Galaxy |

Changeset 10:7573a6c11c4d (2019-11-27)

Previous changeset 9:61a3e97aa865 (2019-09-30) Next changeset 11:5f43703968cf (2019-12-18)

Commit message:
"planemo upload for repository https://github.com/phac-nml/galaxy_tools/tree/master/tools/staramr commit 69b939934ff9f503c7314cdbe6e3cb08e5f84db5"

modified:
staramr_search.xml
test-data/test1-resfinder.tsv
test-data/test1-summary.tsv
test-data/test2-resfinder.tsv
test-data/test2-summary.tsv
test-data/test3-summary.tsv
test-data/test4-summary.tsv
test-data/test5-summary.tsv
test-data/test6-summary.tsv

added:
test-data/test8-summary.tsv

diff -r 61a3e97aa865 -r 7573a6c11c4d staramr_search.xml
--- a/staramr_search.xml Mon Sep 30 12:45:02 2019 -0400
+++ b/staramr_search.xml Wed Nov 27 08:59:23 2019 -0500

[

@@ -1,7 +1,7 @@
<tool id="staramr_search" name="staramr" version="@VERSION@">
     <description>Scans genome assemblies against the ResFinder, PlasmidFinder, and PointFinder databases searching for AMR genes.</description>
     <macros>
-     <token name="@VERSION@">0.6.1</token>
+     <token name="@VERSION@">0.7.0</token>
     </macros>
     <requirements>
         <requirement type="package" version="@VERSION@">staramr</requirement>
@@ -24,6 +24,12 @@

         --nprocs "\${GALAXY_SLOTS:-1}"

+        --genome-size-lower-bound $advanced.genome_size_lower_bound
+        --genome-size-upper-bound $advanced.genome_size_upper_bound
+        --minimum-N50-value $advanced.minimum_N50_value
+        --minimum-contig-length $advanced.minimum_contig_length
+        --unacceptable-number-contigs $advanced.unacceptable_number_contigs
+
         --pid-threshold $advanced.pid_threshold
         --percent-length-overlap-resfinder $advanced.plength_resfinder
         --percent-length-overlap-plasmidfinder $advanced.plength_plasmidfinder
@@ -77,6 +83,16 @@
                    min="0" max="100" help="(--percent-length-overlap-pointfinder)" />
             <param name="plength_plasmidfinder" type="float" label="Percent length overlap of BLAST hit for PlasmidFinder database" value="60.0"
                    min="0" max="100" help="(--percent-length-overlap-plasmidfinder)" />
+            <param name="genome_size_lower_bound" type="integer" label="The lower bound for our genome size for the quality metrics" value="4000000"
+                   help="(--genome-size-lower-bound)" />
+            <param name="genome_size_upper_bound" type="integer" label="The upper bound for our genome size for the quality metrics" value="6000000"
+                   help="(--genome-size-upper-bound)" />
+            <param name="minimum_N50_value" type="integer" label="The minimum N50 value for the quality metrics" value="10000"
+                   help="(--minimum-N50-value)" />
+            <param name="minimum_contig_length" type="integer" label="The minimum contig length for the quality metrics" value="300"
+                   help="(--minimum-contig-length)" />
+            <param name="unacceptable_number_contigs" type="integer" label="The number of contigs, under the minimum contig length which is unacceptable for the quality metrics" value="1000"
+                   help="(--unacceptable-number-contigs)" />
             <param name="report_all_blast" type="boolean" label="Report all BLAST results" truevalue="--report-all-blast" falsevalue=""
                    help="Report all BLAST results (includes overlapping hits, mainly for debugging)" />
             <param name="exclude_negatives" type="boolean" label="Exclude negative (non-resistant) results" truevalue="--exclude-negatives" falsevalue="" />
@@ -169,6 +185,13 @@

             <output name="summary" file="test5-summary.tsv" ftype="tabular" />
         </test>
+        <test>
+            <param name="genomes" value="test-aminoglycoside.fsa" />
+            <param name="genome_size_lower_bound" value="1" />
+            <param name="genome_size_upper_bound" value="10" />
+
+            <output name="summary" file="test8-summary.tsv" ftype="tabular"/>
+        </test>
     </tests>
     <help><![CDATA[
staramr

diff -r 61a3e97aa865 -r 7573a6c11c4d test-data/test1-resfinder.tsv
--- a/test-data/test1-resfinder.tsv Mon Sep 30 12:45:02 2019 -0400
+++ b/test-data/test1-resfinder.tsv Wed Nov 27 08:59:23 2019 -0500

