| Previous changeset 10:a1abfa420d9d (2022-02-13) Next changeset 12:14e7c35f3d00 (2023-01-25) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/pygenometracks commit df07890f27c5d18e423ec889eadca82bd7958def |
|
modified:
macros.xml pyGenomeTracks.xml test-data/bigwig_multiple.png test-data/master_TADs_BW_plot.png test-data/master_TADs_plot.png test-data/test11.ini test-data/test12.ini test-data/test15.ini test-data/test17.ini test-data/test19.ini test-data/test2.ini test-data/test4.ini test-data/test5.ini test-data/test6.ini test-data/test7.ini test-data/test8.ini test-data/test9.ini test-data/test_TADs_bdgm.png test-data/test_alpha.png test-data/test_arcs_use_middle.png test-data/test_arrowhead_zoom.png test-data/test_gtf_bed4.png test-data/test_gtf_flybase_param.png test-data/test_link.png test-data/test_log.png test-data/test_log_grid.png test-data/test_narrowPeak.png test-data/test_operation.png test-data/test_tssarrow.png test-data/test_ucsc_param.png test-data/testpyGT.sh |
|
added:
test-data/chrM.fa test-data/chrM.fa.fai test-data/fasta_indexes.loc test-data/first.maf test-data/islands.bed test-data/master_fasta.png test-data/test22.ini test-data/test23.ini test-data/test24.ini test-data/test25.ini test-data/test_maf.png test-data/test_matrix_square.png test-data/test_vhighlight.png tool-data/fasta_indexes.loc.sample tool_data_table_conf.xml.sample tool_data_table_conf.xml.test |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 macros.xml --- a/macros.xml Sun Feb 13 22:43:45 2022 +0000 +++ b/macros.xml Sat Oct 01 08:43:22 2022 +0000 |
| [ |
| @@ -1,6 +1,6 @@ <macros> - <token name="@TOOL_VERSION@">3.6</token> - <token name="@VERSION_SUFFIX@">1</token> + <token name="@TOOL_VERSION@">3.7</token> + <token name="@VERSION_SUFFIX@">0</token> <xml name="requirements"> <requirements> <requirement type="package" version="@TOOL_VERSION@">pygenometracks</requirement> @@ -61,6 +61,27 @@ <xml name="track_input_link_macro"> <param name="track_input_link" type="data" format="bed,interval" label="Track file(s) for links" multiple="False"/> </xml> + <xml name="track_input_fasta_macro"> + <conditional name="fasta_source"> + <param name="fasta_source_selector" type="select" label="Choose the source for the fasta to display"> + <option value="cached">Locally cached</option> + <option value="history">History</option> + </param> + <when value="cached"> + <param name="fasta_cached" type="select" label="Fasta availables"> + <options from_data_table="fasta_indexes"> + <validator type="no_options" message="No cached fasta is available"/> + </options> + </param> + </when> + <when value="history"> + <param name="fasta_local" type="data" format="fasta" label="Fasta from history"/> + </when> + </conditional> + </xml> + <xml name="track_input_maf_macro"> + <param name="track_input_maf" type="data" format="maf" label="Track file for maf" multiple="False"/> + </xml> <!-- Common to nearly all tracks: --> <xml name="plot_title"> <param name="title" type="text" optional="true" label="Plot title" multiple="True"/> @@ -166,6 +187,20 @@ <when value="none" /> </conditional> </xml> + <xml name="backbone_color_bed_macro"> + <conditional name="backbone_color_bed"> + <param name="backbone_color_bed_select" type="select" label="Define the color of the backbone:"> + <option value="manually" selected="True">manually</option> + <option value="bed_rgb">From the 9th field</option> + <option value="none">No border</option> + </param> + <when value="manually"> + <param name="color" type="color" value="#000000" label="Color of the backbone"/> + </when> + <when value="bed_rgb" /> + <when value="none" /> + </conditional> + </xml> <xml name="bed_advanced_macro"> <param name="global_max_row" type="boolean" truevalue="true" falsevalue="false" checked="false" label="Global max rows" /> @@ -175,8 +210,17 @@ <section name ="gtf" title="When using gtf as input" expanded="False"> <param name="prefered_name" type="text" value="transcript_name" label="attribute to use as label" help="Usually transcript_name or gene_name"/> - <param name="merge_transcripts" type="boolean" truevalue="true" falsevalue="false" checked="false" - label="Merge all transcripts of each gene in a single entry" /> + <conditional name="merge_transcripts"> + <param name="merge_transcripts_select" type="select" label="Merge all transcripts of each gene in a single entry"> + <option value="false" selected="True">No</option> + <option value="true">Yes</option> + </param> + <when value="true"> + <param name="merge_overlapping_exons" type="boolean" truevalue="true" falsevalue="false" checked="true" + label="Merge overlapping exons" help="Usually it makes prettier plots" /> + </when> + <when value="false" /> + </conditional> </section> </xml> <xml name="utr_macro"> @@ -352,4 +396,21 @@ <option value="magma_r">magma reversed</option> <option value="cividis_r">cividis reversed</option> </xml> + <xml name="links_arcs_triangles_options"> + <param name="compact_arcs_level" type="select" label="Height of arcs and triangles:"> + <option value="0" selected="True">default (proportional to distance)</option> + <option value="1">compacted (the height is proportional to the square root of the distance)</option> + <option value="2">highly compacted (the height is the same for all distances)</option> + </param> + <param name="use_middle" type="select" label="Coordinates to use" help="Not useful with loops"> + <option value="false" selected="True">Extremities (start of first and end of second)</option> + <option value="true">Center (mean of start and end for each)</option> + </param> + </xml> + <xml name="region2_option"> + <param name="region2" type="text" label="Region of the genome that should be plotted on the y axis" optional="true" + value="" help="The format is chr:start-end, for example chr10:10-500. By default this is the region on the x-axis. Top is start and bottom is end. Use 'Invert the track' if you want the contrary."> + <validator type="expression" message="Region should be like chr10:10-500">'^[a-zA-Z0-9_]:\d+-\d+$'</validator> + </param> + </xml> </macros> |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 pyGenomeTracks.xml --- a/pyGenomeTracks.xml Sun Feb 13 22:43:45 2022 +0000 +++ b/pyGenomeTracks.xml Sat Oct 01 08:43:22 2022 +0000 |
| [ |
| b'@@ -7,14 +7,21 @@\n <expand macro="requirements" />\n <command detect_errors="exit_code">\n <![CDATA[\n- ## First symlink data of hic to have the good extension\n+ ## First symlink data\n+ ## of hic to have the good extension\n+ ## of fasta to have the index written in the working directory\n #for $counter, $track in enumerate($tracks):\n- #if $track.track_file_style_conditional.track_file_style_selector == "hic_matrix_option":\n+ #if $track.track_file_style_conditional.track_file_style_selector in ["hic_matrix_option", "hic_matrix_square_option"]:\n #for $counter_matrix, $data_matrix in enumerate($track.track_file_style_conditional.matrix_h5_cooler_multiple):\n #set ext = $data_matrix.extension\n ln -s $data_matrix ${counter}_${counter_matrix}.$ext &&\n #end for\n #end if\n+ #if $track.track_file_style_conditional.track_file_style_selector == "fasta_option":\n+ #if $track.track_file_style_conditional.fasta_source.fasta_source_selector == "history":\n+ ln -s $track.track_file_style_conditional.fasta_source.fasta_local fasta_${counter}.fa &&\n+ #end if\n+ #end if\n #end for\n \n \n@@ -46,7 +53,7 @@\n <configfile name="tracks_config">\n ## Each track:\n #for $counter, $track in enumerate($tracks):\n- ## Hi-C Track\n+ ## Hi-C Track triangle\n #if $track.track_file_style_conditional.track_file_style_selector == "hic_matrix_option":\n #for $counter_matrix, $data_matrix in enumerate($track.track_file_style_conditional.matrix_h5_cooler_multiple):\n [hic_section_${counter}_${counter_matrix}]\n@@ -106,6 +113,67 @@\n #end for\n #end if\n \n+ ## Hi-C Track square\n+ #if $track.track_file_style_conditional.track_file_style_selector == "hic_matrix_square_option":\n+ #for $counter_matrix, $data_matrix in enumerate($track.track_file_style_conditional.matrix_h5_cooler_multiple):\n+[hic_section_${counter}_${counter_matrix}]\n+ #set ext = $data_matrix.extension\n+file = ${counter}_${counter_matrix}.