Galaxy |

Changeset 0:7488fa30b865 (2016-06-06)

Next changeset 1:c3b5869b95fd (2016-06-07)

Commit message:
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/circexplorer commit a35817eb4119e6d674d01a5f7f91d4cddd0155d1-dirty

added:
circexplorer.xml
static/images/flow.jpg
test-data/circ_Chimeric.out.junction
test-data/circ_genome.fasta
test-data/circ_output.txt
test-data/circ_ref.txt
test-data/circ_tophat.bam

diff -r 000000000000 -r 7488fa30b865 circexplorer.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/circexplorer.xml Mon Jun 06 18:12:32 2016 -0400

[

@@ -0,0 +1,90 @@
+<tool id="circexplorer" name="CIRCexplorer" version="0.1.0">
+    <requirements>
+        <requirement type="package" version="0.1">circexplorer</requirement>
+    </requirements>
+    <command><![CDATA[
+        #if str($input_selection.input_type) == "star"
+            star_parse.py "$input_selection.junc" ./fusion_junctions.txt &&
+        #end if
+
+        CIRCexplorer.py
+
+        #if str($input_selection.input_type) == "tophat"
+            -f "$input_selection.fusion"
+        #elif str($input_selection.input_type) == "star"
+            -j ./fusion_junctions.txt
+        #end if
+
+        -g "$genome"
+        -r "$ref"
+        $no_fix
+]]>
+    </command>
+    <inputs>
+        <conditional name="input_selection">
+            <param name="input_type" type="select" label="Select input type" help="">
+                <option value="tophat">TopHat & TopHat-Fusion</option>
+                <option value="star">STAR</option>
+            </param>
+            <when value="tophat">
+                <param argument="--fusion" type="data" format="bam" label="TopHat-Fusion fusion BAM file (used in TopHat-Fusion mapping)" />
+            </when>
+            <when value="star">
+                <param argument="--junc" type="data" format="bam" label="STAR Chimeric junction file (used in STAR mapping)" />
+            </when>
+        </conditional>
+
+        <param argument="--genome" type="data" format="fasta" label="Genome FASTA file" />
+
+        <param argument="--ref" type="data" format="txt" label="Gene annotation" />
+
+        <param name="no_fix" type="boolean" checked="false" truevalue="--no-fix" falsevalue=""
+               label="No-fix mode (useful for species with poor gene annotations)" help="(--no-fix)" />
+    </inputs>
+    <outputs>
+        <data name="output" format="txt"/>
+    </outputs>
+    <tests>
+        <test>
+            <param name="input_type" value="tophat" />
+            <param name="fusion" value="circ_tophat.bam" />
+            <param name="genome" value="circ_genome.fasta" />
+            <param name="ref" value="circ_ref.txt" />
+            <output name="output" file="circ_output.txt" ftype="txt"/>
+        </test>
+        <test>
+            <param name="input_type" value="star" />
+            <param name="junc" value="circ_Chimeric.out.junction" />
+            <param name="genome" value="circ_genome.fasta" />
+            <param name="ref" value="circ_ref.txt" />
+            <output name="output" file="circ_output.txt" ftype="txt"/>
+        </test>
+    </tests>
+    <help>
+**What it does**
+
+`CIRCexplorer`_ is a combined strategy to identify junction reads from back spliced exons and intron lariats.
+
+**A schematic flow shows the pipeline**
+
+.. image:: $PATH_TO_IMAGES/flow.jpg
+
+.. _CIRCexplorer: https://github.com/YangLab/CIRCexplorer
+
+**Notice**
+
+CIRCexplorer is now only a circular RNA annotating tool and it parses fusion junction information from mapping results of other aligners. The result of circular RNA annotating directly depends on the mapping strategy of aligners. Different aligners may have different circular RNA annotations. CIRCexplorer is now only in charge of giving fusion junctions a correct gene annotation. Other functions and supports for more aligners are under development.
+    </help>
+    <citations>
+        <citation type="bibtex">
+            @article{Cell,
+                author = {Zhang XO, Wang HB, Zhang Y, Lu X, Chen LL and Yang L},
+                year = {2014},
+                title = {Complementary Sequence-Mediated Exon Circularization},
+                publisher = {Cell},
+                journal = {Cell},
+                url = {http://www.cell.com/cell/abstract/S0092-8674(14)01111-8},
+            }
+        </citation>
+    </citations>
+</tool>

diff -r 000000000000 -r 7488fa30b865 static/images/flow.jpg

Binary file static/images/flow.jpg has changed

diff -r 000000000000 -r 7488fa30b865 test-data/circ_Chimeric.out.junction
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/circ_Chimeric.out.junction Mon Jun 06 18:12:32 2016 -0400

@@ -0,0 +1,5 @@
+chr14 50329517 + chr7 101273023 - 0 0 0 NB500961:75:HK5KFBGXX:1:11101:16270:1101 50320455 38M8935N89M24S 101273007 8S16M127S
+GL000255.1 2529926 + chr15 43404287 + 0 0 0 NB500961:75:HK5KFBGXX:1:11101:12553:1148 2529791 135M16S 43404288 135S16M
+chrM 2627 - chr7 101273023 - 0 0 0 NB500961:75:HK5KFBGXX:1:11101:23326:1154 2628 15S136M 101273008 15M136S
+chr15 40627489 + chr15 40625526 + 0 0 0 NB500961:75:HK5KFBGXX:1:11101:24169:1220 40627445 44M107S 40625527 44S107M
+chr18 22007961 - chr7 101273023 - 0 0 0 NB500961:75:HK5KFBGXX:1:11101:19668:1230 22007962 17S50M821N53M1400N31M 101273007 1S16M134S

diff -r 000000000000 -r 7488fa30b865 test-data/circ_genome.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/circ_genome.fasta Mon Jun 06 18:12:32 2016 -0400

@@ -0,0 +1,14 @@
+>test_chromosome
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+ACTACTATCTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCC
+ACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGC
+AGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCT
+ACGTATTTGGCGCGCGGCGCTACGGCTGAGCGTCGAGCTTGCGATACGCC
+GTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
+ACTATTACTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACT
+GTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
+TTTTCTACTTGAGACTGGGATCGAGGCGGACTTTTTAGGACGGGACTTGC
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

diff -r 000000000000 -r 7488fa30b865 test-data/circ_ref.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/circ_ref.txt Mon Jun 06 18:12:32 2016 -0400

@@ -0,0 +1,1 @@
+SMARCA4 NM_003072 chr19 + 11071597 11172958 11094827 11172492 35 11071597,11094796,11095948,11096864,11097580,11098341,11099992,11101825,11105503,11106888,11107169,11113704,11114015,11118577,11121056,11123624,11129632,11130266,11132400,11134193,11135006,11136097,11136975,11138459,11141405,11143965,11144442,11144798,11145589,11151982,11168930,11169463,11170428,11170720,11172459, 11071850,11095049,11096081,11097269,11097679,11098600,11100119,11101999,11105677,11107056,11107220,11113835,11114073,11118699,11121207,11123788,11129699,11130377,11132643,11134307,11135114,11136184,11137022,11138626,11141569,11144193,11144541,11144876,11145808,11152236,11169039,11169565,11170561,11170863,11172958,

diff -r 000000000000 -r 7488fa30b865 test-data/circ_tophat.bam

Binary file test-data/circ_tophat.bam has changed