@@ -1,2 +1,2 @@
-Isolate ID Gene Predicted Phenotype %Identity %Overlap HSP Length/Total Length Contig Start End Accession
-16S-rc_gyrA-rc_beta-lactam.fsa blaIMP-42 ampicillin, amoxicillin/clavulanic acid, cefoxitin, ceftriaxone, meropenem 99.73 100.00 741/741 16S_rrsD 4381 5121 AB753456
+Isolate ID Gene Predicted Phenotype %Identity %Overlap HSP Length/Total Length Contig Start End Accession Sequence
+16S-rc_gyrA-rc_beta-lactam.fsa blaIMP-42 ampicillin, amoxicillin/clavulanic acid, cefoxitin, ceftriaxone, meropenem 99.73 100.00 741/741 16S_rrsD 4381 5121 AB753456 ATGAGCAAGTTATCTGTATTCTTTATATTTTTGTTTTGCAGCATTGCTACCGCAGCAGAGTCTTTGCCAGATTTAAAAATTGAAAAGCTTGATGAAGGCGTTTATGTTCATACTTCGTTTGAAGAAGTTAACAGGTGGGGCGTTGTTCCTAAACATGGTTTGGTGGTTCTTGTAAATGCTGAGGCTTACCTAATTGACACTCCATTTACGGCTAAAGATACTGAAAAGTTAGTCACTTGGTTTGTGGAGCGTGGCTATAAAATAAAAGGCAGCATTTCCTCTCATTTTCATAGCGACAGCACGGGCGGAATAGAGTGGCTTAATTCTCGATCTATCCCCACGTATGCATCTGAATTAACAAATGAACTGCTTAAAAAAGACGGTAAGGTTCAAGCCACAAATTCATTTAGCGGAGTTAACTATTGGCTAGTTAAAAATAAAATTGAAGTTTTTTATCCAGGCCCGGGACACACTCCAGATAACGTAGTGGTTTGGTTGCCTGAAAGGAAAATATTATTCGGTGGTTGTTTTATTAAACCGTACGGTTTAGGCAATTTGGGTGACGCAAATATAGAAGCTTGGCCAAAGTCCGCCAAATTATTAAAGTCCAAATATGGTAAGGCAAAACTGGTTGTTCCAAGTCACAGTGAAGTTGGAGACGCATCACTCTTGAAACTTACATTAGAGCAGGCGGTTAAAGGGTTAAACGAAAGTAAAAAACCATCAAAACCAAGCAACTAA

diff -r 61a3e97aa865 -r 7573a6c11c4d test-data/test1-summary.tsv
--- a/test-data/test1-summary.tsv Mon Sep 30 12:45:02 2019 -0400
+++ b/test-data/test1-summary.tsv Wed Nov 27 08:59:23 2019 -0500

[

@@ -1,2 +1,2 @@
-Isolate ID Genotype Predicted Phenotype Plasmid Scheme Sequence Type
-16S-rc_gyrA-rc_beta-lactam.fsa 16S_rrsD (C1065T), blaIMP-42, gyrA (A67P) spectinomycin, ampicillin, amoxicillin/clavulanic acid, cefoxitin, ceftriaxone, meropenem, ciprofloxacin I/R, nalidixic acid None - -
+Isolate ID Quality Module Genotype Predicted Phenotype Plasmid Scheme Sequence Type Genome Length N50 value Number of Contigs Greater Than Or Equal To 300 bp Quality Module Feedback
+16S-rc_gyrA-rc_beta-lactam.fsa Failed 16S_rrsD (C1065T), blaIMP-42, gyrA (A67P) spectinomycin, ampicillin, amoxicillin/clavulanic acid, cefoxitin, ceftriaxone, meropenem, ciprofloxacin I/R, nalidixic acid None - - 5220 5220 1 Genome length is not within the acceptable length range [4000000,6000000] ; N50 value is not greater than the specified minimum value [10000]

diff -r 61a3e97aa865 -r 7573a6c11c4d test-data/test2-resfinder.tsv
--- a/test-data/test2-resfinder.tsv Mon Sep 30 12:45:02 2019 -0400
+++ b/test-data/test2-resfinder.tsv Wed Nov 27 08:59:23 2019 -0500

diff -r 61a3e97aa865 -r 7573a6c11c4d test-data/test2-summary.tsv
--- a/test-data/test2-summary.tsv Mon Sep 30 12:45:02 2019 -0400
+++ b/test-data/test2-summary.tsv Wed Nov 27 08:59:23 2019 -0500

