__getattr__('file_name') +#end for +#return $file_list +#end def +--m-feature-metadata-file=$list_dict_to_string_feature_mdata($m_feature_metadatafile) +#end if + #if $pignoremissingsamples: --p-ignore-missing-samples #end if -#if $pnumberoffeatures: +#if str($pnumberoffeatures): --p-number-of-features=$pnumberoffeatures #end if @@ -41,11 +55,11 @@ <param label="--p-ignore-missing-samples: --p-no-ignore-missing-samples This will suppress the error raised when the coordinates matrix contains samples that are not present in the metadata. Samples without metadata are included by setting all metadata values to: 'This sample has no metadata'. This flag is only applied if at least one sample is present in both the coordinates matrix and the metadata. [default: False]" name="pignoremissingsamples" selected="False" type="boolean"/> <param label="--p-number-of-features: INTEGER Range(1, None) The number of most important features (arrows) to display in the ordination. [default: 5]" name="pnumberoffeatures" optional="True" type="integer" min="1" value="5"/> - <repeat name="m_sample_metadatafile" optional="False" title="--m-metadata-file"> + <repeat name="m_sample_metadatafile" optional="False" title="--m-sample-metadata-file [required]"> <param label="--m-sample-metadata-file: (multiple arguments will be merged) The sample metadata. [required]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> - <repeat name="m_feature_metadatafile" optional="True" title="--m-metadata-file"> + <repeat name="m_feature_metadatafile" optional="True" title="--m-feature-metadata-file"> <param label="--m-feature-metadata-file: (multiple arguments will be merged) The feature metadata (useful to manipulate the arrows in the plot). [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_emperor_plot.xml --- a/qiime2/qiime_emperor_plot.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_emperor_plot.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -41,7 +41,7 @@ <param label="--p-custom-axes: TEXT... List[Str] Numeric sample metadata columns that should be included as axes in the Emperor plot. [optional]" name="pcustomaxes" optional="True" type="text"/> <param label="--p-ignore-missing-samples: --p-no-ignore-missing-samples This will suppress the error raised when the coordinates matrix contains samples that are not present in the metadata. Samples without metadata are included by setting all metadata values to: 'This sample has no metadata'. This flag is only applied if at least one sample is present in both the coordinates matrix and the metadata. [default: False]" name="pignoremissingsamples" selected="False" type="boolean"/> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> + <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file [required]"> <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_emperor_procrustes-plot.xml --- a/qiime2/qiime_emperor_procrustes-plot.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_emperor_procrustes-plot.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -8,6 +8,7 @@ qiime emperor procrustes-plot --i-reference-pcoa=$ireferencepcoa + --i-other-pcoa=$iotherpcoa @@ -24,10 +25,23 @@ +#if '__sq__' in str($pcustomaxes): + #set $pcustomaxes_temp = $pcustomaxes.replace('__sq__', "'") + #set $pcustomaxes = $pcustomaxes_temp +#end if + +#if '__cb__' in str($pcustomaxes): + #set $pcustomaxes_temp = $pcustomaxes.replace('__cb__', "]") + #set $pcustomaxes = $pcustomaxes_temp +#end if + #if str($pcustomaxes): --p-custom-axes="$pcustomaxes" #end if + + + #if $pignoremissingsamples: --p-ignore-missing-samples #end if @@ -44,7 +58,7 @@ <param label="--p-custom-axes: TEXT... List[Str] Numeric sample metadata columns that should be included as axes in the Emperor plot. [optional]" name="pcustomaxes" optional="True" type="text"/> <param label="--p-ignore-missing-samples: --p-no-ignore-missing-samples This will suppress the error raised when the coordinates matrix contains samples that are not present in the metadata. Samples without metadata are included by setting all metadata values to: 'This sample has no metadata'. This flag is only applied if at least one sample is present in both the coordinates matrix and the metadata. [default: False]" name="pignoremissingsamples" selected="False" type="boolean"/> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> + <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file [required]"> <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_feature-classifier_classify-consensus-blast.xml --- a/qiime2/qiime_feature-classifier_classify-consensus-blast.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_feature-classifier_classify-consensus-blast.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -19,15 +19,15 @@ #end if -#if $pmaxaccepts: +#if str($pmaxaccepts): --p-maxaccepts=$pmaxaccepts #end if -#if $ppercidentity: +#if str($ppercidentity): --p-perc-identity=$ppercidentity #end if -#if $pquerycov: +#if str($pquerycov): --p-query-cov=$pquerycov #end if @@ -35,18 +35,29 @@ --p-strand=$pstrand #end if -#if $pevalue: +#if str($pevalue): --p-evalue=$pevalue #end if -#if $pminconsensus: +#if str($pminconsensus): --p-min-consensus=$pminconsensus #end if + + + + +#if '__sq__' in str($punassignablelabel): + #set $punassignablelabel_temp = $punassignablelabel.replace('__sq__', "'") + #set $punassignablelabel = $punassignablelabel_temp +#end if + #if str($punassignablelabel): --p-unassignable-label="$punassignablelabel" #end if + + --o-classification=oclassification ; cp oclassification.qza $oclassification @@ -81,7 +92,7 @@ </param> <param label="--p-evalue: NUMBER BLAST expectation value (E) threshold for saving hits. [default: 0.001]" name="pevalue" optional="True" type="float" value="0.001"/> <param label="--p-min-consensus: NUMBER Range(0.5, 1.0, inclusive_start=False, inclusive_end=True) Minimum fraction of assignments must match top hit to be accepted as consensus assignment. Must be in range (0.5, 1.0]. [default: 0.51]" name="pminconsensus" optional="True" type="float" min="0.5" max="1" exclude_min="True" exclude_max="False" value="0.51"/> - <param label="--p-unassignable-label: TEXT [default: 'Unassigned']" name="punassignablelabel" optional="True" type="text" value="'Unassigned'"/> + <param label="--p-unassignable-label: TEXT [default: 'Unassigned']" name="punassignablelabel" optional="True" type="text" value="Unassigned"/> </inputs> <outputs> <data format="qza" label="${tool.name} on ${on_string}: classification.qza" name="oclassification"/> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_feature-classifier_classify-consensus-vsearch.xml --- a/qiime2/qiime_feature-classifier_classify-consensus-vsearch.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_feature-classifier_classify-consensus-vsearch.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -20,15 +20,16 @@ #end if -#if $pmaxaccepts: + +#if str($pmaxaccepts): --p-maxaccepts=$pmaxaccepts #end if -#if $ppercidentity: +#if str($ppercidentity): --p-perc-identity=$ppercidentity #end if -#if $pquerycov: +#if str($pquerycov): --p-query-cov=$pquerycov #end if @@ -36,14 +37,26 @@ --p-strand=$pstrand #end if -#if $pminconsensus: +#if str($pminconsensus): --p-min-consensus=$pminconsensus #end if + + + + +#if '__sq__' in str($punassignablelabel): + #set $punassignablelabel_temp = $punassignablelabel.replace('__sq__', "'") + #set $punassignablelabel = $punassignablelabel_temp +#end if + #if str($punassignablelabel): --p-unassignable-label="$punassignablelabel" #end if + + + #set $pthreads = '${GALAXY_SLOTS:-4}' #if str($pthreads): --p-threads="$pthreads" @@ -81,7 +94,7 @@ <option value="plus">plus</option> </param> <param label="--p-min-consensus: NUMBER Range(0.5, 1.0, inclusive_start=False, inclusive_end=True) Minimum fraction of assignments must match top hit to be accepted as consensus assignment. Must be in range (0.5, 1.0]. [default: 0.51]" name="pminconsensus" optional="True" type="float" min="0.5" max="1" exclude_min="True" exclude_max="False" value="0.51"/> - <param label="--p-unassignable-label: TEXT [default: 'Unassigned']" name="punassignablelabel" optional="True" type="text" value="'Unassigned'"/> + <param label="--p-unassignable-label: TEXT [default: 'Unassigned']" name="punassignablelabel" optional="True" type="text" value="Unassigned"/> </inputs> <outputs> <data format="qza" label="${tool.name} on ${on_string}: classification.qza" name="oclassification"/> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_feature-classifier_classify-hybrid-vsearch-sklearn.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/qiime2/qiime_feature-classifier_classify-hybrid-vsearch-sklearn.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -0,0 +1,116 @@ +<?xml version="1.0" ?> +<tool id="qiime_feature-classifier_classify-hybrid-vsearch-sklearn" name="qiime feature-classifier classify-hybrid-vsearch-sklearn" version="2019.7"> + <description> - ALPHA Hybrid classifier: VSEARCH exact match + sklearn classifier</description> + <requirements> + <requirement type="package" version="2019.7">qiime2</requirement> + </requirements> + <command><![CDATA[ +qiime feature-classifier classify-hybrid-vsearch-sklearn + +--i-query=$iquery +--i-reference-reads=$ireferencereads +--i-reference-taxonomy=$ireferencetaxonomy +--i-classifier=$iclassifier + +#if str($pmaxaccepts) != 'None': + --p-maxaccepts=$pmaxaccepts +#end if + +#if str($ppercidentity): + --p-perc-identity=$ppercidentity +#end if + +#if str($pquerycov): + --p-query-cov=$pquerycov +#end if + +#if str($pstrand) != 'None': + --p-strand=$pstrand +#end if + +#if str($pminconsensus): + --p-min-consensus=$pminconsensus +#end if + +#if str($pconfidence) != 'None': + --p-confidence=$pconfidence +#end if + +#if str($preadorientation) != 'None': + --p-read-orientation=$preadorientation +#end if + +#set $pthreads = '${GALAXY_SLOTS:-4}' + +#if str($pthreads): + +#if str($pthreads): + --p-threads="$pthreads" +#end if + +#end if + + +#if $pprefilter: + --p-prefilter +#end if + +#if str($psamplesize): + --p-sample-size=$psamplesize +#end if + +#if str($prandseed): + --p-randseed=$prandseed +#end if + + +--o-classification=oclassification + +; +cp oclassification.qza $oclassification + ]]></command> + <inputs> + <param format="qza,no_unzip.zip" label="--i-query: ARTIFACT FeatureData[Sequence] Sequences to classify taxonomically. [required]" name="iquery" optional="False" type="data"/> + <param format="qza,no_unzip.zip" label="--i-reference-reads: ARTIFACT FeatureData[Sequence] reference sequences. [required]" name="ireferencereads" optional="False" type="data"/> + <param format="qza,no_unzip.zip" label="--i-reference-taxonomy: ARTIFACT FeatureData[Taxonomy] reference taxonomy labels. [required]" name="ireferencetaxonomy" optional="False" type="data"/> + <param format="qza,no_unzip.zip" label="--i-classifier: ARTIFACT TaxonomicClassifier Pre-trained sklearn taxonomic classifier for classifying the reads. [required]" name="iclassifier" optional="False" type="data"/> + <param label="--p-maxaccepts: " name="pmaxaccepts" optional="True" type="select"> + <option selected="True" value="None">Selection is Optional</option> + <option value="Int % Range(1">Int % Range(1</option> + <option value="None">None</option> + </param> + <param label="--p-perc-identity: PROPORTION Range(0.0, 1.0, inclusive_end=True) Percent sequence similarity to use for PREFILTER. Reject match if percent identity to query is lower. Set to a lower value to perform a rough pre-filter. This parameter is ignored if `prefilter` is disabled. [default: 0.5]" name="ppercidentity" optional="True" type="float" value="0.5"/> + <param label="--p-query-cov: PROPORTION Range(0.0, 1.0, inclusive_end=True) Query coverage threshold to use for PREFILTER. Reject match if query alignment coverage per high-scoring pair is lower. Set to a lower value to perform a rough pre-filter. This parameter is ignored if `prefilter` is disabled. [default: 0.8]" name="pquerycov" optional="True" type="float" value="0.8"/> + <param label="--p-strand: " name="pstrand" optional="True" type="select"> + <option selected="True" value="None">Selection is Optional</option> + <option value="both">both</option> + <option value="plus">plus</option> + </param> + <param label="--p-min-consensus: NUMBER Range(0.5, 1.0, inclusive_start=False, inclusive_end=True) Minimum fraction of assignments must match top hit to be accepted as consensus assignment. [default: 0.51]" name="pminconsensus" optional="True" type="float" value="0.51"/> + <param label="--p-confidence: " name="pconfidence" optional="True" type="select"> + <option selected="True" value="None">Selection is Optional</option> + <option value="Float % Range(0">Float % Range(0</option> + <option value="1">1</option> + <option value="inclusive_end=True">inclusive_end=True</option> + </param> + <param label="--p-read-orientation: " name="preadorientation" optional="True" type="select"> + <option selected="True" value="None">Selection is Optional</option> + <option value="same">same</option> + <option value="reverse-complement">reverse-complement</option> + <option value="auto">auto</option> + </param> + <param label="--p-prefilter: --p-no-prefilter Toggle positive filter of query sequences on or off. [default: True]" name="pprefilter" selected="False" type="boolean"/> + <param label="--p-sample-size: INTEGER Range(1, None) Randomly extract the given number of sequences from the reference database to use for prefiltering. This parameter is ignored if `prefilter` is disabled. [default: 1000]" name="psamplesize" optional="True" type="integer" value="1000"/> + <param label="--p-randseed: INTEGER Use integer as a seed for the pseudo-random generator Range(0, None) used during prefiltering. A given seed always produces the same output, which is useful for replicability. Set to 0 to use a pseudo-random seed. This parameter is ignored if `prefilter` is disabled. [default: 0]" name="prandseed" optional="True" type="integer" value="0"/> + </inputs> + <outputs> + <data format="qza" label="${tool.name} on ${on_string}: classification.qza" name="oclassification"/> + </outputs> + <help><![CDATA[ + + ]]></help> +<macros> + <import>qiime_citation.xml</import> +</macros> +<expand macro="qiime_citation"/> +</tool> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_feature-classifier_classify-sklearn.xml --- a/qiime2/qiime_feature-classifier_classify-sklearn.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_feature-classifier_classify-sklearn.