Previous changeset 19:604e373b3b45 (2018-02-23) Next changeset 21:feab8fd2f0a7 (2018-02-23) |
Commit message:
Uploaded 20180223 |
modified:
query.xml |
added:
._.shed.yml ._example.tsv ._query.py ._query.xml |
b |
diff -r 604e373b3b45 -r 7944301895cb ._.shed.yml |
b |
Binary file ._.shed.yml has changed |
b |
diff -r 604e373b3b45 -r 7944301895cb ._example.tsv |
b |
Binary file ._example.tsv has changed |
b |
diff -r 604e373b3b45 -r 7944301895cb ._query.py |
b |
Binary file ._query.py has changed |
b |
diff -r 604e373b3b45 -r 7944301895cb ._query.xml |
b |
Binary file ._query.xml has changed |
b |
diff -r 604e373b3b45 -r 7944301895cb query.xml --- a/query.xml Fri Feb 23 13:21:20 2018 -0500 +++ b/query.xml Fri Feb 23 15:45:14 2018 -0500 |
b |
@@ -64,7 +64,7 @@ idn CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC The ID can contain alphanumeric characters in addition to spaces, dots, dashes, and round and square brackets. -Any additional characters will be trimmed out. +Any additional character will be trimmed out. The output of the tool is a collection that contains a file for each ID with a list of accession numbers representing the samples that express one particular transcript. |