$ext\n+file_type = hic_matrix_square\n+ #if $track.track_file_style_conditional.title:\n+title = $track.track_file_style_conditional.title\n+ #else:\n+title = $data_matrix.element_identifier\n+ #end if\n+ #if $track.track_file_style_conditional.region2:\n+region2 = $track.track_file_style_conditional.region2\n+ #end if\n+ #if $track.track_file_style_conditional.colormap:\n+colormap = $track.track_file_style_conditional.colormap\n+ #end if\n+ #if $track.track_file_style_conditional.min_value != "":\n+min_value = $track.track_file_style_conditional.min_value\n+ #end if\n+ #if $track.track_file_style_conditional.max_value != "":\n+max_value = $track.track_file_style_conditional.max_value\n+ #end if\n+transform = $track.track_file_style_conditional.transform\n+ #if $track.track_file_style_conditional.height_matrix != "":\n+height = $track.track_file_style_conditional.height_matrix\n+ #end if\n+ #if $track.track_file_style_conditional.show_masked_bins:\n+show_masked_bins = $track.track_file_style_conditional.show_masked_bins\n+ #end if\n+ #if $track.track_file_style_conditional.invert_orientation:\n+orientation = inverted\n+ #end if\n+ #if $track.track_file_style_conditional.scale_factor:\n+scale_factor = $track.track_file_style_conditional.scale_factor\n+ #end if\n+rasterize = $track.track_file_style_conditional.rasterize\n+ ## If a boundary file is given a new section needs to be written:\n+ #if str($track.track_file_style_conditional.boundaries_file) != "None":\n+ #if len($track.track_file_style_conditional.boundaries_file)>$counter_matrix:\n+ #set boundary_file = $track.track_file_style_conditional.boundaries_file[$counter_matrix]\n+ #else:\n+ #set boundary_file = $track.track_file_style_conditional.boundaries_file[0]\n+ #end if\n+[t'..b'_input_maf" value="first.maf" ftype="maf"/>\n+ <param name="reference" value="mm10"/>\n+ <param name="title" value="species_order = hg19, species_labels = Human, species_order_only = true" />\n+ <param name="height" value="3"/>\n+ <param name="species_order" value="hg19"/>\n+ <param name="species_labels" value="Human"/>\n+ <param name="species_order_only" value="true"/>\n+ <param name="spacer_height" value="1"/>\n+ </conditional>\n+ </repeat>\n+ <repeat name="tracks">\n+ <conditional name="track_file_style_conditional">\n+ <param name="track_file_style_selector" value="xaxis_option" />\n+ <param name="xaxis_where" value="bottom" />\n+ </conditional>\n+ </repeat>\n+ <param name="image_file_format" value="png" />\n+ <output name="outFileName" file="test_maf.png" ftype="png" compare="sim_size" delta="1200" />\n+ </test>\n+ <!--test 25-->\n+ <test>\n+ <param name="region" value="chr2:73,800,000-75,744,000"/>\n+ <repeat name="tracks">\n+ <conditional name="track_file_style_conditional">\n+ <param name="track_file_style_selector" value="bedgraph_track_option" />\n+ <param name="track_input_bedgraph" value="GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz" ftype="bedgraph" />\n+ <param name="title" value="bedgraph color = blue" />\n+ <param name="height_bedgraph" value="5" />\n+ <param name="color" value="blue" />\n+ <param name="show_data" value="true" />\n+ <param name="max_value" value="5" />\n+ </conditional>\n+ </repeat>\n+ <repeat name="tracks">\n+ <conditional name="track_file_style_conditional">\n+ <param name="track_file_style_selector" value="vhighlight_track_option" />\n+ <param name="track_input_bed_single" value="islands.bed" ftype="bed"/>\n+ </conditional>\n+ </repeat>\n+ <repeat name="tracks">\n+ <conditional name="track_file_style_conditional">\n+ <param name="track_file_style_selector" value="xaxis_option" />\n+ <param name="xaxis_where" value="bottom" />\n+ </conditional>\n+ </repeat>\n+ <param name="image_file_format" value="png" />\n+ <output name="outFileName" file="test_vhighlight.png" ftype="png" compare="sim_size" delta="1200" />\n+ </test>\n </tests>\n <help><![CDATA[\n \n@@ -2738,6 +3300,8 @@\n - narrow peaks\n - links\n - Hi-C matrices (cool or HiCExplorer h5)\n+ - Fasta\n+ - MAF (multiple alignment format)\n \n _________________\n \n@@ -2757,10 +3321,13 @@\n - **Bedgraph track:** generic bedgraph track plotting.\n - **Bedgraph matrix track** is used to specifically plot bm files computed by HiCExplorer\'s ``hicFindTADs`` (TAD seperation scores).\n - **Vlines:** vertical lines drawn on top of all tracks following a bed file. It is used as a visual support where regions start / end over all tracks, for example to display TAD boundaries computed by HiCExplorer\'s ``hicFindTADs``.\n+ - **Vhighlight:** vertical rectangles drawn on top of all tracks following a bed file. It is used as a visual support to highlight some regions.\n - **Hlines:** horizontal lines drawn either by themselves or on top of other tracks.\n - **Spacer:** Add some space between two tracks.\n - **X-axis:** Plot x-axis scale wherever you want.\n - **Scale bar track:** Plot scale bar.\n+ - **Fasta track:** Display sequences from fasta.\n+ - **Maf track:** Display alignments from maf.\n \n For each track, parameters for the color, the width or the font size can be defined.\n \n' |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/bigwig_multiple.png |
| b |
| Binary file test-data/bigwig_multiple.png has changed |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/chrM.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/chrM.fa Sat Oct 01 08:43:22 2022 +0000 |
| b |
| b'@@ -0,0 +1,333 @@\n+>chrM\n+GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCAT\n+TTGGTATTTTCGTCTGGGGGGTATGCACGCGATAGCATTGCGAGACGCTG\n+GAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATC\n+CTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTA\n+AAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATAACAATTGAAT\n+GTCTGCACAGCCACTTTCCACACAGACATCATAACAAAAAATTTCCACCA\n+AACCCCCCCTCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCA\n+AACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAATTT\n+TATCTTTTGGCGGTATGCACTTTTAACAGTCACCCCCCAACTAACACATT\n+ATTTTCCCCTCCCACTCCCATACTACTAATCTCATCAATACAACCCCCGC\n+CCATCCTACCCAGCACACACACACCGCTGCTAACCCCATACCCCGAACCA\n+ACCAAACCCCAAAGACACCCCCCACAGTTTATGTAGCTTACCTCCTCAAA\n+GCAATACACTGAAAATGTTTAGACGGGCTCACATCACCCCATAAACAAAT\n+AGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACACATGCAA\n+GCATCCCCGTTCCAGTGAGTTCACCCTCTAAATCACCACGATCAAAAGGA\n+ACAAGCATCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCAC\n+ACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTT\n+AACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACCGC\n+GGTCACACGATTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTA\n+GATCACCCCCTCCCCAATAAAGCTAAAACTCACCTGAGTTGTAAAAAACT\n+CCAGTTGACACAAAATAGACTACGAAAGTGGCTTTAACATATCTGAACAC\n+ACAATAGCTAAGACCCAAACTGGGATTAGATACCCCACTATGCTTAGCCC\n+TAAACCTCAACAGTTAAATCAACAAAACTGCTCGCCAGAACACTACGAGC\n+CACAGCTTAAAACTCAAAGGACCTGGCGGTGCTTCATATCCCTCTAGAGG\n+AGCCTGTTCTGTAATCGATAAACCCCGATCAACCTCACCACCTCTTGCTC\n+AGCCTATATACCGCCATCTTCAGCAAACCCTGATGAAGGCTACAAAGTAA\n+GCGCAAGTACCCACGTAAAGACGTTAGGTCAAGGTGTAGCCCATGAGGTG\n+GCAAGAAATGGGCTACATTTTCTACCCCAGAAAACTACGATAGCCCTTAT\n+GAAACTTAAGGGTCGAAGGTGGATTTAGCAGTAAACTAAGAGTAGAGTGC\n+TTAGTTGAACAGGGCCCTGAAGCGCGTACACACCGCCCGTCACCCTCCTC\n+AAGTATACTTCAAAGGACATTTAACTAAAACCCCTACGCATTTATATAGA\n+GGAGACAAGTCGTAACATGGTAAGTGTACTGGAAAGTGCACTTGGACGAA\n+CCAGAGTGTAGCTTAACACAAAGCACCCAACTTACACTTAGGAGATTTCA\n+ACTTAACTTGACCGCTCTGAGCTAAACCTAGCCCCAAACCCACTCCACCT\n+TACTACCAGACAACCTTAGCCAAACCATTTACCCAAATAAAGTATAGGCG\n+ATAGAAATTGAAACCTGGCGCAATAGATATAGTACCGCAAGGGAAAGATG\n+AAAAATTATAACCAAGCATAATATAGCAAGGACTAACCCCTATACCTTCT\n+GCATAATGAATTAACTAGAAATAACTTTGCAAGGAGAGCCAAAGCTAAGA\n+CCCCCGAAACCAGACGAGCTACCTAAGAACAGCTAAAAGAGCACACCCGT\n+CTATGTAGCAAAATAGTGGGAAGATTTATAGGTAGAGGCGACAAACCTAC\n+CGAGCCTGGTGATAGCTGGTTGTCCAAGATAGAATCTTAGTTCAACTTTA\n+AATTTGCCCACAGAACCCTCTAAATCCCCTTGTAAATTTAACTGTTAGTC\n+CAAAGAGGAACAGCTCTTTGGACACTAGGAAAAAACCTTGTAGAGAGAGT\n+AAAAAATTTAACACCCATAGTAGGCCTAAAAGCAGCCACCAATTAAGAAA\n+GCGTTCAAGCTCAACACCCACTACCTAAAAAATCCCAAACATATAACTGA\n+ACTCCTCACACCCAATTGGACCAATCTATCACCCTATAGAAGAACTAATG\n+TTAGTATAAGTAACATGAAAACATTCTCCTCCGCATAAGCCTGCGTCAGA\n+TTAAAACACTGAACTGACAATTAACAGCCCAATATCTACAATCAACCAAC\n+AAGTCATTATTACCCTCACTGTCAACCCAACACAGGCATGCTCATAAGGA\n+AAGGTTAAAAAAAGTAAAAGGAACTCGGCAAATCTTACCCCGCCTGTTTA\n+CCAAAAACATCACCTCTAGCATCACCAGTATTAGAGGCACCGCCTGCCCA\n+GTGACACATGTTTAACGGCCGCGGTACCCTAACCGTGCAaaggtagcata\n+atcacttgttccttaaatagggacctgtatgaatggctccacgagggttc\n+agctgtctcttacttttaaccagtgaaattgacctgcccgtgaagaggcg\n+ggcataacacagcaagacgagaagaccctatggagctttaatttaTTAAT\n+GCAAACAGTACCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCATT\n+AAAAATTTCGGTTGGGGCGACCTCGGAGCAGAACCCAACCTCCGAGCAGT\n+ACATGCTAAGACTTCACCAGTCAAAGCGAACTACTATACTCAATTGATCC\n+AATAACTTGACCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCT\n+ATTCTAGAGTCCATATCAACAATAGGGTTTACGACCTCGATGTTGGATCA\n+GGACATCCCGATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATT\n+AAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCT\n+ATCTACNTTCAAATTCCTCCCTGTACGAAAGGACAAGAGAAATAAGGCCT\n+ACTTCACAAAGCGCCTTCCCCCGTAAATGATATCATCTCAACTTAGTATT\n+ATACCCACACCCACCCAAGAACAGGGTTTgttaagatggcagagcccggt\n+aatcgcataaaacttaaaactttacagtcagaggttcaattcctcttctt\n+aacaacaTACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAAT\n+CGCAATGGCATTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATAC\n+AACTACGCAAAGGCCCCAACGTTGTAGGCCCCTACGGGCTACTACAACCC\n+TTCGCTGACGCCATAAAACTCTTCACCAAAGAGCCCCTAAAACCCGCCAC\n+ATCTACCATCACCCTCTACATCACCGCCCCGACCTTAGCTCTCACCATCG\n+CTCTTCTACTATGAACCCCCCTCCCCATACCCAACCCCCTGGTCAACCTC\n+AACCTAGGCCTCCTATTTATTCTAGCCACCTCTAGCCTAGCCGTTTACTC\n+AATCCTCTGATCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGCG\n+CACTGCGAGCAGTAGCCCAAACAATCTCATATGAAGTCACCCTAGCCATC\n+ATTCTACTATCAACATTACTAATAAGTGGCTCCTTTAACCTCTCCACCCT\n+TATCACAACACAAGAACACCT'..b'CTTAGTTACCGCTAACAACCTATTC\n+CAACTGTTCATCGGCTGAGAGGGCGTAGGAATTATATCCTTCTTGCTCAT\n+CAGTTGATGATACGCCCGAGCAGATGCCAACACAGCAGCCATTCAAGCAA\n+TCCTATACAACCGTATCGGCGATATCGGTTTCATCCTCGCCTTAGCATGA\n+TTTATCCTACACTCCAACTCATGAGACCCACAACAAATAGCCCTTCTAAA\n+CGCTAATCCAAGCCTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCAG\n+GCAAATCAGCCCAATTAGGTCTCCACCCCTGACTCCCCTCAGCCATAGAA\n+GGCCCCACCCCAGTCTCAGCCCTACTCCACTCAAGCACTATAGTTGTAGC\n+AGGAATCTTCTTACTCATCCGCTTCCACCCCCTAGCAGAAAATAGCCCAC\n+TAATCCAAACTCTAACACTATGCTTAGGCGCTATCACCACTCTGTTCGCA\n+GCAGTCTGCGCCCTTACACAAAATGACATCAAAAAAATCGTAGCCTTCTC\n+CACTTCAAGTCAACTAGGACTCATAATAGTTACAATCGGCATCAACCAAC\n+CACACCTAGCATTCCTGCACATCTGTACCCACGCCTTCTTCAAAGCCATA\n+CTATTTATGTGCTCCGGGTCCATCATCCACAACCTTAACAATGAACAAGA\n+TATTCGAAAAATAGGAGGACTACTCAAAACCATACCTCTCACTTCAACCT\n+CCCTCACCATTGGCAGCCTAGCATTAGCAGGAATACCTTTCCTCACAGGT\n+TTCTACTCCAAAGACCACATCATCGAAACCGCAAACATATCATACACAAA\n+CGCCTGAGCCCTATCTATTACTCTCATCGCTACCTCCCTGACAAGCGCCT\n+ATAGCACTCGAATAATTCTTCTCACCCTAACAGGTCAACCTCGCTTCCCC\n+ACCCTTACTAACATTAACGAAAATAACCCCACCCTACTAAACCCCATTAA\n+ACGCCTGGCAGCCGGAAGCCTATTCGCAGGATTTCTCATTACTAACAACA\n+TTTCCCCCGCATCCCCCTTCCAAACAACAATCCCCCTCTACCTAAAACTC\n+ACAGCCCTCGCTGTCACTTTCCTAGGACTTCTAACAGCCCTAGACCTCAA\n+CTACCTAACCAACAAACTTAAAATAAAATCCCCACTATGCACATTTTATT\n+TCTCCAACATACTCGGATTCTACCCTAGCATCACACACCGCACAATCCCC\n+TATCTAGGCCTTCTTACGAGCCAAAACCTGCCCCTACTCCTCCTAGACCT\n+AACCTGACTAGAAAAGCTATTACCTAAAACAATTTCACAGCACCAAATCT\n+CCACCTCCATCATCACCTCAACCCAAAAAGGCATAATTAAACTTTACTTC\n+CTCTCTTTCTTCTTCCCACTCATCCTAACCCTACTCCTAATCACATAACC\n+TATTCCCCCGAGCAATCTCAATTACAATATATACACCAACAAACAATGTT\n+CAACCAGTAACTACTACTAATCAACGCCCATAATCATACAAAGCCCCCGC\n+ACCAATAGGATCCTCCCGAATCAACCCTGACCCCTCTCCTTCATAAATTA\n+TTCAGCTTCCTACACTATTAAAGTTTACCACAACCACCACCCCATCATAC\n+TCTTTCACCCACAGCACCAATCCTACCTCCATCGCTAACCCCACTAAAAC\n+ACTCACCAAGACCTCAACCCCTGACCCCCATGCCTCAGGATACTCCTCAA\n+TAGCCATCGCTGTAGTATATCCAAAGACAACCATCATTCCCCCTAAATAA\n+ATTAAAAAAACTATTAAACCCATATAACCTCCCCCAAAATTCAGAATAAT\n+AACACACCCGACCACACCGCTAACAATCAATACTAAACCCCCATAAATAG\n+GAGAAGGCTTAGAAGAAAACCCCACAAACCCCATTACTAAACCCACACTC\n+AACAGAAACAAAGCATACATCATTATTCTCGCACGGACTACAACCACGAC\n+CAATGATATGAAAAACCATCGTTGTATTTCAACTACAAGAACACCAATGA\n+CCCCAATACGCAAAACTAACCCCCTAATAAAATTAATTAACCACTCATTC\n+ATCGACCTCCCCACCCCATCCAACATCTCCGCATGATGAAACTTCGGCTC\n+ACTCCTTGGCGCCTGCCTGATCCTCCAAATCACCACAGGACTATTCCTAG\n+CCATGCACTACTCACCAGACGCCTCAACCGCCTTTTCATCAATCGCCCAC\n+ATCACTCGAGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCAA\n+TGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCC\n+TATATTACGGATCATTTCTCTACTCAGAAACCTGAAACATCGGCATTATC\n+CTCCTGCTTGCAACTATAGCAACAGCCTTCATAGGCTATGTCCTCCCGTG\n+AGGCCAAATATCATTCTGAGGGGCCACAGTAATTACAAACTTACTATCCG\n+CCATCCCATACATTGGGACAGACCTAGTTCAATGAATCTGAGGAGGCTAC\n+TCAGTAGACAGTCCCACCCTCACACGATTCTTTACCTTTCACTTCATCTT\n+GCCCTTCATTATTGCAGCCCTAGCAACACTCCACCTCCTATTCTTGCACG\n+AAACGGGATCAAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAATC\n+ACCTTCCACCCTTACTACACAATCAAAGACGCCCTCGGCTTACTTCTCTT\n+CCTTCTCTCCTTAATGACATTAACACTATTCTCACCAGACCTCCTAGGCG\n+ACCCAGACAATTATACCCTAGCCAACCCCTTAAACACCCCTCCCCACATC\n+AAGCCCGAATGATATTTCCTATTCGCCTACACAATTCTCCGATCCGTCCC\n+TAACAAACTAGGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTAG\n+CAATAATCCCCATCCTCCATATATCCAAACAACAAAGCATAATATTTCGC\n+CCACTAAGCCAATCACTTTATTGACTCCTAGCCGCAGACCTCCTCATTCT\n+AACCTGAATCGGAGGACAACCAGTAAGCTACCCTTTTACCATCATTGGAC\n+AAGTAGCATCCGTACTATACTTCACAACAATCCTAATCCTAATACCAACT\n+ATCTCCCTAATTGAAAACAAAATACTCAAATGGGCCTGTCCTTGTAGTAT\n+AAACTAATACACCAGTCTTGTAAACCGGAGATGAAAACCTTTTTCCAAGG\n+ACAAATCAGAGAAAAAGTCTTTAACTCCACCATTAGCACCCAAAGCTAAG\n+ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGT\n+ACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACA\n+TTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCAC\n+CTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTA\n+CAAGcaagtacagcaatcaaccctcaactatcacacatcaactgcaactC\n+CAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAA\n+CAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAA\n+ATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGAC\n+CACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCG\n+CTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACAT\n+CTGGTTCCTACTTCAGGGTCATAAAGCCTAAATAGCCCACACGTTCCCCT\n+TAAATAAGACATCACGATG\n' |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/chrM.fa.fai --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/chrM.fa.fai Sat Oct 01 08:43:22 2022 +0000 |
| b |
| @@ -0,0 +1,1 @@ +chrM 16569 6 50 51 |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/fasta_indexes.loc --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fasta_indexes.loc Sat Oct 01 08:43:22 2022 +0000 |
| b |
| @@ -0,0 +1,1 @@ +chrM hg19 human mitochondrial genome ${__HERE__}/chrM.fa |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/first.maf --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/first.maf Sat Oct 01 08:43:22 2022 +0000 |
| b |