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -7,8 +7,17 @@ <command><![CDATA[ qiime feature-classifier classify-sklearn + +#if str( $id_to_classifier_fp.selector ) == 'history' +#set $classifier = $id_to_classifier_fp.classifier_fp +--i-classifier '$classifier' +#else: +#set $classifier = $id_to_classifier_fp.classifier_fp.fields.path +--i-classifier '$classifier' +#end if + + --i-reads=$ireads ---i-classifier=$iclassifier #set $pnjobs = '${GALAXY_SLOTS:-4}' @@ -17,8 +26,10 @@ #end if -#if $pconfidence: - --p-confidence=$pconfidence +#if str($pconfidence) != '': + #if float($pconfidence) >= 0.0: + --p-confidence=$pconfidence + #end if #end if #if str($preadorientation) != 'None': @@ -30,8 +41,22 @@ cp oclassification.qza $oclassification ]]></command> <inputs> + <conditional name="id_to_classifier_fp" optional="True"> + <param name="selector" type="select" label="Reference classifier to query"> + <option value="cached">Public classifiers</option> + <option value="history">Classifiers from your history</option> + </param> + <when value="cached"> + <param name="classifier_fp" label="Reference classifier" type="select" optional="True"> + <options from_data_table="qiime_rep_set" /> + </param> + </when> + <when value="history"> + <param name="classifier_fp" type="data" format="qza,no_unzip.zip" label="Reference classifier" optional="True" /> + </when> + </conditional> + <param format="qza,no_unzip.zip" label="--i-reads: ARTIFACT FeatureData[Sequence] The feature data to be classified. [required]" name="ireads" optional="False" type="data"/> - <param format="qza,no_unzip.zip" label="--i-classifier: ARTIFACT TaxonomicClassifier The taxonomic classifier for classifying the reads. [required]" name="iclassifier" optional="False" type="data"/> <param label="--p-confidence: NUMBER Confidence threshold for limiting taxonomic depth. Provide -1 to disable confidence calculation, or 0 to calculate confidence but not apply it to limit the taxonomic depth of the assignments. [default: 0.7]" name="pconfidence" optional="True" type="float" value="0.7"/> <param label="--p-read-orientation: " name="preadorientation" optional="True" type="select"> <option selected="True" value="None">Selection is Optional</option> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_feature-classifier_extract-reads.xml --- a/qiime2/qiime_feature-classifier_extract-reads.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_feature-classifier_extract-reads.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -5,29 +5,41 @@ <requirement type="package" version="2019.4">qiime2</requirement> </requirements> <command><![CDATA[ + + +#if str( $input_sequences.selector ) == 'history' + #set $seq = $input_sequences.i_sequences + +#else: + qiime tools import --type 'FeatureData[Sequence]' --input-path '$input_sequences.i_sequences.fields.path' --output-path database.qza; + #set $seq = 'database.qza' +#end if + + qiime feature-classifier extract-reads ---i-sequences=$isequences +--i-sequences=$seq + --p-f-primer="$pfprimer" --p-r-primer="$prprimer" -#if $ptrunclen: +#if str($ptrunclen): --p-trunc-len=$ptrunclen #end if -#if $ptrimleft: +#if str($ptrimleft): --p-trim-left=$ptrimleft #end if -#if $pidentity: +#if str($pidentity): --p-identity=$pidentity #end if -#if $pminlength: +#if str($pminlength): --p-min-length=$pminlength #end if -#if $pmaxlength: +#if str($pmaxlength): --p-max-length=$pmaxlength #end if @@ -36,7 +48,21 @@ cp oreads.qza $oreads ]]></command> <inputs> - <param format="qza,no_unzip.zip" label="--i-sequences: ARTIFACT FeatureData[Sequence] [required]" name="isequences" optional="False" type="data"/> + <conditional name="input_sequences" optional="False"> + <param name="selector" type="select" label="--i-sequences: FeatureData[Sequence] [required] - Reference sequences to query"> + <option value="cached">Public databases</option> + <option value="history">Databases from your history</option> + </param> + <when value="cached"> + <param name="i_sequences" label="--i-sequences: FeatureData[Sequence] [required] - Reference sequences" type="select" optional="True"> + <options from_data_table="qiime_rep_set" /> + </param> + </when> + <when value="history"> + <param name="i_sequences" type="data" format="qza,no_unzip.zip" label="Reference databases" optional="True" /> + </when> + </conditional> + <param label="--p-f-primer: TEXT forward primer sequence [required]" name="pfprimer" optional="False" type="text"/> <param label="--p-r-primer: TEXT reverse primer sequence [required]" name="prprimer" optional="False" type="text"/> <param label="--p-trunc-len: INTEGER read is cut to trunc-len if trunc-len is positive. Applied before trim-left. [default: 0]" name="ptrunclen" optional="True" type="integer" value="0"/> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_feature-classifier_fit-classifier-naive-bayes.xml --- a/qiime2/qiime_feature-classifier_fit-classifier-naive-bayes.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_feature-classifier_fit-classifier-naive-bayes.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| b'@@ -5,36 +5,52 @@\n \t\t<requirement type="package" version="2019.4">qiime2</requirement>\n \t</requirements>\n \t<command><![CDATA[\n-qiime feature-classifier fit-classifier-naive-bayes\n-\n---i-reference-reads=$ireferencereads\n \n \n #if str( $id_to_taxonomy_fp.selector ) == \'history\'\n \t#set $tax = $id_to_taxonomy_fp.taxonomy_fp\n-\t--i-reference-taxonomy \'$tax\'\n #else:\n-\t#set $tax = $id_to_taxonomy_fp.taxonomy_fp.fields.path\n-\t--i-reference-taxonomy \'$tax\'\n+\t#set $tax_path = $id_to_taxonomy_fp.taxonomy_fp.fields.path\n+\tqiime tools import --type \'FeatureData[Taxonomy]\' --source-format HeaderlessTSVTaxonomyFormat --input-path $tax_path --output-path ref-taxonomy.qza;\n+\t#set $tax=\'ref-taxonomy.qza\'\n #end if\n \n \n+qiime feature-classifier fit-classifier-naive-bayes\n+\n+\n+--i-reference-taxonomy \'$tax\'\n+\n+\n+--i-reference-reads=$ireferencereads\n+\n #if str($iclassweight) != \'None\':\n --i-class-weight=$iclassweight\n #end if\n \n-#if $pclassifyalpha:\n+#if str($pclassifyalpha):\n --p-classify--alpha=$pclassifyalpha\n #end if\n \n-#if $pclassifychunksize:\n+#if str($pclassifychunksize):\n --p-classify--chunk-size=$pclassifychunksize\n #end if\n \n+\n+\n+\n+#if \'__sq__\' in str($pclassifyclassprior):\n+ #set $pclassifyclassprior_temp = $pclassifyclassprior.replace(\'__sq__\', "\'")\n+ #set $pclassifyclassprior = $pclassifyclassprior_temp\n+#end if\n+\n #if str($pclassifyclassprior):\n --p-classify--class-prior="$pclassifyclassprior"\n #end if\n \n+\n+\n+\n #if $pclassifyfitprior:\n --p-classify--fit-prior\n #end if\n@@ -43,34 +59,83 @@\n --p-feat-ext--alternate-sign\n #end if\n \n+\n+\n+\n+\n+#if \'__sq__\' in str($pfeatextanalyzer):\n+ #set $pfeatextanalyzer_temp = $pfeatextanalyzer.replace(\'__sq__\', "\'")\n+ #set $pfeatextanalyzer = $pfeatextanalyzer_temp\n+#end if\n+\n #if str($pfeatextanalyzer):\n --p-feat-ext--analyzer="$pfeatextanalyzer"\n #end if\n \n+\n+\n+\n+\n #if $pfeatextbinary:\n --p-feat-ext--binary\n #end if\n \n+\n+\n+#if \'__sq__\' in str($pfeatextdecodeerror):\n+ #set $pfeatextdecodeerror_temp = $pfeatextdecodeerror.replace(\'__sq__\', "\'")\n+ #set $pfeatextdecodeerror = $pfeatextdecodeerror_temp\n+#end if\n+\n #if str($pfeatextdecodeerror):\n --p-feat-ext--decode-error="$pfeatextdecodeerror"\n #end if\n \n+\n+\n+\n+\n+#if \'__sq__\' in str($pfeatextencoding):\n+ #set $pfeatextencoding_temp = $pfeatextencoding.replace(\'__sq__\', "\'")\n+ #set $pfeatextencoding = $pfeatextencoding_temp\n+#end if\n+\n #if str($pfeatextencoding):\n --p-feat-ext--encoding="$pfeatextencoding"\n #end if\n \n+\n+\n+\n+\n+#if \'__sq__\' in str($pfeatextinput):\n+ #set $pfeatextinput_temp = $pfeatextinput.replace(\'__sq__\', "\'")\n+ #set $pfeatextinput = $pfeatextinput_temp\n+#end if\n+\n #if str($pfeatextinput):\n --p-feat-ext--input="$pfeatextinput"\n #end if\n \n+\n+\n+\n #if $pnofeatextlowercase:\n --p-no-feat-ext--lowercase\n #end if\n \n-#if $pfeatextnfeatures:\n+#if str($pfeatextnfeatures):\n --p-feat-ext--n-features=$pfeatextnfeatures\n #end if\n \n+\n+\n+\n+#if \'__sq__\' in str($pfeatextngramrange):\n+ #set $pfeatextngramrange_temp = $pfeatextngramrange.replace(\'__sq__\', "\'")\n+ #set $pfeatextngramrange = $pfeatextngramrange_temp\n+#end if\n+\n #if \'__ob__\' in str($pfeatextngramrange):\n #set $pfeatextngramrange_temp = $pfeatextngramrange.replace(\'__ob__\', \'[\')\n #set $pfeatextngramrange = $pfeatextngramrange_temp\n@@ -85,30 +150,75 @@\n #end if\n \n \n+\n+\n+\n #if $pfeatextnonnegative:\n --p-feat-ext--non-negative\n #end if\n \n+\n+#if \'__sq__\' in str($pfeatextnorm):\n+ #set $pfeatextnorm_temp = $pfeatextnorm.replace(\'__sq__\', "\'")\n+ #set $pfeatextnorm = $pfeatextnorm_temp\n+#end if\n+\n #if str($pfeatextnorm):\n --p-feat-ext--norm="$pfeatextnorm"\n #end if\n \n+\n+\n+\n+#if \'__sq__\' in str($pfeatextpreprocessor):\n+ #set $pfeatextpreprocessor_temp = $pfeatextpreprocessor.replace(\'__sq__\', "\'")\n+ #set $pfeatextpreprocessor = $pfeatextpreprocessor_temp\n+#end if\n+\n #if str($pfeatextpreprocessor):\n --p-feat-ext--preprocessor="$pfeatextpreprocessor"\n #end if\n \n+\n+\n+\n+#if \'__sq__\' in str($pfeatextstopwords):\n+ #set $pfeatextstopwords_temp = $pfeatextstopwords.replace(\'__s'..b'sify--fit-prior [default: False]" name="pclassifyfitprior" selected="False" type="boolean"/>\n \t\t<param label="--p-feat-ext--alternate-sign: --p-no-feat-ext--alternate-sign [default: False]" name="pfeatextalternatesign" selected="False" type="boolean"/>\n-\t\t<param label="--p-feat-ext--analyzer: TEXT [default: \'char_wb\']" name="pfeatextanalyzer" optional="True" type="text" value="\'char_wb\'"/>\n+\t\t<param label="--p-feat-ext--analyzer: TEXT [default: \'char_wb\']" name="pfeatextanalyzer" optional="True" type="text" value="char_wb"/>\n \t\t<param label="--p-feat-ext--binary: --p-no-feat-ext--binary [default: False]" name="pfeatextbinary" selected="False" type="boolean"/>\n-\t\t<param label="--p-feat-ext--decode-error: TEXT [default: \'strict\']" name="pfeatextdecodeerror" optional="True" type="text" value="\'strict\'"/>\n-\t\t<param label="--p-feat-ext--encoding: TEXT [default: \'utf-8\']" name="pfeatextencoding" optional="True" type="text" value="\'utf-8\'"/>\n-\t\t<param label="--p-feat-ext--input: TEXT [default: \'content\']" name="pfeatextinput" optional="True" type="text" value="\'content\'"/>\n+\t\t<param label="--p-feat-ext--decode-error: TEXT [default: \'strict\']" name="pfeatextdecodeerror" optional="True" type="text" value="strict"/>\n+\t\t<param label="--p-feat-ext--encoding: TEXT [default: \'utf-8\']" name="pfeatextencoding" optional="True" type="text" value="utf-8"/>\n+\t\t<param label="--p-feat-ext--input: TEXT [default: \'content\']" name="pfeatextinput" optional="True" type="text" value="content"/>\n \t\t<param label="--p-no-feat-ext--lowercase: [default: False]" name="pnofeatextlowercase" selected="False" type="boolean"/>\n \t\t<param label="--p-feat-ext--n-features: INTEGER [default: 8192]" name="pfeatextnfeatures" optional="True" type="integer" value="8192"/>\n-\t\t<param label="--p-feat-ext--ngram-range: TEXT [default: \'[7, 7]\']" name="pfeatextngramrange" optional="True" type="text" value="\'[7, 7]"/>\n+\t\t<param label="--p-feat-ext--ngram-range: TEXT [default: \'[7, 7]\']" name="pfeatextngramrange" optional="True" type="text" value="[7, 7]"/>\n \t\t<param label="--p-feat-ext--non-negative: --p-no-feat-ext--non-negative [default: False]" name="pfeatextnonnegative" selected="False" type="boolean"/>\n-\t\t<param label="--p-feat-ext--norm: TEXT [default: \'l2\']" name="pfeatextnorm" optional="True" type="text" value="\'l2\'"/>\n-\t\t<param label="--p-feat-ext--preprocessor: TEXT [default: \'null\']" name="pfeatextpreprocessor" optional="True" type="text" value="\'null\'"/>\n-\t\t<param label="--p-feat-ext--stop-words: TEXT [default: \'null\']" name="pfeatextstopwords" optional="True" type="text" value="\'null\'"/>\n-\t\t<param label="--p-feat-ext--strip-accents: TEXT [default: \'null\']" name="pfeatextstripaccents" optional="True" type="text" value="\'null\'"/>\n-\t\t<param label="--p-feat-ext--token-pattern: TEXT [default: \'(?u)\\\\b\\\\w\\\\w+\\\\b\']" name="pfeatexttokenpattern" optional="True" type="text" value="\'(?u)\\\\b\\\\w\\\\w+\\\\b\'"/>\n-\t\t<param label="--p-feat-ext--tokenizer: TEXT [default: \'null\']" name="pfeatexttokenizer" optional="True" type="text" value="\'null\'"/>\n+\t\t<param label="--p-feat-ext--norm: TEXT [default: \'l2\']" name="pfeatextnorm" optional="True" type="text" value="l2"/>\n+\t\t<param label="--p-feat-ext--preprocessor: TEXT [default: \'null\']" name="pfeatextpreprocessor" optional="True" type="text" value="null"/>\n+\t\t<param label="--p-feat-ext--stop-words: TEXT [default: \'null\']" name="pfeatextstopwords" optional="True" type="text" value="null"/>\n+\t\t<param label="--p-feat-ext--strip-accents: TEXT [default: \'null\']" name="pfeatextstripaccents" optional="True" type="text" value="null"/>\n+\t\t<param label="--p-feat-ext--token-pattern: TEXT [default: \'(?u)\\\\b\\\\w\\\\w+\\\\b\']" name="pfeatexttokenpattern" optional="True" type="text" value="(?u)\\\\b\\\\w\\\\w+\\\\b"/>\n+\t\t<param label="--p-feat-ext--tokenizer: TEXT [default: \'null\']" name="pfeatexttokenizer" optional="True" type="text" value="null"/>\n \t</inputs>\n \t<outputs>\n \t\t<data format="qza" label="${tool.name} on ${on_string}: classifier.qza" name="oclassifier"/>\n' |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_feature-table_core-features.xml --- a/qiime2/qiime_feature-table_core-features.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_feature-table_core-features.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -9,15 +9,15 @@ --i-table=$itable -#if $pminfraction: +#if str($pminfraction): --p-min-fraction=$pminfraction #end if -#if $pmaxfraction: +#if str($pmaxfraction): --p-max-fraction=$pmaxfraction #end if -#if $psteps: +#if str($psteps): --p-steps=$psteps #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_feature-table_filter-features.xml --- a/qiime2/qiime_feature-table_filter-features.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_feature-table_filter-features.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -22,7 +22,7 @@ #end if -#if $pminfrequency: +#if str($pminfrequency): --p-min-frequency=$pminfrequency #end if @@ -30,14 +30,14 @@ --p-max-frequency="$pmaxfrequency" #end if -#if $pminsamples: +#if str($pminsamples): --p-min-samples=$pminsamples #end if #if str($pmaxsamples): --p-max-samples="$pmaxsamples" #end if - --m-metadata-file=mmetadatafile + #if '__sq__' in str($pwhere): #set $pwhere_temp = $pwhere.replace('__sq__', "'") #set $pwhere = $pwhere_temp @@ -47,7 +47,7 @@ --p-where="$pwhere" #end if -#if $pexcludeids: +#if str($pexcludeids): --p-exclude-ids #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_feature-table_filter-samples.xml --- a/qiime2/qiime_feature-table_filter-samples.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_feature-table_filter-samples.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -22,7 +22,7 @@ #end if -#if $pminfrequency: +#if str($pminfrequency): --p-min-frequency=$pminfrequency #end if @@ -30,7 +30,7 @@ --p-max-frequency="$pmaxfrequency" #end if -#if $pminfeatures: +#if str($pminfeatures): --p-min-features=$pminfeatures #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_feature-table_group.xml --- a/qiime2/qiime_feature-table_group.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_feature-table_group.