| Next changeset 1:f3a318881b1b (2017-11-12) |
|
Commit message:
Uploaded |
|
added:
compalignp.xml test-data/eukaryotic-trnas_2.1.clustal test-data/eukaryotic-trnas_2.1.out tool_dependencies.xml |
| b |
| diff -r 000000000000 -r 7e55ac3bd458 compalignp.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/compalignp.xml Tue Jun 09 05:36:03 2015 -0400 |
| [ |
| @@ -0,0 +1,48 @@ +<tool id="compalignp" name="Compalignp" version="1.0"> + <description>Fractional identities between alignments</description> + <requirements> + <requirement type="package" version="1.0">compalignp</requirement> + </requirements> + <stdio> + <exit_code range="1:" level="fatal" description="Error occurred. Please check Tool Standard Error" /> + <exit_code range=":-1" level="fatal" description="Error occurred. Please check Tool Standard Error" /> + </stdio> + <command> +<![CDATA[ + compalignp + -t $rna_alignment_target + -r $rna_alignment_reference + > $output +]]> + </command> + <inputs> + <param format="clustalw,stockholm" name="rna_alignment_target" type="data" label="Target RNA Alignment" help="(-t)" /> + <param format="clustalw,stockholm" name="rna_alignment_reference" type="data" label="Reference RNA Alignment" help="(-r)" /> + </inputs> + <outputs> + <data name="output" format="txt" /> + </outputs> + <tests> + <test> + <param name="rna_alignment_target" value="eukaryotic-trnas_2.1.clustal"/> + <param name="rna_alignment_reference" value="eukaryotic-trnas_2.1.clustal"/> + <output name="output" file="eukaryotic-trnas_2.1.out"/> + </test> + </tests> + <help> +<![CDATA[ +**compalignp** + +> Paranoia version of squids compalign. + +Compute fractional "identity" between trusted alignment and test alignment +Identity of the multiple sequence alignments is defined as +the averaged identity over all N(N-1)/2 pairwise alignments. + + +]]> + </help> +<citations> + <citation type="doi">10.1186/1748-7188-1-19</citation> +</citations> +</tool> |
| b |
| diff -r 000000000000 -r 7e55ac3bd458 test-data/eukaryotic-trnas_2.1.clustal --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/eukaryotic-trnas_2.1.clustal Tue Jun 09 05:36:03 2015 -0400 |
| b |
| @@ -0,0 +1,7 @@ +CLUSTAL 2.1 multiple sequence alignment + + +Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA + ************************************** ************** ******* ********* + |
| b |
| diff -r 000000000000 -r 7e55ac3bd458 test-data/eukaryotic-trnas_2.1.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/eukaryotic-trnas_2.1.out Tue Jun 09 05:36:03 2015 -0400 |
| b |
| @@ -0,0 +1,1 @@ +1.00 |
| b |
| diff -r 000000000000 -r 7e55ac3bd458 tool_dependencies.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Tue Jun 09 05:36:03 2015 -0400 |
| b |
| @@ -0,0 +1,27 @@ +<?xml version="1.0"?> +<tool_dependency> + <package name="squid" version="1.9g"> + <repository changeset_revision="a82a68a3374e" name="package_squid_1_9g" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" /> + </package> + <package name="compalignp" version="1.0"> + <install version="1.0"> + <actions> + <action type="download_by_url">http://www.biophys.uni-duesseldorf.de/bralibase/compalignp.tgz</action> + <action type="set_environment_for_install"> + <repository changeset_revision="a82a68a3374e" name="package_squid_1_9g" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu"> + <package name="squid" version="1.9g" /> + </repository> + </action> + <action type="shell_command">make</action> + <action type="move_file"> + <source>compalignp</source> + <destination>$INSTALL_DIR/bin</destination> + </action> + <action type="set_environment"> + <environment_variable action="prepend_to" name="PATH">$INSTALL_DIR/bin</environment_variable> + <environment_variable action="set_to" name="COMPALIGNP_ROOT_PATH">$INSTALL_DIR/bin</environment_variable> + </action> + </actions> + </install> + </package> +</tool_dependency> |