| b'@@ -0,0 +1,987 @@\n+##maf version=1\n+a score=41100.0\n+s mm10.chr2 34705072 4 + 182113224 G-AAG \n+s rn5.chr3 19096925 4 + 183740530 G-AAG \n+i rn5.chr3 C 0 C 0 \n+s hg19.chr9 13114691 4 - 141213431 G-ACA \n+i hg19.chr9 I 195 I 6 \n+\n+a score=423183.0\n+s mm10.chr2 34705076 25 + 182113224 AGGTGGAGA-------ACTATAGAATTTGAAA \n+s rn5.chr3 19096929 25 + 183740530 AGGCAGAGA-------ACTGTGGAGTTTGAAA \n+i rn5.chr3 C 0 C 0 \n+s hg19.chr9 13114701 25 - 141213431 AAATAAAAG-------GCTGTAAATCTTGAAG \n+i hg19.chr9 I 6 C 0 \n+\n+a score=66158.0\n+s mm10.chr2 34705101 4 + 182113224 GTCT \n+s rn5.chr3 19096954 4 + 183740530 GGCT \n+i rn5.chr3 C 0 C 0 \n+s hg19.chr9 13114726 4 - 141213431 TTCT \n+i hg19.chr9 C 0 C 0 \n+\n+a score=387811.0\n+s mm10.chr2 34705105 18 + 182113224 AATATTGCTTTCA---GCAAA \n+s rn5.chr3 19096958 18 + 183740530 AATATTGCTTTCA---GCAAA \n+i rn5.chr3 C 0 C 0 \n+s hg19.chr9 13114730 18 - 141213431 AACACTGCTCTCA---GCAAA \n+i hg19.chr9 C 0 C 0 \n+\n+a score=10920.0\n+s mm10.chr2 34705123 1 + 182113224 T \n+s rn5.chr3 19096976 1 + 183740530 T \n+i rn5.chr3 C 0 C 0 \n+s hg19.chr9 13114748 1 - 141213431 T \n+i hg19.chr9 C 0 C 0 \n+\n+a score=-29032.0\n+s mm10.chr2 34705124 7 + 182113224 GTCTTGA--- \n+s rn5.chr3 19096977 7 + 183740530 GTCCTAA--- \n+i rn5.chr3 C 0 C 0 \n+s hg19.chr9 13114749 2 - 141213431 -----AA--- \n+i hg19.chr9 C 0 C 0 \n+\n+a score=-6898.0\n+s mm10.chr2 34705131 8 + 182113224 TTTA------AAAA \n+s rn5.chr3 19096984 8 + 183740530 TTTT------AAAA \n+i rn5.chr3 C 0 C 0 \n+s hg19.chr9 13114751 8 - 141213431 CTTT------AAAA \n+i hg19.chr9 C 0 I 1 \n+\n+a score=37882.0\n+s mm10.chr2 34705139 24 + 182113224 AAAAATCTATGAGTGAAATG---AATA \n+s rn5.chr3 19096992 23 + 183740530 CGAATTC-ATGAATGAAATG---AATA \n+i rn5.chr3 C 0 C 0 \n+s hg19.chr9 13114760 24 - 141213431 AGATAAGTATGCAGAGGATG---GAAA \n+i hg19.chr9 I 1 C 0 \n+\n+a score=2589.0\n+s mm10.chr2 34705163 1 + 182113224 T \n+s rn5.chr3 19097015 1 + 183740530 T \n+i rn5.chr3 C 0 C 0 \n+s hg19.chr9 13114784 1 - 141213431 T \n+i hg19.chr9 C 0 C 0 \n+\n+a score=-36380.0\n+s mm10.chr2 34705164 35 + 182113224 ATAATGCCATGAAAT--TGACTCTA-ATTTCT-AAATGT \n+s rn5.chr3 19097016 30 + 183740530 ATAATGCCACG-AAT--TAACTCTA-ATTTCT-AA---- \n+i rn5.chr3 C 0 C 0 \n+s hg19.chr9 13114785 32 - 141213431 -TTCAAACATAAAA---AAATTATT-A-ATCT-AAATGT \n+i hg19.chr9 C 0 C 0 \n+\n+a score=33050.0\n+s mm10.chr2 34705199 17 + 182113224 ACTA-TTTTA--GACTACAG \n+s rn5.chr3 19097046 14 + 183740530 ---A-TCTTA--GACTACAG \n+i rn5.chr3 C 0 C 0 \n+s hg19.chr9 13114817 13 - 141213431 -----TTTTA--GTCTGAAG \n+i hg19.chr9 C 0 I 3470 \n+\n+a score=548.0\n+s mm10.chr2 34705216 11 + 182113224 AACTCCCCCTC-- \n+s rn5.chr3 19097060 11 + 183740530 AACCCCCACTC-- \n+i rn5.chr3 C 0 C 0 \n+\n+a score=-4856.0\n+s mm10.chr2 34705227 6 + 182113224 CCCAAA- \n+s rn5.chr3 19097071 6 + 183740530 CCAAAA- \n+i rn5.chr3 C 0 C 0 \n+\n+a score=87104.0\n+s mm10.chr2 34705233 20 + 182113224 AGATAACCCTAACTAAGCAT \n+s rn5.chr3 19097077 16 + 183740530 AGATACCC----CTAAGCAC \n+i rn5.chr3 C 0 C 0 \n+\n+a score=1769.0\n+s mm10.chr2 34705253 1 + 182113224 G \n+s rn5.chr3 19097093 1 + 183740530 G \n+i rn5.chr3 C 0 C 0'..b' C 0 C 0 \n+s hg19.chr9 13119520 3 - 141213431 CCT---- \n+i hg19.chr9 C 0 C 0 \n+\n+a score=73448.0\n+s mm10.chr2 34707081 10 + 182113224 CAACACTGTA--- \n+s rn5.chr3 19099128 9 + 183740530 -AACACTGTA--- \n+i rn5.chr3 C 0 C 0 \n+s hg19.chr9 13119523 9 - 141213431 -GGTATTAAA--- \n+i hg19.chr9 C 0 C 0 \n+s sorAra1.scaffold_258498 6374 1 + 196505 ---------A--- \n+i sorAra1.scaffold_258498 C 0 C 0 \n+\n+a score=-28287.0\n+s mm10.chr2 34707091 5 + 182113224 TCAA---C \n+s rn5.chr3 19099137 7 + 183740530 TCCACT-C \n+i rn5.chr3 C 0 C 0 \n+s sorAra1.scaffold_258498 6375 5 + 196505 TCAAC--- \n+i sorAra1.scaffold_258498 C 0 C 0 \n+\n+a score=4831.0\n+s mm10.chr2 34707096 1 + 182113224 T \n+s rn5.chr3 19099144 1 + 183740530 T \n+i rn5.chr3 C 0 C 0 \n+s hg19.chr9 13119532 1 - 141213431 T \n+i hg19.chr9 C 0 I 709 \n+s sorAra1.scaffold_258498 6380 1 + 196505 T \n+i sorAra1.scaffold_258498 C 0 I 1 \n+\n+a score=555.0\n+s mm10.chr2 34707097 1 + 182113224 C \n+s rn5.chr3 19099145 1 + 183740530 C \n+i rn5.chr3 C 0 C 0 \n+\n+a score=18165.0\n+s mm10.chr2 34707098 3 + 182113224 TCT \n+s rn5.chr3 19099146 3 + 183740530 TCT \n+i rn5.chr3 C 0 C 0 \n+s sorAra1.scaffold_258498 6382 2 + 196505 -TT \n+i sorAra1.scaffold_258498 I 1 C 0 \n+\n+a score=32760.0\n+s mm10.chr2 34707101 3 + 182113224 AAA \n+s rn5.chr3 19099149 3 + 183740530 AAA \n+i rn5.chr3 C 0 C 0 \n+s sorAra1.scaffold_258498 6384 3 + 196505 AAA \n+i sorAra1.scaffold_258498 C 0 C 0 \n+\n+a score=-12377.0\n+s mm10.chr2 34707104 8 + 182113224 TCTCAATG \n+s rn5.chr3 19099152 8 + 183740530 GTTCAATG \n+i rn5.chr3 C 0 C 0 \n+s sorAra1.scaffold_258498 6387 6 + 196505 --TTTAAA \n+i sorAra1.scaffold_258498 C 0 I 672 \n+\n+a score=13142.0\n+s mm10.chr2 34707112 17 + 182113224 ttctcaaaagcacttaa--- \n+s rn5.chr3 19099160 17 + 183740530 TTTTCAAAAGCACTTAC--- \n+i rn5.chr3 C 0 C 0 \n+\n+a score=2730.0\n+s mm10.chr2 34707129 2 + 182113224 aa \n+s rn5.chr3 19099177 2 + 183740530 AA \n+i rn5.chr3 C 0 C 0 \n+\n+a score=1746.0\n+s mm10.chr2 34707131 3 + 182113224 tgg \n+s rn5.chr3 19099179 3 + 183740530 Tgg \n+i rn5.chr3 C 0 C 0 \n+\n+a score=1998.0\n+s mm10.chr2 34707134 22 + 182113224 gcat------gaca--gcagggcaatctca \n+s rn5.chr3 19099182 24 + 183740530 gcat------gatattgcagggcactctca \n+i rn5.chr3 C 0 C 0 \n+\n+a score=452.0\n+s mm10.chr2 34707156 4 + 182113224 acac \n+s rn5.chr3 19099206 4 + 183740530 gcac \n+i rn5.chr3 C 0 C 0 \n+\n+a score=8445.0\n+s mm10.chr2 34707160 152 + 182113224 tcaataagcagaggcaggtggatctctgtgagtttgagtccagcctaaaatacactggcagttccatgaatagcctgagctacatgacgagatcctgtctcaaaCTAGCTCCAAAAAGGAAGACAGG-AAAATCATTTCTTTACTTAATACTT \n+s rn5.chr3 19099210 147 + 183740530 tcaagaggcagaggcaggtgga--tctgtaagtctgaggccagcctgaggttcactggcagttcca-gcatagcctgagctacatgatgagaccctggctcaaaccaa---aagaaaGAAAGAAAGGAAAAATGATTTCTTTATCTAATATTT \n+i rn5.chr3 C 0 I 1 \n+\n+a score=0.0\n+s mm10.chr2 34707312 6 + 182113224 TACCTA \n+\n' |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/islands.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/islands.bed Sat Oct 01 08:43:22 2022 +0000 |
| b |
| @@ -0,0 +1,5 @@ +chr2 73970064 73983434 islandI +chr2 74060473 74082287 islandII +chr2 74201443 74221207 islandIII +chr2 74264930 74274051 islandIV +chr2 74290763 74304478 islandV |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/master_TADs_BW_plot.png |
| b |
| Binary file test-data/master_TADs_BW_plot.png has changed |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/master_TADs_plot.png |
| b |
| Binary file test-data/master_TADs_plot.png has changed |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/master_fasta.png |
| b |
| Binary file test-data/master_fasta.png has changed |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test11.ini --- a/test-data/test11.ini Sun Feb 13 22:43:45 2022 +0000 +++ b/test-data/test11.ini Sat Oct 01 08:43:22 2022 +0000 |
| [ |
| @@ -1,6 +1,6 @@ [x-axis] where = top -[hic_section_0_0] +[hic_section_1_0] file = test-data/Li_et_al_2015.h5 file_type = hic_matrix title = Kc DpnII (Li et al. 2015) @@ -12,21 +12,25 @@ rasterize = true [spacer] height = 0.05 -[bedgraph_matrix_2] +[bedgraph_matrix_3] file = test-data/tad_score.gz -title = TAD separation score (Ramirez et al.) +title = TAD separation score (Ramirez et al.) as block with horizontal lines and data range height = 10.0 type = lines file_type = bedgraph_matrix show_data_range = true plot_horizontal_lines = true pos_score_in_bin = block -[bedgraph_matrix_3] +individual_color = grey +summary_color = #1f77b4 +[bedgraph_matrix_4] file = test-data/tad_score.gz -title = TAD separation score (Ramirez et al.) +title = TAD separation score (Ramirez et al.) as center without horizontal lines, summary in red and individual in blue height = 10.0 type = lines file_type = bedgraph_matrix show_data_range = false plot_horizontal_lines = false -pos_score_in_bin = center \ No newline at end of file +pos_score_in_bin = center +individual_color = blue +summary_color = red \ No newline at end of file |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test12.ini --- a/test-data/test12.ini Sun Feb 13 22:43:45 2022 +0000 +++ b/test-data/test12.ini Sat Oct 01 08:43:22 2022 +0000 |