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -13,17 +13,7 @@ --p-mode=$pmode -#if $input_files_mmetadatafile: -#def list_dict_to_string(list_dict): - #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') - #for d in list_dict[1:]: - #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') - #end for - #return $file_list -#end def - --m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) -#end if - +--m-metadata-file=$mmedatafile --o-grouped-table=ogroupedtable ; @@ -42,9 +32,7 @@ <option value="sum">sum</option> </param> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> - <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> - </repeat> + <param label="--m-metadata-file [required]" name="mmedatafile" type="data" format="tabular,qza,no_unzip.zip" /> </inputs> <outputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_feature-table_heatmap.xml --- a/qiime2/qiime_feature-table_heatmap.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_feature-table_heatmap.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -9,16 +9,8 @@ --i-table=$itable -#if $input_files_mmetadatafile: -#def list_dict_to_string(list_dict): - #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') - #for d in list_dict[1:]: - #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') - #end for - #return $file_list -#end def - --m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) -#end if + +--m-metadata-file=$mmedatafile #if str($mmetadatacolumn): @@ -281,9 +273,8 @@ <option value="PRGn">PRGn</option> </param> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> - <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> - </repeat> + <param label="--m-metadata-file" name="mmedatafile" optional="True" type="data" format="tabular,qza,no_unzip.zip" /> + </inputs> <outputs> <data format="html" label="${tool.name} on ${on_string}: visualization.qzv" name="ovisualization"/> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_feature-table_merge-seqs.xml --- a/qiime2/qiime_feature-table_merge-seqs.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_feature-table_merge-seqs.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -7,6 +7,8 @@ <command><![CDATA[ qiime feature-table merge-seqs + +#if $input_files_idata: #def list_dict_to_string(list_dict): #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') #for d in list_dict[1:]: @@ -15,6 +17,7 @@ #return $file_list #end def --i-data=$list_dict_to_string($input_files_idata) +#end if --o-merged-data=omergeddata |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_feature-table_merge-taxa.xml --- a/qiime2/qiime_feature-table_merge-taxa.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_feature-table_merge-taxa.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -7,6 +7,8 @@ <command><![CDATA[ qiime feature-table merge-taxa + +#if $input_files_idata: #def list_dict_to_string(list_dict): #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') #for d in list_dict[1:]: @@ -15,6 +17,7 @@ #return $file_list #end def --i-data=$list_dict_to_string($input_files_idata) +#end if --o-merged-data=omergeddata |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_feature-table_merge.xml --- a/qiime2/qiime_feature-table_merge.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_feature-table_merge.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -7,6 +7,7 @@ <command><![CDATA[ qiime feature-table merge +#if $input_files_itables: #def list_dict_to_string(list_dict): #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') #for d in list_dict[1:]: @@ -15,6 +16,7 @@ #return $file_list #end def --i-tables=$list_dict_to_string($input_files_itables) +#end if #if str($poverlapmethod) != 'None': |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_feature-table_rarefy.xml --- a/qiime2/qiime_feature-table_rarefy.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_feature-table_rarefy.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -8,7 +8,10 @@ qiime feature-table rarefy --i-table=$itable ---p-sampling-depth="$psamplingdepth" + +#if str($psamplingdepth): + --p-sampling-depth="$psamplingdepth" +#end if #if $pwithreplacement: --p-with-replacement |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_feature-table_subsample.xml --- a/qiime2/qiime_feature-table_subsample.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_feature-table_subsample.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -8,7 +8,11 @@ qiime feature-table subsample --i-table=$itable ---p-subsampling-depth="$psubsamplingdepth" + +#if str($psubsamplingdepth): + --p-subsampling-depth="$psubsamplingdepth" +#end if + --p-axis=$paxis --o-sampled-table=osampledtable |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_feature-table_summarize.xml --- a/qiime2/qiime_feature-table_summarize.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_feature-table_summarize.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -9,6 +9,8 @@ --i-table=$itable + +#if $m_sample_metadatafile: #def list_dict_to_string(list_dict): #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') #for d in list_dict[1:]: @@ -17,6 +19,8 @@ #return $file_list #end def --m-sample-metadata-file=$list_dict_to_string($m_sample_metadatafile) +#end if + --o-visualization=ovisualization ; |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_fragment-insertion_sepp.xml --- a/qiime2/qiime_fragment-insertion_sepp.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_fragment-insertion_sepp.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -23,7 +23,7 @@ #end if -#if $palignmentsubsetsize: +#if str($palignmentsubsetsize): --p-alignment-subset-size=$palignmentsubsetsize #end if @@ -31,10 +31,6 @@ --p-placement-subset-size="$pplacementsubsetsize" #end if -#if $pdebug: - --p-debug -#end if - --o-tree=otree --o-placements=oplacements ; @@ -47,7 +43,6 @@ <param format="qza,no_unzip.zip" label="--i-reference-phylogeny: ARTIFACT Phylogeny[Rooted] The rooted reference phylogeny. Must be in sync with reference-alignment, i.e. each tip name must have exactly one corresponding record. [optional]" name="ireferencephylogeny" optional="True" type="data"/> <param label="--p-alignment-subset-size: INTEGER Each placement subset is further broken into subsets of at most these many sequences and a separate HMM is trained on each subset. The default alignment subset size is set to balance the exhaustiveness of the alignment step with the running time. [default: 1000]" name="palignmentsubsetsize" optional="True" type="integer" value="1000"/> <param label="--p-placement-subset-size: INTEGER The tree is divided into subsets such that each subset includes at most these many subsets. The placement step places the fragment on only one subset, determined based on alignment scores. The default placement subset is set to make sure the memory requirement of the pplacer step does not become prohibitively large." name="pplacementsubsetsize" optional="True" type="integer"/> - <param label="--p-debug: --p-no-debug Print additional run information to STDOUT for debugging. Run together with --verbose to actually see the information on STDOUT. Temporary directories will not be removed if run fails. [default: False]" name="pdebug" selected="False" type="boolean"/> </inputs> <outputs> <data format="qza" label="${tool.name} on ${on_string}: tree.qza" name="otree"/> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_gneiss_add-pseudocount.xml --- a/qiime2/qiime_gneiss_add-pseudocount.xml Wed Jul 17 01:53:11 2019 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| [ |
| @@ -1,55 +0,0 @@ -<?xml version="1.0" ?> -<tool id="qiime_gneiss_add-pseudocount" name="qiime gneiss add-pseudocount" version="2018.4"> - <description> - Add pseudocount to table</description> - <requirements> - <requirement type="package" version="2018.4">qiime2</requirement> - </requirements> - <command> - <![CDATA[ - qiime gneiss add-pseudocount --i-table=$itable - - #if $ppseudocount: - --p-pseudocount=$ppseudocount - #end if - - #if str($cmdconfig) != 'None': - --cmd-config=$cmdconfig - #end if - --o-composition-table=ocompositiontable; - - cp ocompositiontable.qza $ocompositiontable - ]]> - </command> - <inputs> - <param format="qza,no_unzip.zip" label="--i-table: FeatureTable[Frequency] The feature table to which pseudocounts should be added. [required]" name="itable" optional="False" type="data"/> - <param label="--p-pseudocount: The value to add to all counts in the feature table. [default: 1]" name="ppseudocount" optional="True" type="integer" value="1"/> - <param label="--cmd-config: Use config file for command options" name="cmdconfig" optional="True" type="data"/> - </inputs> - <outputs> - <data format="qza" label="${tool.name} on ${on_string}: composition-table.qza" name="ocompositiontable"/> - </outputs> - <help> - <![CDATA[ -Add pseudocount to table -------------------------- - -Increment all counts in table by pseudocount. - -Parameters ----------- -table : FeatureTable[Frequency] - The feature table to which pseudocounts should be added. -pseudocount : Int, optional - The value to add to all counts in the feature table. - -Returns -------- -composition_table : FeatureTable[Composition] - The resulting feature table. - ]]> - </help> -<macros> - <import>qiime_citation.xml</import> -</macros> -<expand macro="qiime_citation" /> -</tool> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_gneiss_balance-taxonomy.xml --- a/qiime2/qiime_gneiss_balance-taxonomy.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_gneiss_balance-taxonomy.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -7,33 +7,37 @@ <command><![CDATA[ qiime gneiss balance-taxonomy + +#if str( $id_to_taxonomy_fp.selector ) == 'history' + #set $tax = $id_to_taxonomy_fp.taxonomy_fp + --i-taxonomy '$tax' +#else: + #set $tax = $id_to_taxonomy_fp.taxonomy_fp.fields.path + --i-taxonomy '$tax' +#end if + + --i-table=$itable --i-tree=$itree ---i-taxonomy=$itaxonomy --p-balance-name="$pbalancename" -#if $input_files_mmetadatafile: -#def list_dict_to_string(list_dict): - #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') - #for d in list_dict[1:]: - #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') - #end for - #return $file_list -#end def - --m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) + +#if $metadatafile: + --m-metadata-file=$metadatafile #end if -#if $ppseudocount: + +#if str($ppseudocount): --p-pseudocount=$ppseudocount #end if -#if $ptaxalevel: +#if str($ptaxalevel): --p-taxa-level=$ptaxalevel #end if -#if $pnfeatures: +#if str($pnfeatures): --p-n-features=$pnfeatures #end if @@ -51,6 +55,22 @@ && mv '$ovisualization.files_path/index.html' '$ovisualization' ]]></command> <inputs> + + <conditional name="id_to_taxonomy_fp" optional="True"> + <param name="selector" type="select" label="Reference taxonomy to query"> + <option value="cached">Public databases</option> + <option value="history">Databases from your history</option> + </param> + <when value="cached"> + <param argument="--taxonomy_fp" label="Reference taxonomy" type="select" optional="True"> + <options from_data_table="qiime_taxonomy" /> + </param> + </when> + <when value="history"> + <param argument="--taxonomy_fp" type="data" format="qza,no_unzip.zip" label="Reference databases" optional="True" /> + </when> + </conditional> + <param format="qza,no_unzip.zip" label="--i-table: ARTIFACT FeatureTable[Frequency] A table of abundances. [required]" name="itable" optional="False" type="data"/> <param format="qza,no_unzip.zip" label="--i-tree: ARTIFACT The tree used to calculate the balances. Hierarchy [required]" name="itree" optional="False" type="data"/> <param format="qza,no_unzip.zip" label="--i-taxonomy: ARTIFACT FeatureData[Taxonomy] Taxonomy information for the OTUs. [required]" name="itaxonomy" optional="False" type="data"/> @@ -61,9 +81,7 @@ <param label="--p-threshold: NUMBER A threshold to designate discrete categories for a numerical metadata column. This will split the numerical column values into two categories, values below the threshold, and values above the threshold. If not specified, this threshold will default to the mean. [optional]" name="pthreshold" optional="True" type="float"/> <param label="--m-metadata-column: COLUMN MetadataColumn[Categorical | Numeric] Metadata column for plotting the balance (optional). [optional]" name="mmetadatacolumn" optional="True" type="text"/> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> - <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> - </repeat> + <param label="--m-metadata-file METADATA" name="metadatafile" type="data" format="tabular,qza,no_unzip.zip" optional="True" /> </inputs> <outputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_gneiss_dendrogram-heatmap.xml --- a/qiime2/qiime_gneiss_dendrogram-heatmap.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_gneiss_dendrogram-heatmap.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -24,11 +24,11 @@ #end if -#if $ppseudocount: +#if str($ppseudocount): --p-pseudocount=$ppseudocount #end if -#if $pndim: +#if str($pndim): --p-ndim=$pndim #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_gneiss_gradient-clustering.xml --- a/qiime2/qiime_gneiss_gradient-clustering.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_gneiss_gradient-clustering.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -11,6 +11,7 @@ --m-gradient-column="$mgradientcolumn" +#if $input_files_mgradientfile: #def list_dict_to_string(list_dict): #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') #for d in list_dict[1:]: @@ -18,9 +19,8 @@ #end for #return $file_list #end def - --m-gradient-file=$list_dict_to_string($input_files_mgradientfile) - +#end if #if $pnoweighted: --p-no-weighted |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_gneiss_ilr-hierarchical.xml --- a/qiime2/qiime_gneiss_ilr-hierarchical.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_gneiss_ilr-hierarchical.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -10,7 +10,7 @@ --i-table=$itable --i-tree=$itree -#if $ppseudocount: +#if str($ppseudocount): --p-pseudocount=$ppseudocount #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_gneiss_ilr-phylogenetic.xml --- a/qiime2/qiime_gneiss_ilr-phylogenetic.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_gneiss_ilr-phylogenetic.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -10,7 +10,7 @@ --i-table=$itable --i-tree=$itree -#if $ppseudocount: +#if str($ppseudocount): --p-pseudocount=$ppseudocount #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_gneiss_ilr-transform.xml --- a/qiime2/qiime_gneiss_ilr-transform.xml Wed Jul 17 01:53:11 2019 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| [ |