[

@@ -1,2 +1,2 @@
-Isolate ID Genotype Predicted Phenotype Plasmid Scheme Sequence Type
-16S-rc_gyrA-rc_beta-lactam.fsa blaIMP-42 ampicillin, amoxicillin/clavulanic acid, cefoxitin, ceftriaxone, meropenem None - -
+Isolate ID Quality Module Genotype Predicted Phenotype Plasmid Scheme Sequence Type Genome Length N50 value Number of Contigs Greater Than Or Equal To 300 bp Quality Module Feedback
+16S-rc_gyrA-rc_beta-lactam.fsa Failed blaIMP-42 ampicillin, amoxicillin/clavulanic acid, cefoxitin, ceftriaxone, meropenem None - - 5220 5220 1 Genome length is not within the acceptable length range [4000000,6000000] ; N50 value is not greater than the specified minimum value [10000]

diff -r 61a3e97aa865 -r 7573a6c11c4d test-data/test3-summary.tsv
--- a/test-data/test3-summary.tsv Mon Sep 30 12:45:02 2019 -0400
+++ b/test-data/test3-summary.tsv Wed Nov 27 08:59:23 2019 -0500

[

@@ -1,2 +1,2 @@
-Isolate ID Genotype Predicted Phenotype Plasmid Scheme Sequence Type
-16S-rc_gyrA-rc_beta-lactam.fsa None Sensitive None - -
+Isolate ID Quality Module Genotype Predicted Phenotype Plasmid Scheme Sequence Type Genome Length N50 value Number of Contigs Greater Than Or Equal To 300 bp Quality Module Feedback
+16S-rc_gyrA-rc_beta-lactam.fsa Failed None Sensitive None - - 5220 5220 1 Genome length is not within the acceptable length range [4000000,6000000] ; N50 value is not greater than the specified minimum value [10000]

diff -r 61a3e97aa865 -r 7573a6c11c4d test-data/test4-summary.tsv
--- a/test-data/test4-summary.tsv Mon Sep 30 12:45:02 2019 -0400
+++ b/test-data/test4-summary.tsv Wed Nov 27 08:59:23 2019 -0500

[

@@ -1,2 +1,2 @@
-Isolate ID Genotype Predicted Phenotype Plasmid Scheme Sequence Type
-16S_rc_gyrA_rc_beta-lactam_spaces__extra:characters_.fsa None Sensitive None - -
+Isolate ID Quality Module Genotype Predicted Phenotype Plasmid Scheme Sequence Type Genome Length N50 value Number of Contigs Greater Than Or Equal To 300 bp Quality Module Feedback
+16S_rc_gyrA_rc_beta-lactam_spaces__extra:characters_.fsa Failed None Sensitive None - - 5220 5220 1 Genome length is not within the acceptable length range [4000000,6000000] ; N50 value is not greater than the specified minimum value [10000]

diff -r 61a3e97aa865 -r 7573a6c11c4d test-data/test5-summary.tsv
--- a/test-data/test5-summary.tsv Mon Sep 30 12:45:02 2019 -0400
+++ b/test-data/test5-summary.tsv Wed Nov 27 08:59:23 2019 -0500

[

@@ -1,2 +1,2 @@
-Isolate ID Genotype Predicted Phenotype Plasmid Scheme Sequence Type
-test-aminoglycoside.fsa None Sensitive None - -
+Isolate ID Quality Module Genotype Predicted Phenotype Plasmid Scheme Sequence Type Genome Length N50 value Number of Contigs Greater Than Or Equal To 300 bp Quality Module Feedback
+test-aminoglycoside.fsa Failed None Sensitive None - - 438 438 1 Genome length is not within the acceptable length range [4000000,6000000] ; N50 value is not greater than the specified minimum value [10000]

diff -r 61a3e97aa865 -r 7573a6c11c4d test-data/test6-summary.tsv
--- a/test-data/test6-summary.tsv Mon Sep 30 12:45:02 2019 -0400
+++ b/test-data/test6-summary.tsv Wed Nov 27 08:59:23 2019 -0500

[

@@ -1,2 +1,2 @@
-Isolate ID Genotype Predicted Phenotype Plasmid Scheme Sequence Type
-test-aminoglycoside.fsa aac(6')-Iaa gentamicin None - -
+Isolate ID Quality Module Genotype Predicted Phenotype Plasmid Scheme Sequence Type Genome Length N50 value Number of Contigs Greater Than Or Equal To 300 bp Quality Module Feedback
+test-aminoglycoside.fsa Failed aac(6')-Iaa gentamicin None - - 438 438 1 Genome length is not within the acceptable length range [4000000,6000000] ; N50 value is not greater than the specified minimum value [10000]

diff -r 61a3e97aa865 -r 7573a6c11c4d test-data/test8-summary.tsv
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test8-summary.tsv Wed Nov 27 08:59:23 2019 -0500

[

@@ -0,0 +1,2 @@
+Isolate ID Quality Module Genotype Predicted Phenotype Plasmid Scheme Sequence Type Genome Length N50 value Number of Contigs Greater Than Or Equal To 300 bp Quality Module Feedback
+test-aminoglycoside.fsa Failed None Sensitive None - - 438 438 1 Genome length is not within the acceptable length range [1,10] ; N50 value is not greater than the specified minimum value [10000]