| [ |
| @@ -1,6 +1,6 @@ [x-axis] where = top -[hic_section_0_0] +[hic_section_1_0] file = Li_et_al_2015.h5 file_type = hic_matrix title = Kc DpnII (Li et al. 2015) @@ -9,7 +9,7 @@ transform = no scale_factor = 1.0 rasterize = true -[links_1] +[links_2] file = test.arcs height = 1.5 color = red @@ -19,7 +19,7 @@ links_type = loops overlay_previous = share-y file_type = links -[links_2] +[links_3] file = test.arcs title = test.arcs height = 5.0 @@ -29,6 +29,8 @@ line_width = 0.5 line_style = solid links_type = arcs +compact_arcs_level = 0 +use_middle = false orientation = inverted overlay_previous = no file_type = links \ No newline at end of file |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test15.ini --- a/test-data/test15.ini Sun Feb 13 22:43:45 2022 +0000 +++ b/test-data/test15.ini Sat Oct 01 08:43:22 2022 +0000 |
| [ |
| @@ -2,16 +2,21 @@ where = bottom [genes_1_0] file = dm3_genes.bed.gz -title = flybase +title = flybase backbone blue color = #000000 border_color = #000000 style = flybase height_utr = 1.0 color_utr = grey arrowhead_included = false +arrowhead_fraction = 0.004 +color_backbone = blue display = stacked height = 10.0 labels = true +all_labels_inside = false +labels_in_margin = false +fontstyle = normal file_type = bed global_max_row = false max_labels = 60 @@ -19,14 +24,18 @@ overlay_previous = no [genes_2_0] file = dm3_genes.bed.gz -title = UCSC +title = UCSC backbone blue color = #000000 border_color = #000000 style = UCSC arrow_interval = 10 +color_backbone = blue display = stacked height = 10.0 labels = true +all_labels_inside = false +labels_in_margin = false +fontstyle = normal file_type = bed global_max_row = false max_labels = 60 @@ -43,6 +52,9 @@ display = stacked height = 10.0 labels = true +all_labels_inside = false +labels_in_margin = false +fontstyle = normal file_type = bed global_max_row = false max_labels = 60 @@ -60,6 +72,9 @@ display = stacked height = 10.0 labels = true +all_labels_inside = false +labels_in_margin = false +fontstyle = normal file_type = bed global_max_row = false max_labels = 60 |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test17.ini --- a/test-data/test17.ini Sun Feb 13 22:43:45 2022 +0000 +++ b/test-data/test17.ini Sat Oct 01 08:43:22 2022 +0000 |
| [ |
| @@ -1,67 +1,129 @@ -[test bedgraph] +[bedgraph_0] file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz -color = blue -height = 5 title = bedgraph color = blue transform = no -transform = no - -[test bedgraph] +color = blue +alpha = 1.0 +height = 5.0 +show_data_range = true +grid = false +nans_to_zeros = false +use_middle = false +file_type = bedgraph +type = fill +overlay_previous = no +[bedgraph_1] file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz +title = bedgraph color = blue transform = log color = blue -height = 5 -title = bedgraph color = blue transform = log +alpha = 1.0 +height = 5.0 +show_data_range = true +grid = false +nans_to_zeros = false +use_middle = false +file_type = bedgraph +type = fill transform = log - -[test bedgraph] +y_axis_values = transformed +log_pseudocount = 0.0 +overlay_previous = no +[bedgraph_2] file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz +title = bedgraph color = red transform = log min_value = 1 color = red -height = 5 -title = bedgraph color = red transform = log min_value = 1 -min_value = 1 +alpha = 1.0 +height = 5.0 +min_value = 1.0 +show_data_range = true +grid = false +nans_to_zeros = false +use_middle = false +file_type = bedgraph +type = fill transform = log - -[test bedgraph] +y_axis_values = transformed +log_pseudocount = 0.0 +overlay_previous = no +[bedgraph_3] file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz -color = green -height = 5 title = bedgraph color = green transform = log log_pseudocount = 2 min_value = 0 -transform = log -log_pseudocount = 2 -min_value = 0 - -[test bedgraph with operation] -file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz color = green -height = 5 -title = bedgraph color = green operation = log(2+file) min_value = 0.7 -operation = log(2+file) -min_value = 0.7 - -[test bedgraph] +alpha = 1.0 +height = 5.0 +min_value = 0.0 +show_data_range = true +grid = false +nans_to_zeros = false +use_middle = false +file_type = bedgraph +type = fill +transform = log +y_axis_values = transformed +log_pseudocount = 2.0 +overlay_previous = no +[bedgraph_4] file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz -color = black -height = 5 +title = bedgraph color = green operation = log(2+file) min_value = 0.7 +color = green +alpha = 1.0 +height = 5.0 +min_value = 0.7 +show_data_range = true +grid = false +nans_to_zeros = false +use_middle = false +file_type = bedgraph +type = fill +operation = log(2+file) +overlay_previous = no +[bedgraph_5] +file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz title = bedgraph color = black transform = log2 log_pseudocount = 1 min_value = 0 -transform = log2 -log_pseudocount = 1 -min_value = 0 - -[test bedgraph] -file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz color = black -height = 5 +alpha = 1.0 +height = 5.0 +min_value = 0.0 +show_data_range = true +grid = false +nans_to_zeros = false +use_middle = false +file_type = bedgraph +type = fill +transform = log2 +y_axis_values = transformed +log_pseudocount = 1.0 +overlay_previous = no +[bedgraph_6] +file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz title = bedgraph color = black operation = log2(1+file) min_value = 0 -operation = log2(1+file) -min_value = 0 - -[test bedgraph] -file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz color = black -height = 5 +alpha = 1.0 +height = 5.0 +min_value = 0.0 +show_data_range = true +grid = false +nans_to_zeros = false +use_middle = false +file_type = bedgraph +type = fill +operation = log2(1+file) +overlay_previous = no +[bedgraph_7] +file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz title = bedgraph color = black transform = log2 log_pseudocount = 1 min_value = 0 y_axis_values = original +color = black +alpha = 1.0 +height = 5.0 +min_value = 0.0 +show_data_range = true +grid = false +nans_to_zeros = false +use_middle = false +file_type = bedgraph +type = fill transform = log2 -log_pseudocount = 1 -min_value = 0 y_axis_values = original - -[x-axis] \ No newline at end of file +log_pseudocount = 1.0 +overlay_previous = no +[x-axis] +where = bottom \ No newline at end of file |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test19.ini --- a/test-data/test19.ini Sun Feb 13 22:43:45 2022 +0000 +++ b/test-data/test19.ini Sat Oct 01 08:43:22 2022 +0000 |
| [ |