| @@ -1,56 +0,0 @@ -<?xml version="1.0" ?> -<tool id="qiime_gneiss_ilr-transform" name="qiime gneiss ilr-transform" version="2018.4"> - <description> - Isometric Log-ratio Transform</description> - <requirements> - <requirement type="package" version="2018.4">qiime2</requirement> - </requirements> - <command> - <![CDATA[ - qiime gneiss ilr-transform --i-table=$itable --i-tree=$itree --o-balances=obalances - - #if str($cmdconfig) != 'None': - --cmd-config=$cmdconfig - #end if - ; - cp obalances.qza $obalances; - ]]> - </command> - <inputs> - <param format="qza,no_unzip.zip" label="--i-table: FeatureTable[Composition] The feature table containing the samples in which the ilr transform will be performed. [required]" name="itable" optional="False" type="data"/> - <param format="qza,no_unzip.zip" label="--i-tree: Hierarchy A hierarchy of feature identifiers that defines the partitions of features. Each tip in the hierarchycorresponds to the feature identifiers in the table. This tree can contain tip ids that are not present in the table, but all feature ids in the table must be present in this tree. This assumes that all of the internal nodes in the tree have labels. [required]" name="itree" optional="False" type="data"/> - <param label="--cmd-config: Use config file for command options" name="cmdconfig" optional="True" type="data"/> - </inputs> - <outputs> - <data format="qza" label="${tool.name} on ${on_string}: balances.qza" name="obalances"/> - </outputs> - <help> - <![CDATA[ -Isometric Log-ratio Transform ------------------------------- - -Calculate balances given a hierarchy. - -Parameters ----------- -table : FeatureTable[Composition] - The feature table containing the samples in which the ilr transform - will be performed. -tree : Hierarchy - A hierarchy of feature identifiers that defines the partitions of - features. Each tip in the hierarchycorresponds to the feature - identifiers in the table. This tree can contain tip ids that are not - present in the table, but all feature ids in the table must be present - in this tree. This assumes that all of the internal nodes in the tree - have labels. - -Returns -------- -balances : FeatureTable[Balance] - The resulting balances from the ilr transform. - ]]> - </help> -<macros> - <import>qiime_citation.xml</import> -</macros> -<expand macro="qiime_citation" /> -</tool> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_gneiss_lme-regression.xml --- a/qiime2/qiime_gneiss_lme-regression.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_gneiss_lme-regression.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -36,6 +36,11 @@ <param format="qza,no_unzip.zip" label="--i-tree: ARTIFACT A hierarchy of feature identifiers where each tip Hierarchy corresponds to the feature identifiers in the table. This tree can contain tip ids that are not present in the table, but all feature ids in the table must be present in this tree. [required]" name="itree" optional="False" type="data"/> <param label="--p-formula: TEXT Statistical formula specifying the statistical model. In other words, a list of the metadata categories that will be used in the linear mixed effect model, typically separated by '+'. For more information see https://patsy.readthedocs.io/en/latest/API-reference.ht ml [required]" name="pformula" optional="False" type="text"/> <param label="--p-groups: TEXT [required]" name="pgroups" optional="False" type="text"/> + + <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file [required]"> + <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> + </repeat> + </inputs> <outputs> <data format="html" label="${tool.name} on ${on_string}: visualization.qzv" name="ovisualization"/> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_gneiss_ols-regression.xml --- a/qiime2/qiime_gneiss_ols-regression.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_gneiss_ols-regression.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -37,7 +37,7 @@ <param label="--p-formula: TEXT Formula specifying the statistical model. In other words, a list of the metadata categories that will be used in the regression model, typically separated by '+'. For more information see https://patsy.readthedocs.io/en/latest/API-reference.html [required]" name="pformula" optional="False" type="text"/> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> + <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file [required]"> <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> </inputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_longitudinal_anova.xml --- a/qiime2/qiime_longitudinal_anova.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_longitudinal_anova.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -7,8 +7,18 @@ <command><![CDATA[ qiime longitudinal anova + + + +#if 'X' in str($pformula): + #set $pformula_temp = $pformula.replace('X', "~") + #set $pformula = $pformula_temp +#end if + --p-formula="$pformula" + + #if str($psstype) != 'None': --p-sstype=$psstype #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_longitudinal_feature-volatility.xml --- a/qiime2/qiime_longitudinal_feature-volatility.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_longitudinal_feature-volatility.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -8,13 +8,15 @@ qiime longitudinal feature-volatility --i-table=$itable + + --p-state-column="$pstatecolumn" #if str($pindividualidcolumn): --p-individual-id-column="$pindividualidcolumn" #end if -#if $pcv: +#if str($pcv): --p-cv=$pcv #end if @@ -29,7 +31,7 @@ #end if -#if $pnestimators: +#if str($pnestimators): --p-n-estimators=$pnestimators #end if @@ -101,7 +103,7 @@ <option value="ignore">ignore</option> </param> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> + <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file [required]"> <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_longitudinal_first-differences.xml --- a/qiime2/qiime_longitudinal_first-differences.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_longitudinal_first-differences.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -8,8 +8,17 @@ qiime longitudinal first-differences --p-state-column="$pstatecolumn" +--p-metric="$pmetric" + + + +#if '__pd__' in str($pindividualidcolumn): + #set $pwhere_temp = $pindividualidcolumn.replace('__pd__', "#") + #set $pindividualidcolumn = $pwhere_temp +#end if --p-individual-id-column="$pindividualidcolumn" ---p-metric="$pmetric" + + #if str($itable) != 'None': --i-table=$itable @@ -53,7 +62,7 @@ </param> <param label="--p-baseline: NUMBER A value listed in the state-column metadata column against which all other states should be compared. Toggles calculation of static differences instead of first differences (which are calculated if no value is given for baseline). If a 'baseline' value is provided, sample differences at each state are compared against the baseline state, instead of the previous state. Must be a value listed in the state-column. [optional]" name="pbaseline" optional="True" type="float"/> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> + <repeat name="input_files_mmetadatafile" optional="False" title="--m-metadata-file [required]"> <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_longitudinal_first-distances.xml --- a/qiime2/qiime_longitudinal_first-distances.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_longitudinal_first-distances.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -48,7 +48,7 @@ <option value="drop">drop</option> </param> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> + <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file [required]"> <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_longitudinal_linear-mixed-effects.xml --- a/qiime2/qiime_longitudinal_linear-mixed-effects.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_longitudinal_linear-mixed-effects.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -47,7 +47,7 @@ --p-lowess #end if -#if $pci: +#if str($pci): --p-ci=$pci #end if @@ -93,7 +93,7 @@ <param label="--p-ci: NUMBER Size of the confidence interval for the regression Range(0, 100) estimate. [default: 95]" name="pci" optional="True" type="float" min="0" max="100" value="95"/> <param label="--p-formula: TEXT R-style formula to use for model specification. A formula must be used if the 'metric' parameter is None. Note that the metric and group columns specified in the formula will override metric and group columns that are passed separately as parameters to this method. Formulae will be in the format 'a ~ b + c', where 'a' is the metric (dependent variable) and 'b' and 'c' are independent covariates. Use '+' to add a variable; '+ a:b' to add an interaction between variables a and b; '*' to include a variable and all interactions; and '-' to subtract a particular term (e.g., an interaction term). See https://patsy.readthedocs.io/en/latest/formulas.html for full documentation of valid formula operators. Always enclose formulae in quotes to avoid unpleasant surprises. [optional]" name="pformula" optional="True" type="text"/> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> + <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file [required]"> <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_longitudinal_maturity-index.xml --- a/qiime2/qiime_longitudinal_maturity-index.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_longitudinal_maturity-index.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -20,19 +20,19 @@ --p-estimator=$pestimator #end if -#if $pnestimators: +#if str($pnestimators): --p-n-estimators=$pnestimators #end if -#if $ptestsize: +#if str($ptestsize): --p-test-size=$ptestsize #end if -#if $pstep: +#if str($pstep): --p-step=$pstep #end if -#if $pcv: +#if str($pcv): --p-cv=$pcv #end if @@ -62,7 +62,7 @@ --p-missing-samples=$pmissingsamples #end if -#if $pfeaturecount: +#if str($pfeaturecount): --p-feature-count=$pfeaturecount #end if @@ -139,7 +139,7 @@ </param> <param label="--p-feature-count: INTEGER Range(0, None) Filter feature table to include top N most important features. Set to zero to include all features. [default: 50]" name="pfeaturecount" optional="True" type="integer" min="0" value="50"/> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> + <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file [required]"> <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> </inputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_longitudinal_nmit.xml --- a/qiime2/qiime_longitudinal_nmit.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_longitudinal_nmit.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -8,7 +8,21 @@ qiime longitudinal nmit --i-table=$itable ---p-individual-id-column="$pindividualidcolumn" + + + + +#if '__sq__' in str($pindividualidcolumn): + #set $pindividualidcolumn_temp = $pindividualidcolumn.replace('__sq__', "'") + #set $pindividualidcolumn = $pindividualidcolumn_temp +#end if + +#if str($pindividualidcolumn): + --p-individual-id-column="$pindividualidcolumn" +#end if + + + #if str($pcorrmethod) != 'None': --p-corr-method=$pcorrmethod @@ -50,7 +64,7 @@ <option value="nuc">nuc</option> </param> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> + <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file [required]"> <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_longitudinal_pairwise-differences.xml --- a/qiime2/qiime_longitudinal_pairwise-differences.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_longitudinal_pairwise-differences.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -11,7 +11,17 @@ --p-state-column="$pstatecolumn" --p-state-1="$pstate1" --p-state-2="$pstate2" ---p-individual-id-column="$pindividualidcolumn" + + +#if '__sq__' in str($pindividualidcolumn): + #set $pindividualidcolumn_temp = $pindividualidcolumn.replace('__sq__', "'") + #set $pindividualidcolumn = $pindividualidcolumn_temp +#end if +#if str($pindividualidcolumn): + --p-individual-id-column="$pindividualidcolumn" +#end if + + #if str($itable) != 'None': --i-table=$itable |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_longitudinal_pairwise-distances.xml --- a/qiime2/qiime_longitudinal_pairwise-distances.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_longitudinal_pairwise-distances.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -12,7 +12,17 @@ --p-state-column="$pstatecolumn" --p-state-1="$pstate1" --p-state-2="$pstate2" ---p-individual-id-column="$pindividualidcolumn" + + +#if '__sq__' in str($pindividualidcolumn): + #set $pindividualidcolumn_temp = $pindividualidcolumn.replace('__sq__', "'") + #set $pindividualidcolumn = $pindividualidcolumn_temp +#end if +#if str($pindividualidcolumn): + --p-individual-id-column="$pindividualidcolumn" +#end if + + #if $pparametric: --p-parametric |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_longitudinal_plot-feature-volatility.xml --- a/qiime2/qiime_longitudinal_plot-feature-volatility.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_longitudinal_plot-feature-volatility.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -11,10 +11,20 @@ --i-importances=$iimportances --p-state-column="$pstatecolumn" + + +#if '__sq__' in str($pindividualidcolumn): + #set $pindividualidcolumn_temp = $pindividualidcolumn.replace('__sq__', "'") + #set $pindividualidcolumn = $pindividualidcolumn_temp +#end if + #if str($pindividualidcolumn): --p-individual-id-column="$pindividualidcolumn" #end if + + + #if str($pdefaultgroupcolumn): --p-default-group-column="$pdefaultgroupcolumn" #end if @@ -56,7 +66,7 @@ <option value="log">log</option> </param> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> + <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file [required]"> <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_longitudinal_volatility.xml --- a/qiime2/qiime_longitudinal_volatility.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_longitudinal_volatility.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -13,10 +13,19 @@ --i-table=$itable #end if + + +#if '__sq__' in str($pindividualidcolumn): + #set $pindividualidcolumn_temp = $pindividualidcolumn.replace('__sq__', "'") + #set $pindividualidcolumn = $pindividualidcolumn_temp +#end if + #if str($pindividualidcolumn): --p-individual-id-column="$pindividualidcolumn" #end if + + #if str($pdefaultgroupcolumn): --p-default-group-column="$pdefaultgroupcolumn" #end if @@ -62,7 +71,7 @@ <option value="log">log</option> </param> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> + <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file [required]"> <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> </repeat> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_metadata_tabulate.xml --- a/qiime2/qiime_metadata_tabulate.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_metadata_tabulate.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -8,6 +8,7 @@ qiime metadata tabulate +#if $input_files_minputfile: #def list_dict_to_string(list_dict): #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') #for d in list_dict[1:]: @@ -16,9 +17,10 @@ #return $file_list #end def --m-input-file=$list_dict_to_string($input_files_minputfile) +#end if -#if $ppagesize: +#if str($ppagesize): --p-page-size=$ppagesize #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_phylogeny_align-to-tree-mafft-fasttree.xml --- a/qiime2/qiime_phylogeny_align-to-tree-mafft-fasttree.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_phylogeny_align-to-tree-mafft-fasttree.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -16,11 +16,11 @@ #end if -#if $pmaskmaxgapfrequency: +#if str($pmaskmaxgapfrequency): --p-mask-max-gap-frequency=$pmaskmaxgapfrequency #end if -#if $pmaskminconservation: +#if str($pmaskminconservation): --p-mask-min-conservation=$pmaskminconservation #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_phylogeny_iqtree-ultrafast-bootstrap.xml --- a/qiime2/qiime_phylogeny_iqtree-ultrafast-bootstrap.