| Previous changeset 1:402b67d1af7d (2019-01-23) Next changeset 3:f8e51626fc56 (2020-02-26) |
|
Commit message:
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mash commit 24f4271bd62a3d96fec812eae2ad607f6a7f723c" |
|
modified:
macros.xml mash_screen.xml |
|
added:
test-data/ERR024951_seqtk_sample_1000_1.sketch.msh test-data/test_assembly.fasta test-data/test_assembly.sketch.msh |
| b |
| diff -r 402b67d1af7d -r 7f7d8b0c8517 macros.xml --- a/macros.xml Wed Jan 23 15:59:25 2019 -0500 +++ b/macros.xml Sun Feb 16 17:03:45 2020 -0500 |
| b |
| @@ -3,4 +3,21 @@ <token name="@INTYPES@"> fasta,fasta.gz,fastq,fastq.gz,fastqsanger,fastqsanger.gz </token> + + <xml name="citations"> + <citations> + <citation type="doi">10.1186/s13059-016-0997-x</citation> + </citations> + </xml> + + <xml name="requirements"> + <requirements> + <requirement type="package" version="@TOOL_VERSION@">mash</requirement> + </requirements> + </xml> + + <xml name="version_command"> + <version_command>mash --version</version_command> + </xml> + </macros> |
| b |
| diff -r 402b67d1af7d -r 7f7d8b0c8517 mash_screen.xml --- a/mash_screen.xml Wed Jan 23 15:59:25 2019 -0500 +++ b/mash_screen.xml Sun Feb 16 17:03:45 2020 -0500 |
| [ |
| @@ -1,12 +1,10 @@ -<tool id="mash_screen" name="mash screen" version="@TOOL_VERSION@+galaxy1" profile="19.01"> - <description>determines how well query sequences are contained within a pool of sequences.</description> +<tool id="mash_screen" name="mash screen" version="@TOOL_VERSION@+galaxy2" profile="19.01"> + <description>determines how well query sequences are contained within a pool of sequences</description> <macros> <import>macros.xml</import> </macros> - <requirements> - <requirement type="package" version="@TOOL_VERSION@">mash</requirement> - </requirements> - <version_command>mash --version</version_command> + <expand macro="requirements" /> + <expand macro="version_command" /> <command detect_errors="exit_code"><![CDATA[ ln -s '$queries' queries.msh && mash screen @@ -44,9 +42,10 @@ </when> </conditional> <param name="queries" type="data" format="msh" /> - <param type="boolean" name="winner_takes_all" argument="-w" truevalue="-w" falsevalue=""/> - <param type="float" name="minimum_identity_to_report" argument="-i" value="0." min="-1." max="1." /> - <param type="float" name="maximum_p_value_to_report" argument="-v" value="1." min="0." max="1."/> + <param name="winner_takes_all" argument="-w" type="boolean" checked="true" truevalue="-w" falsevalue="" label="'Winner takes all' to remove redundancy in the result" + help="If this option is not enabled, every matching strain from the same species of the reference database is reported in the result."/> + <param type="float" name="minimum_identity_to_report" argument="-i" value="0." min="-1." max="1." label="Minimum identity to report" /> + <param type="float" name="maximum_p_value_to_report" argument="-v" value="1." min="0." max="1." label="Maximum p-value to report" /> </inputs> <outputs> <data name="output" format="tabular" /> @@ -73,7 +72,8 @@ </test> </tests> <help><![CDATA[ -Description: + +**What it does** Determine how well query sequences are contained within a pool of sequences. The queries must be formatted as a single Mash sketch file (.msh), created @@ -85,18 +85,5 @@ query-comment], where median-multiplicity is computed for shared hashes, based on the number of observations of those hashes within the pool. ]]></help> - <citations> - <citation type="bibtex"> -@article{ondov2016mash, - title={Mash: fast genome and metagenome distance estimation using MinHash}, - author={Ondov, Brian D and Treangen, Todd J and Melsted, P{\'a}ll and Mallonee, Adam B and Bergman, Nicholas H and Koren, Sergey and Phillippy, Adam M}, - journal={Genome biology}, - volume={17}, - number={1}, - pages={132}, - year={2016}, - publisher={BioMed Central} - } - </citation> - </citations> + <expand macro="citations"/> </tool> |
| b |
| diff -r 402b67d1af7d -r 7f7d8b0c8517 test-data/ERR024951_seqtk_sample_1000_1.sketch.msh |
| b |
| Binary file test-data/ERR024951_seqtk_sample_1000_1.sketch.msh has changed |
| b |
| diff -r 402b67d1af7d -r 7f7d8b0c8517 test-data/test_assembly.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_assembly.fasta Sun Feb 16 17:03:45 2020 -0500 |
| b |
| @@ -0,0 +1,3 @@ +>test +GCATGTCGATCTGTGTGCTAGTCGTAGTCGATCGATCTGATCGATCTGTCAGTCAGTAGT +CTCAGCGATGCATTATTATATTATATTATCGATCGATGCTGATCGATTATATTCGATCTG |
| b |
| diff -r 402b67d1af7d -r 7f7d8b0c8517 test-data/test_assembly.sketch.msh |
| b |
| Binary file test-data/test_assembly.sketch.msh has changed |