| @@ -1,75 +1,129 @@ -[test bedgraph] +[bedgraph_0] file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz +title = bedgraph color = blue transform = no color = blue -height = 5 -title = bedgraph color = blue transform = no -transform = no +alpha = 1.0 +height = 5.0 +show_data_range = true grid = true - -[test bedgraph] +nans_to_zeros = false +use_middle = false +file_type = bedgraph +type = fill +overlay_previous = no +[bedgraph_1] file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz -color = blue -height = 5 title = bedgraph color = blue transform = log -transform = log +color = blue +alpha = 1.0 +height = 5.0 +show_data_range = true grid = true - -[test bedgraph] +nans_to_zeros = false +use_middle = false +file_type = bedgraph +type = fill +transform = log +y_axis_values = transformed +log_pseudocount = 0.0 +overlay_previous = no +[bedgraph_2] file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz +title = bedgraph color = red transform = log min_value = 1 color = red -height = 5 -title = bedgraph color = red transform = log min_value = 1 -min_value = 1 +alpha = 1.0 +height = 5.0 +min_value = 1.0 +show_data_range = true +grid = true +nans_to_zeros = false +use_middle = false +file_type = bedgraph +type = fill transform = log -grid = true - -[test bedgraph] +y_axis_values = transformed +log_pseudocount = 0.0 +overlay_previous = no +[bedgraph_3] file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz -color = green -height = 5 title = bedgraph color = green transform = log log_pseudocount = 2 min_value = 0 -transform = log -log_pseudocount = 2 -min_value = 0 -grid = true - -[test bedgraph with operation] -file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz color = green -height = 5 -title = bedgraph color = green operation = log(2+file) min_value = 0.7 -operation = log(2+file) -min_value = 0.7 +alpha = 1.0 +height = 5.0 +min_value = 0.0 +show_data_range = true grid = true - -[test bedgraph] +nans_to_zeros = false +use_middle = false +file_type = bedgraph +type = fill +transform = log +y_axis_values = transformed +log_pseudocount = 2.0 +overlay_previous = no +[bedgraph_4] file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz -color = black -height = 5 +title = bedgraph color = green operation = log(2+file) min_value = 0.7 +color = green +alpha = 1.0 +height = 5.0 +min_value = 0.7 +show_data_range = true +grid = true +nans_to_zeros = false +use_middle = false +file_type = bedgraph +type = fill +operation = log(2+file) +overlay_previous = no +[bedgraph_5] +file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz title = bedgraph color = black transform = log2 log_pseudocount = 1 min_value = 0 -transform = log2 -log_pseudocount = 1 -min_value = 0 -grid = true - -[test bedgraph] -file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz color = black -height = 5 +alpha = 1.0 +height = 5.0 +min_value = 0.0 +show_data_range = true +grid = true +nans_to_zeros = false +use_middle = false +file_type = bedgraph +type = fill +transform = log2 +y_axis_values = transformed +log_pseudocount = 1.0 +overlay_previous = no +[bedgraph_6] +file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz title = bedgraph color = black operation = log2(1+file) min_value = 0 -operation = log2(1+file) -min_value = 0 -grid = true - -[test bedgraph] -file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz color = black -height = 5 +alpha = 1.0 +height = 5.0 +min_value = 0.0 +show_data_range = true +grid = true +nans_to_zeros = false +use_middle = false +file_type = bedgraph +type = fill +operation = log2(1+file) +overlay_previous = no +[bedgraph_7] +file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz title = bedgraph color = black transform = log2 log_pseudocount = 1 min_value = 0 y_axis_values = original +color = black +alpha = 1.0 +height = 5.0 +min_value = 0.0 +show_data_range = true +grid = true +nans_to_zeros = false +use_middle = false +file_type = bedgraph +type = fill transform = log2 -log_pseudocount = 1 -min_value = 0 y_axis_values = original -grid = true - -[x-axis] \ No newline at end of file +log_pseudocount = 1.0 +overlay_previous = no +[x-axis] +where = bottom \ No newline at end of file |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test2.ini --- a/test-data/test2.ini Sun Feb 13 22:43:45 2022 +0000 +++ b/test-data/test2.ini Sat Oct 01 08:43:22 2022 +0000 |
| [ |
| @@ -1,6 +1,6 @@ [x-axis] where = top -[bigwig_0] +[bigwig_1] file = test-data/bigwig_chrx_2e6_5e6.bw title = rep 1 test line color = red @@ -10,9 +10,10 @@ nans_to_zeros = false type = line:1.0 show_data_range = false +grid = false file_type = bigwig overlay_previous = no -[bigwig_0] +[bigwig_1] file = test-data/bigwig_chrx_2e6_5e6.bw title = rep 1 test line color = red @@ -22,9 +23,10 @@ nans_to_zeros = false type = line:1.0 show_data_range = false +grid = false file_type = bigwig overlay_previous = no -[bigwig_1] +[bigwig_2] file = test-data/bigwig_chrx_2e6_5e6.bw title = nans_to_zeros color = blue @@ -34,9 +36,10 @@ nans_to_zeros = true type = line:1.0 show_data_range = true +grid = false file_type = bigwig overlay_previous = no -[hlines_2] +[hlines_3] height = 1.5 y_values = 50 show_data_range = false @@ -46,7 +49,7 @@ line_style = dashed overlay_previous = share-y file_type = hlines -[hlines_3] +[hlines_4] title = hlines height = 1.5 min_value = 12.0 |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test22.ini --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test22.ini Sat Oct 01 08:43:22 2022 +0000 |
| [ |
| @@ -0,0 +1,21 @@ + +[scale bar] +file_type = scalebar +title = scalebar height = 5 +where = right +height = 5 + +[spacer] + +[fasta_1] +file_type = fasta +title = fasta from cached +file = chrM.fa + +[spacer] + +[fasta_2] +file_type = fasta +title = fasta from history height = 5 +file = chrM.fa +height = 5 |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test23.ini --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test23.ini Sat Oct 01 08:43:22 2022 +0000 |
| [ |
| @@ -0,0 +1,61 @@ +[x-axis] +where = top + +[spacer] +height = 0.05 + +[hic matrix] +file = Li_et_al_2015.h5 +title = classical depth=300000 with arcs +depth = 300000 +transform = log1p +file_type = hic_matrix + +[test arcs overlay] +file = test_wide.arcs +color = red +line_width = 5 +links_type = loops +overlay_previous = share-y + +[hic matrix square] +file = Li_et_al_2015.h5 +title = square with arcs +transform = log1p +file_type = hic_matrix_square + +[test arcs overlay] +file = test_wide.arcs +color = red +line_width = 5 +links_type = squares +overlay_previous = share-y + +[hic matrix square] +file = Li_et_al_2015.h5 +title = square with arcs region2=chrX:3000000-3100000 +transform = log1p +file_type = hic_matrix_square +region2 = chrX:3000000-3100000 + +[test arcs overlay] +file = test_wide.arcs +color = red +line_width = 5 +links_type = squares +overlay_previous = share-y + +[hic matrix square] +file = Li_et_al_2015.h5 +title = square with domains, colormap = Blues, tranform = no, region2=chrX:3000000-3100000 +file_type = hic_matrix_square +region2 = chrX:3000000-3100000 +colormap = Blues +transform = no + +[test domains] +file = tad_classification.bed +color = none +border_color = black +display = squares +overlay_previous = share-y |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test24.ini --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test24.ini Sat Oct 01 08:43:22 2022 +0000 |
| [ |
| @@ -0,0 +1,44 @@ +[maf] +file = first.maf +reference = mm10 +file_index = /tmp/first.maf.index +title = default + +[spacer] +height = 1 + +[maf] +file = first.maf +reference = mm10 +file_index = /tmp/first.maf.index +title = height = 3 show sequence +display_ref_seq = true +height = 3 + +[spacer] +height = 1 + +[maf] +file = first.maf +reference = mm10 +file_index = /tmp/first.maf.index +title = species_order = hg19 rn5, species_labels = Human Rat +species_order = hg19 rn5 +species_labels = Human Rat +height = 3 + +[spacer] +height = 1 + +[maf] +file = first.maf +reference = mm10 +file_index = /tmp/first.maf.index +title = species_order = hg19, species_labels = Human, species_order_only = true +species_order = hg19 +species_labels = Human +species_order_only = true +height = 3 + +[x-axis] +where = bottom |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test25.ini --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test25.ini Sat Oct 01 08:43:22 2022 +0000 |
| [ |
| @@ -0,0 +1,21 @@ +[bedgraph_0] +file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz +title = bedgraph color = blue +color = blue +alpha = 1.0 +height = 5.0 +show_data_range = true +grid = false +nans_to_zeros = false +use_middle = false +file_type = bedgraph +type = fill +overlay_previous = no +max_value = 5 + +[islands as highlight] +file = islands.bed +type = vhighlight + +[x-axis] +where = bottom |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test4.ini --- a/test-data/test4.ini Sun Feb 13 22:43:45 2022 +0000 +++ b/test-data/test4.ini Sat Oct 01 08:43:22 2022 +0000 |