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_phylogeny_iqtree-ultrafast-bootstrap.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -13,11 +13,14 @@ --p-seed="$pseed" #end if -#if $pncores: - --p-n-cores=$pncores + +#set $pncores = '${GALAXY_SLOTS:-4}' +#if str($pncores): +--p-n-cores=$pncores #end if -#if $pnruns: + +#if str($pnruns): --p-n-runs=$pnruns #end if @@ -25,7 +28,7 @@ --p-substitution-model=$psubstitutionmodel #end if -#if $pbootstrapreplicates: +#if str($pbootstrapreplicates): --p-bootstrap-replicates=$pbootstrapreplicates #end if @@ -100,7 +103,6 @@ <inputs> <param format="qza,no_unzip.zip" label="--i-alignment: ARTIFACT FeatureData[AlignedSequence] Aligned sequences to be used for phylogenetic reconstruction. [required]" name="ialignment" optional="False" type="data"/> <param label="--p-seed: INTEGER Random number seed. If not set, program defaults will be used. See IQ-TREE manual for details. [optional]" name="pseed" optional="True" type="integer"/> - <param label="--p-n-cores: INTEGER The number of cores to use for parallel processing. Range(0, None) Use '0' to let IQ-TREE automatically determine the optimal number of cores to use. [default: 1]" name="pncores" optional="True" type="integer" min="0" value="1"/> <param label="--p-n-runs: INTEGER Number of indepedent runs. Multiple independent Range(1, None) runs (e.g. 10) can outperform a single run in terms of likelihood maximisation. [default: 1]" name="pnruns" optional="True" type="integer" min="1" value="1"/> <param label="--p-substitution-model: " name="psubstitutionmodel" optional="True" type="select"> <option selected="True" value="None">Selection is Optional</option> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_phylogeny_iqtree.xml --- a/qiime2/qiime_phylogeny_iqtree.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_phylogeny_iqtree.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -19,7 +19,7 @@ --p-n-cores="$pncores" #end if -#if $pnruns: +#if str($pnruns): --p-n-runs=$pnruns #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_phylogeny_raxml-rapid-bootstrap.xml --- a/qiime2/qiime_phylogeny_raxml-rapid-bootstrap.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_phylogeny_raxml-rapid-bootstrap.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -17,7 +17,7 @@ --p-rapid-bootstrap-seed="$prapidbootstrapseed" #end if -#if $pbootstrapreplicates: +#if str($pbootstrapreplicates): --p-bootstrap-replicates=$pbootstrapreplicates #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_phylogeny_raxml.xml --- a/qiime2/qiime_phylogeny_raxml.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_phylogeny_raxml.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -13,7 +13,7 @@ --p-seed="$pseed" #end if -#if $pnsearches: +#if str($pnsearches): --p-n-searches=$pnsearches #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_quality-control_evaluate-composition.xml --- a/qiime2/qiime_quality-control_evaluate-composition.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_quality-control_evaluate-composition.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -10,19 +10,13 @@ --i-expected-features=$iexpectedfeatures --i-observed-features=$iobservedfeatures -#if $input_files_mmetadatafile: -#def list_dict_to_string(list_dict): - #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') - #for d in list_dict[1:]: - #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') - #end for - #return $file_list -#end def - --m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) + +#if $metadatafile: + --m-metadata-file=$metadatafile #end if -#if $pdepth: +#if str($pdepth): --p-depth=$pdepth #end if @@ -58,8 +52,8 @@ --p-plot-observed-features #end if -#if $pplotobservedfeaturesratio: - --p-plot-observed-features-ratio +#if $pnoplotobservedfeaturesratio: + --p-no-plot-observed-features-ratio #end if #if str($mmetadatacolumn): @@ -107,9 +101,8 @@ <param label="--p-no-plot-observed-features-ratio: Do not plot ratio of observed:expected features on score plot. [default: False]" name="pnoplotobservedfeaturesratio" selected="False" type="boolean"/> <param label="--m-metadata-column: COLUMN MetadataColumn[Categorical] Optional sample metadata that maps observed-features sample IDs to expected-features sample IDs. [optional]" name="mmetadatacolumn" optional="True" type="text"/> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> - <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> - </repeat> + <param label="--m-metadata-file METADATA" name="metadatafile" type="data" format="tabular,qza,no_unzip.zip" /> + </inputs> <outputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_quality-control_evaluate-taxonomy.xml --- a/qiime2/qiime_quality-control_evaluate-taxonomy.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_quality-control_evaluate-taxonomy.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -9,7 +9,10 @@ --i-expected-taxa=$iexpectedtaxa --i-observed-taxa=$iobservedtaxa ---p-depth="$pdepth" + +#if str($pdepth): + --p-depth="$pdepth" +#end if #if str($ifeaturetable) != 'None': --i-feature-table=$ifeaturetable |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_quality-control_exclude-seqs.xml --- a/qiime2/qiime_quality-control_exclude-seqs.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_quality-control_exclude-seqs.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -14,7 +14,7 @@ --p-method=$pmethod #end if -#if $ppercidentity: +#if str($ppercidentity): --p-perc-identity=$ppercidentity #end if @@ -22,7 +22,7 @@ --p-evalue="$pevalue" #end if -#if $ppercqueryaligned: +#if str($ppercqueryaligned): --p-perc-query-aligned=$ppercqueryaligned #end if @@ -47,7 +47,7 @@ <option value="blastn-short">blastn-short</option> </param> <param label="--p-perc-identity: PROPORTION Range(0.0, 1.0, inclusive_end=True) Reject match if percent identity to reference is lower. Must be in range [0.0, 1.0] [default: 0.97]" name="ppercidentity" optional="True" type="float" value="0.97" min="0" max="1" exclusive_end="False"/> - <param label="--p-evalue: NUMBER BLAST expectation (E) value threshold for saving hits. Reject if E value is higher than threshold. This threshold is disabled by default. [optional]" name="pevalue" optional="True" type="text"/> + <param label="--p-evalue: NUMBER BLAST expectation (E) value threshold for saving hits. Reject if E value is higher than threshold. This threshold is disabled by default. [optional]" name="pevalue" optional="True" type="float"/> <param label="--p-perc-query-aligned: NUMBER Percent of query sequence that must align to reference in order to be accepted as a hit. [default: 0.97]" name="ppercqueryaligned" optional="True" type="float" value="0.97"/> </inputs> <outputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_quality-filter_q-score-joined.xml --- a/qiime2/qiime_quality-filter_q-score-joined.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_quality-filter_q-score-joined.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -9,19 +9,19 @@ --i-demux=$idemux -#if $pminquality: +#if str($pminquality): --p-min-quality=$pminquality #end if -#if $pqualitywindow: +#if str($pqualitywindow): --p-quality-window=$pqualitywindow #end if -#if $pminlengthfraction: +#if str($pminlengthfraction): --p-min-length-fraction=$pminlengthfraction #end if -#if $pmaxambiguous: +#if str($pmaxambiguous): --p-max-ambiguous=$pmaxambiguous #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_quality-filter_q-score.xml --- a/qiime2/qiime_quality-filter_q-score.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_quality-filter_q-score.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -9,19 +9,19 @@ --i-demux=$idemux -#if $pminquality: +#if str($pminquality): --p-min-quality=$pminquality #end if -#if $pqualitywindow: +#if str($pqualitywindow): --p-quality-window=$pqualitywindow #end if -#if $pminlengthfraction: +#if str($pminlengthfraction): --p-min-length-fraction=$pminlengthfraction #end if -#if $pmaxambiguous: +#if str($pmaxambiguous): --p-max-ambiguous=$pmaxambiguous #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_rep_set.loc --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/qiime2/qiime_rep_set.loc Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -0,0 +1,9 @@ +silva_132_release_rep_set_all_99_silva132_99 silva (132_release) - rep_set_all - 99 - 99_otus silva_132_release_rep_set_all_99_silva132_99.fna /home/galaxy/galaxy/tool-data/qiime_rep_set/silva_132_release_rep_set_all_99_silva132_99.fna +silva_132_release_rep_set_all_97_silva132_97 silva (132_release) - rep_set_all - 97 - 97_otus silva_132_release_rep_set_all_97_silva132_97.fna /home/galaxy/galaxy/tool-data/qiime_rep_set/silva_132_release_rep_set_all_97_silva132_97.fna +silva_128_release_rep_set_all_97_97_otus silva (128_release) - rep_set_all - 97 - 97_otus silva_128_release_rep_set_all_97_97_otus.fasta /home/galaxy/galaxy/tool-data/qiime_rep_set/silva_128_release_rep_set_all_97_97_otus.fasta +unite_20.11.2016_sh_refs_qiime_ver7_97_20.11.2016 unite (20.11.2016) - sh_refs_qiime_ver7_97_20 unite_20.11.2016_sh_refs_qiime_ver7_97_20.11.2016.fasta /home/galaxy/galaxy/tool-data/qiime_rep_set/unite_20.11.2016_sh_refs_qiime_ver7_97_20.11.2016.fasta +greengenes_13_8_97_otus greengenes (13_8_relese) - 97_otus greengenes_13_8_97_otus.fasta /home/galaxy/galaxy/tool-data/qiime_rep_set/greengenes_13_8_97_otus.fasta +greengenes_13_8_99_otus greengenes (13_8_relese) - 99_otus greengenes_13_8_99_otus.fasta /home/galaxy/galaxy/tool-data/qiime_rep_set/greengenes_13_8_99_otus.fasta +GreenGenes_13_8_99_V4_GTGCCAGCMGCCGCGGTAA_GGACTACHVHHHTWTCTAAT GreenGenes_13_8_99_V4_GTGCCAGCMGCCGCGGTAA_GGACTACHVHHHTWTCTAAT GreenGenes_13_8_99_V4_GTGCCAGCMGCCGCGGTAA_GGACTACHVHHHTWTCTAAT.qza /home/galaxy/galaxy/tool-data/QIIME2_reference_classifiers/GreenGenes_13_8_99_V4_GTGCCAGCMGCCGCGGTAA_GGACTACHVHHHTWTCTAAT.qza +GreenGenes_13_8_99_V4_GTGYCAGCMGCCGCGGTAA_GGACTACNVGGGTWTCTAAT GreenGenes_13_8_99_V4_GTGYCAGCMGCCGCGGTAA_GGACTACNVGGGTWTCTAAT GreenGenes_13_8_99_V4_GTGYCAGCMGCCGCGGTAA_GGACTACNVGGGTWTCTAAT.qza /home/galaxy/galaxy/tool-data/QIIME2_reference_classifiers/GreenGenes_13_8_99_V4_GTGYCAGCMGCCGCGGTAA_GGACTACNVGGGTWTCTAAT.qza +GreenGenes_13_8_97_V1_V2_AGAGTTTGATCCTGGCTCAG_CTGCTGCCTYCCGTA GreenGenes_13_8_97_V1_V2_AGAGTTTGATCCTGGCTCAG_CTGCTGCCTYCCGTA GreenGenes_13_8_97_V1_V2_AGAGTTTGATCCTGGCTCAG_CTGCTGCCTYCCGTA.qza /home/galaxy/galaxy/tool-data/QIIME2_reference_classifiers/GreenGenes_13_8_97_V1_V2_AGAGTTTGATCCTGGCTCAG_CTGCTGCCTYCCGTA.qza |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_sample-classifier_classify-samples-from-dist.xml --- a/qiime2/qiime_sample-classifier_classify-samples-from-dist.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_sample-classifier_classify-samples-from-dist.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -10,7 +10,7 @@ --i-distance-matrix=$idistancematrix --m-metadata-column="$mmetadatacolumn" -#if $pk: +#if str($pk): --p-k=$pk #end if @@ -19,15 +19,8 @@ #end if -#if $input_files_mmetadatafile: -#def list_dict_to_string(list_dict): - #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') - #for d in list_dict[1:]: - #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') - #end for - #return $file_list -#end def - --m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) +#if $metadatafile: + --m-metadata-file=$metadatafile #end if @@ -77,9 +70,7 @@ <option value="greyscale">greyscale</option> </param> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> - <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> - </repeat> + <param label="--m-metadata-file METADATA" name="metadatafile" type="data" format="tabular,qza,no_unzip.zip" /> </inputs> <outputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_sample-classifier_classify-samples-ncv.xml --- a/qiime2/qiime_sample-classifier_classify-samples-ncv.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_sample-classifier_classify-samples-ncv.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -10,18 +10,14 @@ --i-table=$itable --m-metadata-column="$mmetadatacolumn" -#if $input_files_mmetadatafile: -#def list_dict_to_string(list_dict): - #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') - #for d in list_dict[1:]: - #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') - #end for - #return $file_list -#end def - --m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) + + +#if $metadatafile: + --m-metadata-file=$metadatafile #end if -#if $pcv: + +#if str($pcv): --p-cv=$pcv #end if @@ -36,7 +32,7 @@ #end if -#if $pnestimators: +#if str($pnestimators): --p-n-estimators=$pnestimators #end if @@ -81,9 +77,8 @@ <option value="ignore">ignore</option> </param> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> - <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> - </repeat> + <param label="--m-metadata-file METADATA" name="metadatafile" type="data" format="tabular,qza,no_unzip.zip" /> + </inputs> <outputs> <data format="qza" label="${tool.name} on ${on_string}: predictions.qza" name="opredictions"/> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_sample-classifier_classify-samples.xml --- a/qiime2/qiime_sample-classifier_classify-samples.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_sample-classifier_classify-samples.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -10,15 +10,15 @@ --i-table=$itable --m-metadata-column="$mmetadatacolumn" -#if $ptestsize: +#if str($ptestsize): --p-test-size=$ptestsize #end if -#if $pstep: +#if str($pstep): --p-step=$pstep #end if -#if $pcv: +#if str($pcv): --p-cv=$pcv #end if @@ -58,18 +58,12 @@ #end if -#if $input_files_mmetadatafile: -#def list_dict_to_string(list_dict): - #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') - #for d in list_dict[1:]: - #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') - #end for - #return $file_list -#end def - --m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) +#if $metadatafile: + --m-metadata-file=$metadatafile #end if + --o-sample-estimator=osampleestimator --o-feature-importance=ofeatureimportance --o-predictions=opredictions @@ -145,9 +139,7 @@ <option value="ignore">ignore</option> </param> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> - <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> - </repeat> + <param label="--m-metadata-file METADATA" name="metadatafile" type="data" format="tabular,qza,no_unzip.zip" /> </inputs> <outputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_sample-classifier_fit-classifier.xml --- a/qiime2/qiime_sample-classifier_fit-classifier.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_sample-classifier_fit-classifier.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -10,11 +10,11 @@ --i-table=$itable --m-metadata-column="$mmetadatacolumn" -#if $pstep: +#if str($pstep): --p-step=$pstep #end if -#if $pcv: +#if str($pcv): --p-cv=$pcv #end if @@ -29,7 +29,7 @@ #end if -#if $pnestimators: +#if str($pnestimators): --p-n-estimators=$pnestimators #end if @@ -50,18 +50,13 @@ #end if -#if $input_files_mmetadatafile: -#def list_dict_to_string(list_dict): - #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') - #for d in list_dict[1:]: - #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') - #end for - #return $file_list -#end def - --m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) + +#if $metadatafile: + --m-metadata-file=$metadatafile #end if + --o-sample-estimator=osampleestimator --o-feature-importance=ofeatureimportance ; @@ -93,9 +88,7 @@ <option value="ignore">ignore</option> </param> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> - <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> - </repeat> + <param label="--m-metadata-file METADATA" name="metadatafile" type="data" format="tabular,qza,no_unzip.zip" /> </inputs> <outputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_sample-classifier_fit-regressor.xml --- a/qiime2/qiime_sample-classifier_fit-regressor.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_sample-classifier_fit-regressor.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -10,11 +10,11 @@ --i-table=$itable --m-metadata-column="$mmetadatacolumn" -#if $pstep: +#if str($pstep): --p-step=$pstep #end if -#if $pcv: +#if str($pcv): --p-cv=$pcv #end if @@ -28,7 +28,7 @@ #end if -#if $pnestimators: +#if str($pnestimators): --p-n-estimators=$pnestimators #end if @@ -49,18 +49,14 @@ #end if -#if $input_files_mmetadatafile: -#def list_dict_to_string(list_dict): - #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') - #for d in list_dict[1:]: - #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') - #end for - #return $file_list -#end def - --m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) + + +#if $metadatafile: + --m-metadata-file=$metadatafile #end if + --o-sample-estimator=osampleestimator --o-feature-importance=ofeatureimportance ; @@ -95,9 +91,7 @@ <option value="ignore">ignore</option> </param> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> - <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> - </repeat> + <param label="--m-metadata-file METADATA" name="metadatafile" type="data" format="tabular,qza,no_unzip.zip" /> </inputs> <outputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_sample-classifier_heatmap.xml --- a/qiime2/qiime_sample-classifier_heatmap.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_sample-classifier_heatmap.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -11,28 +11,25 @@ --i-importance=$iimportance -#if $input_files_mmetadatafile: -#def list_dict_to_string(list_dict): - #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') - #for d in list_dict[1:]: - #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') - #end for - #return $file_list -#end def - --m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) + + +#if $metadatafile: + --m-metadata-file=$metadatafile #end if + + #if str($mmetadatacolumn): --m-metadata-column="$mmetadatacolumn" #end if -#if $pfeaturecount: +#if str($pfeaturecount): --p-feature-count=$pfeaturecount #end if -#if $pimportancethreshold: +#if str($pimportancethreshold): --p-importance-threshold=$pimportancethreshold #end if @@ -297,9 +294,9 @@ <option value="PRGn">PRGn</option> </param> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> - <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> - </repeat> + + <param label="--m-metadata-file METADATA" name="metadatafile" type="data" format="tabular,qza,no_unzip.zip" /> + </inputs> <outputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_sample-classifier_maturity-index.xml --- a/qiime2/qiime_sample-classifier_maturity-index.xml Wed Jul 17 01:53:11 2019 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| [ |
| b'@@ -1,203 +0,0 @@\n-<?xml version="1.0" ?>\n-<tool id="qiime_sample-classifier_maturity-index" name="qiime sample-classifier maturity-index" version="2018.4">\n-\t<description> - Microbial maturity index prediction.</description>\n-\t<requirements>\n-\t\t<requirement type="package" version="2018.4">qiime2</requirement>\n-\t</requirements>\n-\t<command>\n-\t<![CDATA[\n-\tqiime sample-classifier maturity-index --i-table=$itable\n-\n-\t#def list_dict_to_string(list_dict):\n-\t\t#set $file_list = list_dict[0][\'additional_input\'].__getattr__(\'file_name\')\n-\t\t#for d in list_dict[1:]:\n-\t\t\t#set $file_list = $file_list + \' --m-metadata-file=\' + d[\'additional_input\'].__getattr__(\'file_name\')\n-\t\t#end for\n-\t\t#return $file_list\n-\t#end def\n-\n-\t --m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) --p-group-by="$pgroupby" --p-column="$pcolumn" --p-control="$pcontrol"\n-\n-\t#set $pnjobs = \'${GALAXY_SLOTS:-4}\'\n-\n-\t#if str($pnjobs):\n-\t --p-n-jobs="$pnjobs"\n-\t#end if\n-\n-\n-\t#if $pparametertuning:\n-\t --p-parameter-tuning\n-\t#else\n-\t\t--p-no-parameter-tuning\n-\t#end if\n-\n-\t#if $pstep:\n-\t --p-step=$pstep\n-\t#end if\n-\n-\t#if $pstratify:\n-\t --p-stratify\n-\t#else\n-\t\t--p-no-stratify\n-\t#end if\n-\n-\t#if $poptimizefeatureselection:\n-\t --p-optimize-feature-selection\n-\t#else\n-\t\t--p-no-optimize-feature-selection\n-\t#end if\n-\n-\t#if $ptestsize:\n-\t --p-test-size=$ptestsize\n-\t#end if\n-\t --o-visualization=ovisualization\n-\t#if str($pestimator) != \'None\':\n-\t --p-estimator=$pestimator\n-\t#end if\n-\n-\t#if $pmazstats:\n-\t --p-maz-stats\n- \t#else\n- \t\t--p-no-maz-stats\n-\t#end if\n-\n-\t#if str($cmdconfig) != \'None\':\n-\t --cmd-config=$cmdconfig\n-\t#end if\n-\n-\t#if $pcv:\n-\t --p-cv=$pcv\n-\t#end if\n-\n-\t#if $pnestimators:\n-\t --p-n-estimators=$pnestimators\n-\t#end if\n-\n-\t#if str($prandomstate):\n-\t --p-random-state="$prandomstate"\n-\t#end if\n-\t;\n-\tqiime tools export ovisualization.qzv --output-dir out && mkdir -p \'$ovisualization.files_path\'\n-\t&& cp -r out/* \'$ovisualization.files_path\'\n-\t&& mv \'$ovisualization.files_path/index.html\' \'$ovisualization\'\n-\t]]>\n-\t</command>\n-\t<inputs>\n-\t\t<param format="qza,no_unzip.zip" label="--i-table: FeatureTable[Frequency] Feature table containing all features that should be used for target prediction. [required]" name="itable" optional="False" type="data"/>\n-\n-\t\t<repeat name="input_files_mmetadatafile" optional="False" title="--m-metadata-file">\n-\t\t\t<param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [required]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" />\n-\t\t</repeat>\n-\n-\t\t<param label="--p-column: Numeric metadata column to use as prediction target. [required]" name="pcolumn" optional="False" type="text"/>\n-\n-\t\t<param label="--p-group-by: Categorical metadata column to use for plotting and significance testing between main treatment groups. [required]" name="pgroupby" optional="False" type="text"/>\n-\t\t<param label="--p-control: Value of group_by to use as control group. The regression model will be trained using only control group data, and the maturity scores of other groups consequently will be assessed relative to this group. [required]" name="pcontrol" optional="False" type="text"/>\n-\n-\t\t<param label="--p-estimator: Regression model to use for prediction.\n- [default: RandomForestRegressor]" name="pestimator" optional="True" type="select">\n-\t\t\t<option selected="True" value="None">Selection is Optional</option>\n-\t\t\t<option value="Ridge">Ridge</option>\n-\t\t\t<option value="RandomForestRegressor">RandomForestRegressor</option>\n-\t\t\t<option value="GradientBoostingRegressor">GradientBoostingRegressor</option>\n-\t\t\t<option value="ExtraTreesRegressor">ExtraTreesRegressor</option>\n-\t\t\t<option value="SVR">SVR</option>\n-\t\t\t<option value="ElasticNet">ElasticNet</option>\n-\t\t\t<option value="Lasso">Lasso</option>\n-\t\t</param>\n-\t\t<param label="--p-n-estimators: Number of trees to grow for estimation. More trees will improve predict'..b'ault: True]" name="poptimizefeatureselection" checked="True" type="boolean"/>\n-\n-\t\t<param label="--p-stratify: --p-no-stratify Evenly stratify training and test data among metadata categories. If True, all values in column must match at least two samples. [default: False]" name="pstratify" checked="False" type="boolean"/>\n-\n-\t\t<param label="--p-maz-stats: --p-no-maz-stats Calculate anova and pairwise tests on MAZ scores. [default: True]" name="pmazstats" checked="True" type="boolean"/>\n-\n-\t\t<param label="--cmd-config: Use config file for command options" name="cmdconfig" optional="True" type="data"/>\n-\t</inputs>\n-\t<outputs>\n-\t\t<data format="html" label="${tool.name} on ${on_string}: visualization.qzv" name="ovisualization"/>\n-\t</outputs>\n-\t<help>\n-\t\t<![CDATA[\n-Microbial maturity index prediction.\n--------------------------------------\n-\n-Calculates a "microbial maturity" index from a regression model trained on\n-feature data to predict a given continuous metadata column, e.g., to\n-predict age as a function of microbiota composition. The model is trained\n-on a subset of control group samples, then predicts the column value for\n-all samples. This visualization computes maturity index z-scores to compare\n-relative "maturity" between each group, as described in\n-doi:10.1038/nature13421. This method can be used to predict between-group\n-differences in relative trajectory across any type of continuous metadata\n-gradient, e.g., intestinal microbiome development by age, microbial\n-succession during wine fermentation, or microbial community differences\n-along environmental gradients, as a function of two or more different\n-"treatment" groups.\n-\n-Parameters\n-----------\n-table : FeatureTable[Frequency]\n- Feature table containing all features that should be used for target\n- prediction.\n-metadata : Metadata\n-\t\t\\\n-column : Str\n- Numeric metadata column to use as prediction target.\n-group_by : Str\n- Categorical metadata column to use for plotting and significance\n- testing between main treatment groups.\n-control : Str\n- Value of group_by to use as control group. The regression model will be\n- trained using only control group data, and the maturity scores of other\n- groups consequently will be assessed relative to this group.\n-estimator : Str % Choices({\'ElasticNet\', \'ExtraTreesRegressor\', \'GradientBoostingRegressor\', \'Lasso\', \'RandomForestRegressor\', \'Ridge\', \'SVR\'}), optional\n- Regression model to use for prediction.\n-n_estimators : Int % Range(1, None), optional\n- Number of trees to grow for estimation. More trees will improve\n- predictive accuracy up to a threshold level, but will also increase\n- time and memory requirements. This parameter only affects ensemble\n- estimators, such as Random Forest, AdaBoost, ExtraTrees, and\n- GradientBoosting.\n-test_size : Float % Range(0.0, 1.0, inclusive_start=False), optional\n- Fraction of input samples to exclude from training set and use for\n- classifier testing.\n-step : Float % Range(0.0, 1.0, inclusive_start=False), optional\n- If optimize_feature_selection is True, step is the percentage of\n- features to remove at each iteration.\n-cv : Int % Range(1, None), optional\n- Number of k-fold cross-validations to perform.\n-random_state : Int, optional\n- Seed used by random number generator.\n-parameter_tuning : Bool, optional\n- Automatically tune hyperparameters using random grid search.\n-optimize_feature_selection : Bool, optional\n- Automatically optimize input feature selection using recursive feature\n- elimination.\n-stratify : Bool, optional\n- Evenly stratify training and test data among metadata categories. If\n- True, all values in column must match at least two samples.\n-maz_stats : Bool, optional\n- Calculate anova and pairwise tests on MAZ scores.\n-\n-Returns\n--------\n-visualization : Visualization\n-\t\t\\\n-\t\t]]>\n-\t</help>\n-<macros>\n-\t<import>qiime_citation.xml</import>\n-</macros>\n-<expand macro="qiime_citation" />\n-</tool>\n' |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_sample-classifier_regress-samples-ncv.xml --- a/qiime2/qiime_sample-classifier_regress-samples-ncv.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_sample-classifier_regress-samples-ncv.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -10,7 +10,7 @@ --i-table=$itable --m-metadata-column="$mmetadatacolumn" -#if $pcv: +#if str($pcv): --p-cv=$pcv #end if @@ -25,7 +25,7 @@ #end if -#if $pnestimators: +#if str($pnestimators): --p-n-estimators=$pnestimators #end if @@ -46,18 +46,13 @@ #end if -#if $input_files_mmetadatafile: -#def list_dict_to_string(list_dict): - #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') - #for d in list_dict[1:]: - #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') - #end for - #return $file_list -#end def - --m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) + +#if $metadatafile: + --m-metadata-file=$metadatafile #end if + --o-predictions=opredictions --o-feature-importance=ofeatureimportance ; @@ -91,9 +86,9 @@ <option value="ignore">ignore</option> </param> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> - <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> - </repeat> + + <param label="--m-metadata-file METADATA" name="metadatafile" type="data" format="tabular,qza,no_unzip.zip" /> + </inputs> <outputs> <data format="qza" label="${tool.name} on ${on_string}: predictions.qza" name="opredictions"/> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_sample-classifier_regress-samples.xml --- a/qiime2/qiime_sample-classifier_regress-samples.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_sample-classifier_regress-samples.