| [ |
| @@ -9,6 +9,7 @@ number_of_bins = 2000 type = fill show_data_range = false +grid = false file_type = bigwig overlay_previous = no [bigwig_1] @@ -21,6 +22,7 @@ number_of_bins = 300 type = fill show_data_range = false +grid = false file_type = bigwig overlay_previous = share-y [x-axis] |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test5.ini --- a/test-data/test5.ini Sun Feb 13 22:43:45 2022 +0000 +++ b/test-data/test5.ini Sat Oct 01 08:43:22 2022 +0000 |
| [ |
| @@ -1,6 +1,6 @@ [x-axis] where = top -[genes_0_0] +[genes_1_0] file = dm3_subset_BDGP5.78.gtf.gz prefered_name = transcript_name merge_transcripts = false @@ -12,15 +12,16 @@ display = stacked height = 10.0 labels = true -file_type = bed +all_labels_inside = false +labels_in_margin = false +file_type = gtf global_max_row = false max_labels = 60 line_width = 0.5 -arrowhead_included = false overlay_previous = no [spacer] height = 1.0 -[genes_1_0] +[genes_2_0] file = dm3_subset_BDGP5.78_asbed4.bed.gz title = test color = #000000 @@ -30,11 +31,12 @@ display = stacked height = 10.0 labels = true +all_labels_inside = false +labels_in_margin = false file_type = bed global_max_row = false max_labels = 60 line_width = 0.5 -arrowhead_included = false overlay_previous = no [spacer] height = 1.0 \ No newline at end of file |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test6.ini --- a/test-data/test6.ini Sun Feb 13 22:43:45 2022 +0000 +++ b/test-data/test6.ini Sat Oct 01 08:43:22 2022 +0000 |
| [ |
| @@ -5,6 +5,7 @@ type = box use_summit = true height = 4.0 +line_width = 1.0 show_labels = true file_type = narrow_peak overlay_previous = no @@ -15,8 +16,8 @@ type = box use_summit = true height = 4.0 +line_width = 2.0 show_labels = true -line_width = 2 file_type = narrow_peak overlay_previous = no [narrow_peak_2_0] @@ -29,6 +30,7 @@ width_adjust = 3.0 max_value = 50.0 height = 4.0 +line_width = 1.0 show_labels = false file_type = narrow_peak overlay_previous = no @@ -43,6 +45,7 @@ show_data_range = false width_adjust = 1.5 height = 4.0 +line_width = 1.0 show_labels = true file_type = narrow_peak overlay_previous = no |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test7.ini --- a/test-data/test7.ini Sun Feb 13 22:43:45 2022 +0000 +++ b/test-data/test7.ini Sat Oct 01 08:43:22 2022 +0000 |
| [ |
| @@ -1,42 +1,79 @@ [x-axis] where = top -[genes_0_0] -file = test-data/dm3_genes.bed.gz -title = genes +[genes_1_0] +file = test-data/dm3_subset_BDGP5.78.gtf.gz +prefered_name = transcript_name +title = gtf default color = #000000 border_color = #000000 style = flybase height_utr = 1.0 color_utr = grey +arrowhead_included = false +arrowhead_fraction = 0.004 +color_backbone = #000000 display = stacked height = 10.0 labels = true -file_type = bed +all_labels_inside = false +labels_in_margin = false +fontstyle = normal +file_type = gtf global_max_row = false max_labels = 60 line_width = 0.5 -arrowhead_included = false overlay_previous = no -[genes_1_0] +[genes_2_0] file = test-data/dm3_subset_BDGP5.78.gtf.gz prefered_name = gene_name merge_transcripts = true -title = gtf +merge_overlapping_exons = false +title = gtf merge transcripts, use gene_name, red 0.75 UTR color = #000000 border_color = #000000 style = flybase height_utr = 0.75 color_utr = #ff0000 +arrowhead_included = false +arrowhead_fraction = 0.004 +color_backbone = #000000 display = stacked height = 10.0 labels = true -file_type = bed +all_labels_inside = false +labels_in_margin = false +fontstyle = normal +file_type = gtf global_max_row = false max_labels = 60 line_width = 0.5 -arrowhead_included = false overlay_previous = no -[genes_2_0] +[genes_3_0] +file = test-data/dm3_subset_BDGP5.78.gtf.gz +prefered_name = gene_name +merge_transcripts = true +merge_overlapping_exons = true +title = same but merge overlapping exons +color = #000000 +border_color = #000000 +style = flybase +height_utr = 0.75 +color_utr = #ff0000 +arrowhead_included = false +arrowhead_fraction = 0.004 +color_backbone = #000000 +display = stacked +height = 10.0 +labels = true +all_labels_inside = false +labels_in_margin = false +fontstyle = normal +file_type = gtf +global_max_row = false +max_labels = 60 +line_width = 0.5 +overlay_previous = no +[genes_4_0] file = test-data/dm3_genes_withrgbandscore.bed.gz title = genes with scores color = cool_r @@ -44,33 +81,43 @@ style = flybase height_utr = 1.0 color_utr = grey +arrowhead_included = false +arrowhead_fraction = 0.004 +color_backbone = #000000 display = stacked height = 10.0 labels = true +all_labels_inside = false +labels_in_margin = false +fontstyle = normal file_type = bed global_max_row = false max_labels = 60 line_width = 0.5 -arrowhead_included = false overlay_previous = no -[genes_3_0] +[genes_5_0] file = test-data/dm3_genes_withrgbandscore.bed.gz title = genes with utr as bed_rgb -color = black +color = #000000 border_color = #000000 style = flybase height_utr = 1.0 color_utr = bed_rgb +arrowhead_included = false +arrowhead_fraction = 0.004 +color_backbone = #000000 display = stacked height = 10.0 labels = true +all_labels_inside = false +labels_in_margin = false +fontstyle = normal file_type = bed global_max_row = false max_labels = 60 line_width = 0.5 -arrowhead_included = false overlay_previous = no -[genes_3_0] +[genes_6_0] file = test-data/dm3_genes_withrgbandscore.bed.gz title = genes with coding as bed_rgb - labels_in_margin color = bed_rgb @@ -78,17 +125,21 @@ style = flybase height_utr = 1.0 color_utr = grey +arrowhead_included = false +arrowhead_fraction = 0.004 +color_backbone = #000000 display = stacked height = 10.0 labels = true +all_labels_inside = false labels_in_margin = true +fontstyle = normal file_type = bed global_max_row = false max_labels = 60 line_width = 0.5 -arrowhead_included = false overlay_previous = no -[genes_4_0] +[genes_7_0] file = test-data/dm3_genes_withrgbandscore.bed.gz title = genes bed_rgb like - all_labels_inside color = bed_rgb @@ -96,13 +147,17 @@ style = flybase height_utr = 1.0 color_utr = bed_rgb +arrowhead_included = false +arrowhead_fraction = 0.004 +color_backbone = #000000 display = stacked height = 10.0 labels = true all_labels_inside = true +labels_in_margin = false +fontstyle = normal file_type = bed global_max_row = false max_labels = 60 line_width = 0.5 -arrowhead_included = false overlay_previous = no \ No newline at end of file |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test8.ini --- a/test-data/test8.ini Sun Feb 13 22:43:45 2022 +0000 +++ b/test-data/test8.ini Sat Oct 01 08:43:22 2022 +0000 |
| [ |
| @@ -1,6 +1,6 @@ [x-axis] where = top -[genes_0_0] +[genes_1_0] file = test-data/dm3_genes.bed.gz title = dm3_genes.bed color = #000000 @@ -10,13 +10,14 @@ display = stacked height = 10.0 labels = true +all_labels_inside = false +labels_in_margin = false file_type = bed global_max_row = true max_labels = 15 line_width = 0.5 -arrowhead_included = false overlay_previous = no -[genes_1_0] +[genes_2_0] file = test-data/dm3_genes.bed.gz title = genes.bed.gz color = #000000 @@ -26,9 +27,10 @@ display = stacked height = 10.0 labels = true +all_labels_inside = false +labels_in_margin = false file_type = bed global_max_row = false max_labels = 60 line_width = 2.0 -arrowhead_included = false overlay_previous = no \ No newline at end of file |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test9.ini --- a/test-data/test9.ini Sun Feb 13 22:43:45 2022 +0000 +++ b/test-data/test9.ini Sat Oct 01 08:43:22 2022 +0000 |
| [ |