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -10,15 +10,15 @@ --i-table=$itable --m-metadata-column="$mmetadatacolumn" -#if $ptestsize: +#if str($ptestsize): --p-test-size=$ptestsize #end if -#if $pstep: +#if str($pstep): --p-step=$pstep #end if -#if $pcv: +#if str($pcv): --p-cv=$pcv #end if @@ -33,7 +33,7 @@ #end if -#if $pnestimators: +#if str($pnestimators): --p-n-estimators=$pnestimators #end if @@ -58,18 +58,15 @@ #end if -#if $input_files_mmetadatafile: -#def list_dict_to_string(list_dict): - #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') - #for d in list_dict[1:]: - #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') - #end for - #return $file_list -#end def - --m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) + + +#if $metadatafile: + --m-metadata-file=$metadatafile #end if + + --o-sample-estimator=osampleestimator --o-feature-importance=ofeatureimportance --o-predictions=opredictions @@ -89,9 +86,9 @@ <inputs> <param format="qza,no_unzip.zip" label="--i-table: ARTIFACT FeatureTable[Frequency] Feature table containing all features that should be used for target prediction. [required]" name="itable" optional="False" type="data"/> <param label="--m-metadata-column: COLUMN MetadataColumn[Numeric] Numeric metadata column to use as prediction target. [required]" name="mmetadatacolumn" optional="False" type="text"/> - <param label="--p-test-size: PROPORTION Range(0.0, 1.0, inclusive_start=False) Fraction of input samples to exclude from training set and use for classifier testing. [default: 0.2]" name="ptestsize" optional="True" type="float" value="0.2"/> - <param label="--p-step: PROPORTION Range(0.0, 1.0, inclusive_start=False) If optimize-feature-selection is True, step is the percentage of features to remove at each iteration. [default: 0.05]" name="pstep" optional="True" type="float" value="0.05"/> - <param label="--p-cv: INTEGER Number of k-fold cross-validations to perform. Range(1, None) [default: 5]" name="pcv" optional="True" type="integer" value="5"/> + <param label="--p-test-size: PROPORTION Range(0.0, 1.0, inclusive_start=False) Fraction of input samples to exclude from training set and use for classifier testing. [default: 0.2]" name="ptestsize" optional="True" type="float" value="0.2" min="0" max="1" /> + <param label="--p-step: PROPORTION Range(0.0, 1.0, inclusive_start=False) If optimize-feature-selection is True, step is the percentage of features to remove at each iteration. [default: 0.05]" name="pstep" optional="True" type="float" value="0.05" min="0" max="1" /> + <param label="--p-cv: INTEGER Number of k-fold cross-validations to perform. Range(1, None) [default: 5]" name="pcv" optional="True" type="integer" value="5" min="1"/> <param label="--p-random-state: INTEGER Seed used by random number generator. [optional]" name="prandomstate" optional="True" type="integer"/> <param label="--p-n-estimators: INTEGER Range(1, None) Number of trees to grow for estimation. More trees will improve predictive accuracy up to a threshold level, but will also increase time and memory requirements. This parameter only affects ensemble estimators, such as Random Forest, AdaBoost, ExtraTrees, and GradientBoosting. [default: 100]" name="pnestimators" optional="True" type="integer" value="100" min="1"/> <param label="--p-estimator: " name="pestimator" optional="True" type="select"> @@ -116,9 +113,9 @@ <option value="ignore">ignore</option> </param> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> - <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> - </repeat> + + <param label="--m-metadata-file METADATA" name="metadatafile" type="data" format="tabular,qza,no_unzip.zip" /> + </inputs> <outputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_sample-classifier_scatterplot.xml --- a/qiime2/qiime_sample-classifier_scatterplot.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_sample-classifier_scatterplot.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -10,7 +10,7 @@ --i-predictions=$ipredictions --m-truth-column="$mtruthcolumn" ---m-truth-file="$metadatafile" +--m-truth-file="$mtruthfile" #if str($pmissingsamples) != 'None': --p-missing-samples=$pmissingsamples @@ -21,7 +21,6 @@ qiime tools export --input-path ovisualization.qzv --output-path out && mkdir -p '$ovisualization.files_path' && cp -r out/* '$ovisualization.files_path' && mv '$ovisualization.files_path/index.html' '$ovisualization'; -cp mtruthfile.qza $mtruthfile ]]></command> <inputs> <param format="qza,no_unzip.zip" label="--i-predictions: ARTIFACT SampleData[RegressorPredictions] Predicted values to plot on y axis. Must be predictions of numeric data produced by a sample regressor. [required]" name="ipredictions" optional="False" type="data"/> @@ -32,7 +31,7 @@ <option value="ignore">ignore</option> </param> - <param label="--m-truth-file: Metadata file or artifact viewable as metadata." name="metadatafile" type="data" format="tabular,qza,no_unzip.zip" /> + <param label="--m-truth-file: Metadata file or artifact viewable as metadata." name="mtruthfile" type="data" format="tabular,qza,no_unzip.zip" /> </inputs> <outputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_sample-classifier_split-table.xml --- a/qiime2/qiime_sample-classifier_split-table.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_sample-classifier_split-table.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -12,21 +12,14 @@ -#if $input_files_mmetadatafile: -#def list_dict_to_string(list_dict): - #set $file_list = list_dict[0]['additional_input'].__getattr__('file_name') - #for d in list_dict[1:]: - #set $file_list = $file_list + ' --m-metadata-file=' + d['additional_input'].__getattr__('file_name') - #end for - #return $file_list -#end def - - --m-metadata-file=$list_dict_to_string($input_files_mmetadatafile) +#if $metadatafile: + --m-metadata-file=$metadatafile #end if -#if $ptestsize: + +#if str($ptestsize): --p-test-size=$ptestsize #end if @@ -47,7 +40,6 @@ ; cp otrainingtable.qza $otrainingtable; cp otesttable.qza $otesttable; -cp mmetadatafile.qza $mmetadatafile ]]></command> <inputs> <param format="qza,no_unzip.zip" label="--i-table: ARTIFACT FeatureTable[Frequency] Feature table containing all features that should be used for target prediction. [required]" name="itable" optional="False" type="data"/> @@ -61,9 +53,7 @@ <option value="ignore">ignore</option> </param> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> - <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> - </repeat> + <param label="--m-metadata-file METADATA" name="metadatafile" type="data" format="tabular,qza,no_unzip.zip" /> </inputs> <outputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_taxa_barplot.xml --- a/qiime2/qiime_taxa_barplot.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_taxa_barplot.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -7,8 +7,17 @@ <command><![CDATA[ qiime taxa barplot + +#if str( $id_to_taxonomy_fp.selector ) == 'history' + #set $tax = $id_to_taxonomy_fp.taxonomy_fp + --i-taxonomy '$tax' +#else: + #set $tax = $id_to_taxonomy_fp.taxonomy_fp.fields.path + --i-taxonomy '$tax' +#end if + + --i-table=$itable ---i-taxonomy=$itaxonomy #if $input_files_mmetadatafile: #def list_dict_to_string(list_dict): @@ -28,11 +37,27 @@ && mv '$ovisualization.files_path/index.html' '$ovisualization'; ]]></command> <inputs> - <param format="qza,no_unzip.zip" label="--i-table: ARTIFACT FeatureTable[Frequency] Feature table to visualize at various taxonomic levels. [required]" name="itable" optional="False" type="data"/> - <param format="qza,no_unzip.zip" label="--i-taxonomy: ARTIFACT FeatureData[Taxonomy] Taxonomic annotations for features in the provided feature table. All features in the feature table must have a corresponding taxonomic annotation. Taxonomic annotations that are not present in the feature table will be ignored. [required]" name="itaxonomy" optional="False" type="data"/> - <repeat name="input_files_mmetadatafile" optional="True" title="--m-metadata-file"> - <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" /> + <conditional name="id_to_taxonomy_fp" optional="True"> + <param name="selector" type="select" label="Reference taxonomy to query"> + <option value="cached">Public databases</option> + <option value="history">Databases from your history</option> + </param> + <when value="cached"> + <param argument="--taxonomy_fp" label="Reference taxonomy" type="select" optional="True"> + <options from_data_table="qiime_taxonomy" /> + </param> + </when> + <when value="history"> + <param argument="--taxonomy_fp" type="data" format="qza,no_unzip.zip" label="Reference databases" optional="True" /> + </when> + </conditional> + + + <param format="qza,no_unzip.zip" label="--i-table: ARTIFACT FeatureTable[Frequency] Feature table to visualize at various taxonomic levels. [required]" name="itable" optional="False" type="data"/> + + <repeat name="input_files_mmetadatafile" optional="False" title="--m-metadata-file [required]"> + <param label="--m-metadata-file: Metadata file or artifact viewable as metadata. This option may be supplied multiple times to merge metadata. [optional]" name="additional_input" type="data" format="tabular,qza,no_unzip.zip" optional="False" /> </repeat> </inputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_taxa_collapse.xml --- a/qiime2/qiime_taxa_collapse.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_taxa_collapse.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -7,17 +7,44 @@ <command><![CDATA[ qiime taxa collapse +#if str( $id_to_taxonomy_fp.selector ) == 'history' + #set $tax = $id_to_taxonomy_fp.taxonomy_fp + --i-taxonomy '$tax' +#else: + #set $tax = $id_to_taxonomy_fp.taxonomy_fp.fields.path + --i-taxonomy '$tax' +#end if + + --i-table=$itable ---i-taxonomy=$itaxonomy ---p-level="$plevel" + +#if str($plevel): + --p-level="$plevel" +#end if --o-collapsed-table=ocollapsedtable ; cp ocollapsedtable.qza $ocollapsedtable ]]></command> <inputs> + + <conditional name="id_to_taxonomy_fp" optional="True"> + <param name="selector" type="select" label="Reference taxonomy to query"> + <option value="cached">Public databases</option> + <option value="history">Databases from your history</option> + </param> + <when value="cached"> + <param argument="--taxonomy_fp" label="Reference taxonomy" type="select" optional="True"> + <options from_data_table="qiime_taxonomy" /> + </param> + </when> + <when value="history"> + <param argument="--taxonomy_fp" type="data" format="qza,no_unzip.zip" label="Reference databases" optional="True" /> + </when> + </conditional> + + <param format="qza,no_unzip.zip" label="--i-table: ARTIFACT FeatureTable[Frequency] Feature table to be collapsed. [required]" name="itable" optional="False" type="data"/> - <param format="qza,no_unzip.zip" label="--i-taxonomy: ARTIFACT FeatureData[Taxonomy] Taxonomic annotations for features in the provided feature table. All features in the feature table must have a corresponding taxonomic annotation. Taxonomic annotations that are not present in the feature table will be ignored. [required]" name="itaxonomy" optional="False" type="data"/> <param label="--p-level: INTEGER The taxonomic level at which the features should be collapsed. All ouput features will have exactly this many levels of taxonomic annotation. [required]" name="plevel" optional="False" value="" type="integer"/> </inputs> <outputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_taxa_filter-seqs.xml --- a/qiime2/qiime_taxa_filter-seqs.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_taxa_filter-seqs.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -7,8 +7,6 @@ <command><![CDATA[ qiime taxa filter-seqs ---i-sequences=$isequences - #if str( $id_to_taxonomy_fp.selector ) == 'history' #set $tax = $id_to_taxonomy_fp.taxonomy_fp @@ -19,6 +17,8 @@ #end if +--i-sequences=$isequences + #if str($pinclude): --p-include="$pinclude" #end if @@ -59,7 +59,7 @@ <param label="--p-include: TEXT One or more search terms that indicate which taxa should be included in the resulting sequences. If providing more than one term, terms should be delimited by the query-delimiter character. By default, all taxa will be included. [optional]" name="pinclude" optional="True" type="text"/> <param label="--p-exclude: TEXT One or more search terms that indicate which taxa should be excluded from the resulting sequences. If providing more than one term, terms should be delimited by the query-delimiter character. By default, no taxa will be excluded. [optional]" name="pexclude" optional="True" type="text"/> - <param label="--p-query-delimiter: TEXT The string used to delimit multiple search terms provided to include or exclude. This parameter should only need to be modified if the default delimiter (a comma) is used in the provided taxonomic annotations. [default: ',']" name="pquerydelimiter" optional="True" type="text" value="','"/> + <param label="--p-query-delimiter: TEXT The string used to delimit multiple search terms provided to include or exclude. This parameter should only need to be modified if the default delimiter (a comma) is used in the provided taxonomic annotations. [default: ',']" name="pquerydelimiter" optional="True" type="text" value=","/> <param label="--p-mode: " name="pmode" optional="True" type="select"> <option selected="True" value="None">Selection is Optional</option> <option value="exact">exact</option> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_taxa_filter-table.xml --- a/qiime2/qiime_taxa_filter-table.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_taxa_filter-table.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -7,8 +7,6 @@ <command><![CDATA[ qiime taxa filter-table ---i-table=$itable - #if str( $id_to_taxonomy_fp.selector ) == 'history' #set $tax = $id_to_taxonomy_fp.taxonomy_fp @@ -19,6 +17,8 @@ #end if +--i-table=$itable + #if str($pinclude): --p-include="$pinclude" #end if @@ -59,7 +59,7 @@ <param label="--p-include: TEXT One or more search terms that indicate which taxa should be included in the resulting table. If providing more than one term, terms should be delimited by the query-delimiter character. By default, all taxa will be included. [optional]" name="pinclude" optional="True" type="text"/> <param label="--p-exclude: TEXT One or more search terms that indicate which taxa should be excluded from the resulting table. If providing more than one term, terms should be delimited by the query-delimiter character. By default, no taxa will be excluded. [optional]" name="pexclude" optional="True" type="text"/> - <param label="--p-query-delimiter: TEXT The string used to delimit multiple search terms provided to include or exclude. This parameter should only need to be modified if the default delimiter (a comma) is used in the provided taxonomic annotations. [default: ',']" name="pquerydelimiter" optional="True" type="text" value="','"/> + <param label="--p-query-delimiter: TEXT The string used to delimit multiple search terms provided to include or exclude. This parameter should only need to be modified if the default delimiter (a comma) is used in the provided taxonomic annotations. [default: ',']" name="pquerydelimiter" optional="True" type="text" value=","/> <param label="--p-mode: " name="pmode" optional="True" type="select"> <option selected="True" value="None">Selection is Optional</option> <option value="exact">exact</option> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_taxonomy.loc --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/qiime2/qiime_taxonomy.loc Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -0,0 +1,8 @@ +silva_132_release_taxonomy_all_99_taxonomy_all_levels silva (132_release) - taxonomy_all - 99 - taxonomy_all_levels silva_132_release_taxonomy_all_99_taxonomy_all_levels.txt /home/galaxy/galaxy/tool-data/qiime_taxonomy/silva_132_release_taxonomy_all_99_taxonomy_all_levels.txt +silva_132_release_taxonomy_all_97_taxonomy_all_levels silva (132_release) - taxonomy_all - 97 - taxonomy_all_levels silva_132_release_taxonomy_all_97_taxonomy_all_levels.txt /home/galaxy/galaxy/tool-data/qiime_taxonomy/silva_132_release_taxonomy_all_97_taxonomy_all_levels.txt +greengenes_13_8_97_otu_taxonomy greengenes (13_8) - 97_otu_taxonomy greengenes_13_8_97_otu_taxonomy.txt /home/galaxy/galaxy/tool-data/qiime_taxonomy/greengenes_13_8_97_otu_taxonomy.txt +greengenes_13_8_99_otu_taxonomy greengenes (13_8) - 99_otu_taxonomy greengenes_13_8_99_otu_taxonomy.txt /home/galaxy/galaxy/tool-data/qiime_taxonomy/greengenes_13_8_99_otu_taxonomy.txt +silva_128_release_taxonomy_all_97_taxonomy_all_levels silva (128_release) - taxonomy_all - 97 - taxonomy_all_levels silva_128_release_taxonomy_all_97_taxonomy_all_levels.txt /home/galaxy/galaxy/tool-data/qiime_taxonomy/silva_128_release_taxonomy_all_97_taxonomy_all_levels.txt +unite_20.11.2016_sh_taxonomy_qiime_ver7_97_20.11.2016 unite (20.11.2016) - sh_taxonomy_qiime_ver7_97_20 unite_20.11.2016_sh_taxonomy_qiime_ver7_97_20.11.2016.txt /home/galaxy/galaxy/tool-data/qiime_taxonomy/unite_20.11.2016_sh_taxonomy_qiime_ver7_97_20.11.2016.txt +taxmap_ncbi_ssu_ref_132 taxmap_ncbi_ssu_ref_132 taxmap_ncbi_ssu_ref_132.txt /home/galaxy/galaxy/tool-data/qiime_taxonomy/taxmap_ncbi_ssu_ref_132.txt +taxmap_slv_ssu_ref_132 taxmap_slv_ssu_ref_132 taxmap_slv_ssu_ref_132.txt /home/galaxy/galaxy/tool-data/qiime_taxonomy/taxmap_slv_ssu_ref_132.txt |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_tools_export.xml --- a/qiime2/qiime_tools_export.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_tools_export.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -4,7 +4,7 @@ <requirements> <requirement type="package" version="2019.4">qiime2</requirement> </requirements> - <command><![CDATA[qiime tools export --input-path $isequences --output-dir test + <command><![CDATA[qiime tools export --input-path $isequences --output-path test ]]></command> <inputs> <param format="qza,no_unzip.zip" label="Input artifact to export! [required]" name="isequences" optional="False" type="data"/></inputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_tools_export_collection.xml --- a/qiime2/qiime_tools_export_collection.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_tools_export_collection.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -4,7 +4,7 @@ <requirements> <requirement type="package" version="2019.4">qiime2</requirement> </requirements> - <command><![CDATA[qiime tools export --input-path $isequences --output-dir test && cd test && gunzip *]]></command> + <command><![CDATA[qiime tools export --input-path $isequences --output-path test && cd test && gunzip *]]></command> <inputs> <param format="qza,no_unzip.zip" label="Input artifact to export! [required]" name="isequences" optional="False" type="data" /> </inputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_tools_export_paired_collection.xml --- a/qiime2/qiime_tools_export_paired_collection.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_tools_export_paired_collection.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| @@ -4,7 +4,7 @@ <requirements> <requirement type="package" version="2019.4">qiime2</requirement> </requirements> - <command><![CDATA[qiime tools export --input-path $isequences --output-dir test && cd test && gunzip *]]></command> + <command><![CDATA[qiime tools export --input-path $isequences --output-path test && cd test && gunzip *]]></command> <inputs> <param format="qza,no_unzip.zip" label="Input artifact to export! [required]" name="isequences" optional="False" type="data" /> </inputs> |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_tools_import.xml --- a/qiime2/qiime_tools_import.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_tools_import.xml Tue Aug 13 07:40:25 2019 -0400 |
| [ |
| b'@@ -44,7 +44,7 @@\n \t\t\tln -s ${f} $file_for_processing;\n \t\t#end if\n \t#end for\n-\t#if \'SingleEndFastqManifestPhred\' in str($sourceformat):\n+\t#if \'SingleEndFastqManifestPhred\' in str($inputformat):\n \t\t\t#set $cwd = str($outputpath.extra_files_path) + "_manifest_file.txt"\n \t\t\t#set $m_file = open(str($cwd), \'w\')\n \t\t\t$m_file.write("sample-id,absolute-filepath,direction\\n")\n@@ -85,9 +85,9 @@\n \n \t\n \t$m_file.close()\n-\t#if \'PairedEndFastqManifestPhred\' in str($sourceformat):\n+\t#if \'PairedEndFastqManifestPhred\' in str($inputformat):\n \t\t#set $in_= str($cwd)\n-\t#elif \'Casava\' in str($sourceformat):\n+\t#elif \'Casava\' in str($inputformat):\n \t\t#set $in_= \'input\'\n \t#end if\n \n@@ -119,20 +119,21 @@\n \n qiime tools import\n \n---type="$semantic_type"\n+--input-path=$in_\n \n---input-path=$in_\n+#if str($inputformat) != \'None\':\n+\t#if \'__ob__\' in str($inputformat):\n+ \t\t#set $inputformat_temp = str($inputformat).replace(\'__ob__\', \'[\')\n+\t\t#set $inputformat_temp = str($inputformat_temp).replace(\'__cb__\', \']\')\n+ \t\t#set $inputformat = $inputformat_temp\n+\t#end if\n+ --input-format="$inputformat"\n+#end if\n+\n+--type="$semantic_type"\n \n --output-path=outputpath.qza\n \n-#if str($sourceformat) != \'None\':\n-\t#if \'__ob__\' in str($sourceformat):\n- \t\t#set $sourceformat_temp = str($sourceformat).replace(\'__ob__\', \'[\')\n-\t\t#set $sourceformat_temp = str($sourceformat_temp).replace(\'__cb__\', \']\')\n- \t\t#set $sourceformat = $sourceformat_temp\n-\t#end if\n- --source-format="$sourceformat"\n-#end if\n ;\n cp outputpath.qza $outputpath\n ]]>\n@@ -161,13 +162,16 @@\n \t\t\t<option value="DistanceMatrix">DistanceMatrix</option>\n \t\t\t<option value="EMPPairedEndSequences">EMPPairedEndSequences</option>\n \t\t\t<option value="EMPSingleEndSequences">EMPSingleEndSequences</option>\n+\t\t\t<option value="ErrorCorrectionDetails">ErrorCorrectionDetails</option>\n \t\t\t<option value="FeatureData[AlignedSequence]">FeatureData[AlignedSequence]</option>\n+\t\t\t<option value="FeatureData[Importance]">FeatureData[Importance]</option>\n \t\t\t<option value="FeatureData[PairedEndSequence]">FeatureData[PairedEndSequence]</option>\n \t\t\t<option value="FeatureData[Sequence]">FeatureData[Sequence]</option>\n \t\t\t<option value="FeatureData[Taxonomy]">FeatureData[Taxonomy]</option>\n \t\t\t<option value="FeatureTable[Balance]">FeatureTable[Balance]</option>\n \t\t\t<option value="FeatureTable[Composition]">FeatureTable[Composition]</option>\n \t\t\t<option value="FeatureTable[Frequency]">FeatureTable[Frequency]</option>\n+\t\t\t<option value="FeatureTable[PercentileNormalized]">FeatureTable[PercentileNormalized]</option>\n \t\t\t<option value="FeatureTable[PresenceAbsence]">FeatureTable[PresenceAbsence]</option>\n \t\t\t<option value="FeatureTable[RelativeFrequency]">FeatureTable[RelativeFrequency]</option>\n \t\t\t<option value="Hierarchy">Hierarchy</option>\n@@ -176,21 +180,26 @@\n \t\t\t<option value="PCoAResults">PCoAResults</option>\n \t\t\t<option value="Phylogeny[Rooted]">Phylogeny[Rooted]</option>\n \t\t\t<option value="Phylogeny[Unrooted]">Phylogeny[Unrooted]</option>\n+\t\t\t<option value="Placements">Placements</option>\n \t\t\t<option value="QualityFilterStats">QualityFilterStats</option>\n \t\t\t<option value="RawSequences">RawSequences</option>\n \t\t\t<option value="SampleData[AlphaDiversity]">SampleData[AlphaDiversity]</option>\n \t\t\t<option value="SampleData[BooleanSeries]">SampleData[BooleanSeries]</option>\n+\t\t\t<option value="SampleData[ClassifierPredictions]">SampleData[ClassifierPredictions]</option>\n \t\t\t<option value="SampleData[DADA2Stats]">SampleData[DADA2Stats]</option>\n \t\t\t<option value="SampleData[FirstDifferences]">SampleData[FirstDifferences]</option>\n \t\t\t<option value="SampleData[JoinedSequencesWithQuality]">SampleData[JoinedSequencesWithQuality]</option>\n \t\t\t<option selected="True" value="SampleData[PairedEndSequencesWithQuality]">SampleData[PairedEndSequencesWithQuality]</option>\n+\t\t\t<option value="SampleData[RegressorPredictions]">SampleData[RegressorPredictions]</option>\n \t\t\t<option value="SampleData[SequencesWithQuality]">SampleData[SequencesWithQuality]</optio'..b'Classifier">TaxonomicClassifier</option>\n \t\t\t<option value="UchimeStats">UchimeStats</option>\n \t\t</param>\n \n-\t\t<param label="--source-format: The format of the data to be imported. If not provided, data must be in the format expected by the semantic type provided via --type." name="sourceformat" optional="True" type="select">\n+\t\t<param label="--input-format: The format of the data to be imported. If not provided, data must be in the format expected by the semantic type provided via --type." name="inputformat" optional="True" type="select">\n \t\t\t<option value="AlignedDNAFASTAFormat">AlignedDNAFASTAFormat</option>\n \t\t\t<option value="AlignedDNASequencesDirectoryFormat">AlignedDNASequencesDirectoryFormat</option>\n \t\t\t<option value="AlphaDiversityDirectoryFormat">AlphaDiversityDirectoryFormat</option>\n@@ -214,11 +223,14 @@\n \t\t\t<option value="EMPPairedEndDirFmt">EMPPairedEndDirFmt</option>\n \t\t\t<option value="EMPSingleEndCasavaDirFmt">EMPSingleEndCasavaDirFmt</option>\n \t\t\t<option value="EMPSingleEndDirFmt">EMPSingleEndDirFmt</option>\n+\t\t\t<option value="ErrorCorrectionDetailsDirFmt">ErrorCorrectionDetailsDirFmt</option>\n \t\t\t<option value="FastqGzFormat">FastqGzFormat</option>\n \t\t\t<option value="FirstDifferencesDirectoryFormat">FirstDifferencesDirectoryFormat</option>\n \t\t\t<option value="FirstDifferencesFormat">FirstDifferencesFormat</option>\n \t\t\t<option value="HeaderlessTSVTaxonomyDirectoryFormat">HeaderlessTSVTaxonomyDirectoryFormat</option>\n \t\t\t<option value="HeaderlessTSVTaxonomyFormat">HeaderlessTSVTaxonomyFormat</option>\n+\t\t\t<option value="ImportanceDirectoryFormat">ImportanceDirectoryFormat</option>\n+\t\t\t<option value="ImportanceFormat">ImportanceFormat</option>\n \t\t\t<option value="LSMatFormat">LSMatFormat</option>\n \t\t\t<option value="MultiplexedPairedEndBarcodeInSequenceDirFmt">MultiplexedPairedEndBarcodeInSequenceDirFmt</option>\n \t\t\t<option value="MultiplexedSingleEndBarcodeInSequenceDirFmt">MultiplexedSingleEndBarcodeInSequenceDirFmt</option>\n@@ -227,14 +239,23 @@\n \t\t\t<option value="OrdinationDirectoryFormat">OrdinationDirectoryFormat</option>\n \t\t\t<option value="OrdinationFormat">OrdinationFormat</option>\n \t\t\t<option value="PairedDNASequencesDirectoryFormat">PairedDNASequencesDirectoryFormat</option>\n-\t\t\t<option selected="True" value="PairedEndFastqManifestPhred33">PairedEndFastqManifestPhred33</option>\n+\t\t\t<option value="PairedEndFastqManifestPhred33">PairedEndFastqManifestPhred33</option>\n+\t\t\t<option value="PairedEndFastqManifestPhred33V2">PairedEndFastqManifestPhred33V2</option>\n \t\t\t<option value="PairedEndFastqManifestPhred64">PairedEndFastqManifestPhred64</option>\n+\t\t\t<option value="PairedEndFastqManifestPhred64V2">PairedEndFastqManifestPhred64V2</option>\n+\t\t\t<option value="PlacementsDirFmt">PlacementsDirFmt</option>\n+\t\t\t<option value="PlacementsFormat">PlacementsFormat</option>\n+\t\t\t<option value="PredictionsDirectoryFormat">PredictionsDirectoryFormat</option>\n+\t\t\t<option value="PredictionsFormat">PredictionsFormat</option>\n \t\t\t<option value="QIIME1DemuxDirFmt">QIIME1DemuxDirFmt</option>\n \t\t\t<option value="QIIME1DemuxFormat">QIIME1DemuxFormat</option>\n \t\t\t<option value="QualityFilterStatsDirFmt">QualityFilterStatsDirFmt</option>\n \t\t\t<option value="QualityFilterStatsFmt">QualityFilterStatsFmt</option>\n+\t\t\t<option value="SampleEstimatorDirFmt">SampleEstimatorDirFmt</option>\n \t\t\t<option value="SingleEndFastqManifestPhred33">SingleEndFastqManifestPhred33</option>\n+\t\t\t<option value="SingleEndFastqManifestPhred33V2">SingleEndFastqManifestPhred33V2</option>\n \t\t\t<option value="SingleEndFastqManifestPhred64">SingleEndFastqManifestPhred64</option>\n+\t\t\t<option value="SingleEndFastqManifestPhred64V2">SingleEndFastqManifestPhred64V2</option>\n \t\t\t<option value="SingleLanePerSamplePairedEndFastqDirFmt">SingleLanePerSamplePairedEndFastqDirFmt</option>\n \t\t\t<option value="SingleLanePerSampleSingleEndFastqDirFmt">SingleLanePerSampleSingleEndFastqDirFmt</option>\n \t\t\t<option value="TSVTaxonomyDirectoryFormat">TSVTaxonomyDirectoryFormat</option>\n' |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_vsearch_cluster-features-closed-reference.xml --- a/qiime2/qiime_vsearch_cluster-features-closed-reference.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_vsearch_cluster-features-closed-reference.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -9,7 +9,10 @@ --i-sequences=$isequences --i-table=$itable --i-reference-sequences=$ireferencesequences ---p-perc-identity="$ppercidentity" + +#if str($ppercidentity): + --p-perc-identity="$ppercidentity" +#end if #if str($pstrand) != 'None': --p-strand=$pstrand |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_vsearch_join-pairs.xml --- a/qiime2/qiime_vsearch_join-pairs.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_vsearch_join-pairs.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -13,7 +13,7 @@ --p-truncqual="$ptruncqual" #end if -#if $pminlen: +#if str($pminlen): --p-minlen=$pminlen #end if @@ -25,11 +25,11 @@ --p-allowmergestagger #end if -#if $pminovlen: +#if str($pminovlen): --p-minovlen=$pminovlen #end if -#if $pmaxdiffs: +#if str($pmaxdiffs): --p-maxdiffs=$pmaxdiffs #end if @@ -45,19 +45,19 @@ --p-maxee="$pmaxee" #end if -#if $pqmin: +#if str($pqmin): --p-qmin=$pqmin #end if -#if $pqminout: +#if str($pqminout): --p-qminout=$pqminout #end if -#if $pqmax: +#if str($pqmax): --p-qmax=$pqmax #end if -#if $pqmaxout: +#if str($pqmaxout): --p-qmaxout=$pqmaxout #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_vsearch_uchime-denovo.xml --- a/qiime2/qiime_vsearch_uchime-denovo.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_vsearch_uchime-denovo.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -10,23 +10,23 @@ --i-sequences=$isequences --i-table=$itable -#if $pdn: +#if str($pdn): --p-dn=$pdn #end if -#if $pmindiffs: +#if str($pmindiffs): --p-mindiffs=$pmindiffs #end if -#if $pmindiv: +#if str($pmindiv): --p-mindiv=$pmindiv #end if -#if $pminh: +#if str($pminh): --p-minh=$pminh #end if -#if $pxn: +#if str($pxn): --p-xn=$pxn #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 qiime2/qiime_vsearch_uchime-ref.xml --- a/qiime2/qiime_vsearch_uchime-ref.xml Wed Jul 17 01:53:11 2019 -0400 +++ b/qiime2/qiime_vsearch_uchime-ref.xml Tue Aug 13 07:40:25 2019 -0400 |
| b |
| @@ -11,23 +11,23 @@ --i-table=$itable --i-reference-sequences=$ireferencesequences -#if $pdn: +#if str($pdn): --p-dn=$pdn #end if -#if $pmindiffs: +#if str($pmindiffs): --p-mindiffs=$pmindiffs #end if -#if $pmindiv: +#if str($pmindiv): --p-mindiv=$pmindiv #end if -#if $pminh: +#if str($pminh): --p-minh=$pminh #end if -#if $pxn: +#if str($pxn): --p-xn=$pxn #end if |
| b |
| diff -r eda5df31da55 -r 71f124e02000 tool_data/ref_classifier.loc --- a/tool_data/ref_classifier.loc Wed Jul 17 01:53:11 2019 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| b |
| @@ -1,5 +0,0 @@ -#<unique_id> <name> <database_caption> <qza_file_path> -# -#For each reference database, you need to download the qza file in qiime path -# - |
| b |
| diff -r eda5df31da55 -r 71f124e02000 tool_data/ref_taxnonomy.loc --- a/tool_data/ref_taxnonomy.loc Wed Jul 17 01:53:11 2019 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| b |
| @@ -1,5 +0,0 @@ -#<unique_id> <name> <database_caption> <qza_file_path> -# -#For each reference database, you need to download the qza file in qiime path -# - |
| b |
| diff -r eda5df31da55 -r 71f124e02000 tool_data_table_conf.xml.sample --- a/tool_data_table_conf.xml.sample Wed Jul 17 01:53:11 2019 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| b |
| @@ -1,11 +0,0 @@ -<tables> - <table name="taxonomy_fp" comment_char="#"> - <columns>value, name, dbkey, path</columns> - <file path="tool_data/ref_taxnonomy.loc" /> - </table> - <table name="classifier_fp" comment_char="#"> - <columns>value, name, dbkey, path</columns> - <file path="tool-data/ref_classifier.loc" /> - </table> -</tables> - |