| @@ -1,29 +1,58 @@ [x-axis] where = top -[genes_0_0] +[genes_1_0] file = dm3_subset_BDGP5.78.gtf.gz prefered_name = transcript_name merge_transcripts = false -title = test +title = defaut arrowhead fontstyle italic color = #000000 border_color = #000000 style = flybase height_utr = 1.0 color_utr = grey +arrowhead_included = false +arrowhead_fraction = 0.004 display = stacked height = 10.0 labels = true -file_type = bed +all_labels_inside = false +labels_in_margin = false +fontstyle = italic +file_type = gtf global_max_row = false max_labels = 60 line_width = 0.5 -arrowhead_included = false overlay_previous = no [spacer] height = 1.0 -[genes_1_0] +[genes_2_0] +file = dm3_subset_BDGP5.78.gtf.gz +prefered_name = transcript_name +merge_transcripts = false +title = arrowhead_fraction 0.1 fontstyle oblique +color = #000000 +border_color = #000000 +style = flybase +height_utr = 1.0 +color_utr = grey +arrowhead_included = false +arrowhead_fraction = 0.1 +display = stacked +height = 10.0 +labels = true +all_labels_inside = false +labels_in_margin = false +fontstyle = oblique +file_type = gtf +global_max_row = false +max_labels = 60 +line_width = 0.5 +overlay_previous = no +[spacer] +height = 1.0 +[genes_3_0] file = dm3_subset_BDGP5.78_asbed4.bed.gz -title = test +title = genes without orientation color = red border_color = #000000 style = UCSC @@ -31,35 +60,42 @@ display = stacked height = 10.0 labels = true +all_labels_inside = false +labels_in_margin = false +fontstyle = normal file_type = bed global_max_row = false max_labels = 60 line_width = 0.5 -arrowhead_included = false overlay_previous = no [spacer] height = 1.0 -[genes_2_0] +[genes_4_0] file = dm3_subset_BDGP5.78.gtf.gz prefered_name = transcript_name merge_transcripts = false -title = test +title = arrowhead included color = red border_color = #000000 style = flybase height_utr = 1.0 color_utr = grey +arrowhead_included = true +arrowhead_fraction = 0.004 display = stacked height = 10.0 labels = true -file_type = bed +all_labels_inside = false +labels_in_margin = false +fontstyle = normal +file_type = gtf global_max_row = false max_labels = 60 line_width = 0.5 -arrowhead_included = true overlay_previous = no [spacer] height = 1.0 -[vlines_3] +[vlines_5] file = dm3_subset_BDGP5.78_asbed4.bed.gz +line_width = 0.5 type = vlines \ No newline at end of file |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_TADs_bdgm.png |
| b |
| Binary file test-data/test_TADs_bdgm.png has changed |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_alpha.png |
| b |
| Binary file test-data/test_alpha.png has changed |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_arcs_use_middle.png |
| b |
| Binary file test-data/test_arcs_use_middle.png has changed |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_arrowhead_zoom.png |
| b |
| Binary file test-data/test_arrowhead_zoom.png has changed |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_gtf_bed4.png |
| b |
| Binary file test-data/test_gtf_bed4.png has changed |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_gtf_flybase_param.png |
| b |
| Binary file test-data/test_gtf_flybase_param.png has changed |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_link.png |
| b |
| Binary file test-data/test_link.png has changed |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_log.png |
| b |
| Binary file test-data/test_log.png has changed |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_log_grid.png |
| b |
| Binary file test-data/test_log_grid.png has changed |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_maf.png |
| b |
| Binary file test-data/test_maf.png has changed |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_matrix_square.png |
| b |
| Binary file test-data/test_matrix_square.png has changed |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_narrowPeak.png |
| b |
| Binary file test-data/test_narrowPeak.png has changed |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_operation.png |
| b |
| Binary file test-data/test_operation.png has changed |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_tssarrow.png |
| b |
| Binary file test-data/test_tssarrow.png has changed |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_ucsc_param.png |
| b |
| Binary file test-data/test_ucsc_param.png has changed |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_vhighlight.png |
| b |
| Binary file test-data/test_vhighlight.png has changed |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 test-data/testpyGT.sh --- a/test-data/testpyGT.sh Sun Feb 13 22:43:45 2022 +0000 +++ b/test-data/testpyGT.sh Sat Oct 01 08:43:22 2022 +0000 |
| b |
| @@ -20,5 +20,9 @@ pgt --tracks test-data/test19.ini --region chr2:73,800,000-75,744,000 --fontSize 12 -o test-data/test_log_grid.png pgt --tracks test-data/test20.ini --region chrX:3000000-3300000 --fontSize 12 -o test-data/test_arcs_use_middle.png pgt --tracks test-data/test21.ini --region X:3000000-3600000 --fontSize 12 --trackLabelFraction 0.3 --plotWidth 12 --dpi 20 -o test-data/master_scale_bar_startend.png +pgt --tracks test-data/test22.ini --region chrM:10-30 --fontSize 12 -o test-data/master_fasta.png +pgt --tracks test-data/test23.ini --region chrX:3000000-3300000 --fontSize 12 -o test-data/test_matrix_square.png +pgt --tracks test-data/test24.ini --region 2:34704975-34705208 --fontSize 12 -o test-data/test_maf.png +pgt --tracks test-data/test25.ini --region chr2:73,800,000-75,744,000 --fontSize 12 -o test-data/test_vhighlight.png conda_env_deactivate |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 tool-data/fasta_indexes.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/fasta_indexes.loc.sample Sat Oct 01 08:43:22 2022 +0000 |
| b |
| @@ -0,0 +1,29 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Samtools indexed sequences data files. You will need +#to create these data files and then create a fasta_indexes.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The fasta_indexes.loc +#file has this format (white space characters are TAB characters): +# +# <unique_build_id> <dbkey> <display_name> <file_base_path> +# +#So, for example, if you had hg19 Canonical indexed stored in +# +# /depot/data2/galaxy/hg19/sam/, +# +#then the fasta_indexes.loc entry would look like this: +# +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /depot/data2/galaxy/hg19/sam/hg19canon.fa +# +#and your /depot/data2/galaxy/hg19/sam/ directory +#would contain hg19canon.fa and hg19canon.fa.fai files. +# +#Your fasta_indexes.loc file should include an entry per line for +#each index set you have stored. The file in the path does actually +#exist, but it should never be directly used. Instead, the name serves +#as a prefix for the index file. For example: +# +#hg18canon hg18 Human (Homo sapiens): hg18 Canonical /depot/data2/galaxy/hg18/sam/hg18canon.fa +#hg18full hg18 Human (Homo sapiens): hg18 Full /depot/data2/galaxy/hg18/sam/hg18full.fa +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /depot/data2/galaxy/hg19/sam/hg19canon.fa +#hg19full hg19 Human (Homo sapiens): hg19 Full /depot/data2/galaxy/hg19/sam/hg19full.fa |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 tool_data_table_conf.xml.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Sat Oct 01 08:43:22 2022 +0000 |
| b |
| @@ -0,0 +1,7 @@ +<tables> + <!-- Location of SAMTools indexes for FASTA files --> + <table name="fasta_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/fasta_indexes.loc" /> + </table> +</tables> |
| b |
| diff -r a1abfa420d9d -r 7dd841a32245 tool_data_table_conf.xml.test --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.test Sat Oct 01 08:43:22 2022 +0000 |
| b |
| @@ -0,0 +1,6 @@ +<tables> + <table name="fasta_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="${__HERE__}/test-data/fasta_indexes.loc" /> + </table> +</tables> |