Galaxy |

Changeset 7:841084c5fc46 (2021-10-20)

Previous changeset 6:0e93176640ac (2021-09-13) Next changeset 8:553bfe8bd0b5 (2021-11-15)

Commit message:
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/abyss commit e14b8554ee2a7d00b98c7cb863a07245d29ab93f"

modified:
abyss-pe.xml
test-data/abyss-contigs1.fa
test-data/abyss-long-scaffolds3.fa
test-data/abyss-scaffolds1.fa
test-data/abyss-stats1.tab
test-data/abyss-stats2.tab
test-data/abyss-stats3.tab
test-data/abyss-unitigs1.fa
test-data/abyss-unitigs2.fa
test-data/abyss-unitigs3.fa

removed:
test-data/coverage1.hist
test-data/coverage2.hist
test-data/coverage3.hist

diff -r 0e93176640ac -r 841084c5fc46 abyss-pe.xml
--- a/abyss-pe.xml Mon Sep 13 16:58:30 2021 +0000
+++ b/abyss-pe.xml Wed Oct 20 12:50:40 2021 +0000

[

@@ -4,7 +4,7 @@
         <xref type="bio.tools">abyss</xref>
     </xrefs>
     <macros>
-        <token name="@TOOL_VERSION@">2.3.1</token>
+        <token name="@TOOL_VERSION@">2.3.2</token>
         <xml name="reads_conditional">
             <conditional name="reads">
                 <param name="reads_selector" type="select" label="Type of paired-end datasets">
@@ -37,10 +37,11 @@
         <regex match="Exception:" />
     </stdio>
     <version_command>ABYSS --version | head -n 1</version_command>
-    <command>
+    <command><![CDATA[
abyss-pe
name=abyss
j=\${GALAXY_SLOTS:-1}
+B=\${GALAXY_MEMORY_MB:-2048}M
k=$k

#if str($K)
@@ -91,11 +92,11 @@
#if str($d)
     d=$d
#end if
-#if str($S)
-    S=$S
+#if $S
+    S='$S'
#end if
-#if str($N)
-    N=$N
+#if $N
+    N='$N'
#end if
#if $lib_repeat
     lib='
@@ -146,7 +147,7 @@
         long${i}='$v'
     #end for
#end if
-    </command>
+    ]]></command>

     <inputs>
         <repeat name="lib_repeat" title="Paired-end library" help="(lib)">
@@ -167,15 +168,19 @@
         <param argument="c" type="float" value="" optional="true" label="Minimum mean k-mer coverage of a unitig" help="Defaults to sqrt(median)" />
         <param argument="b" type="integer" value="" optional="true" label="Maximum length of a bubble (in bp)" help="abyss-pe has two bubble popping stages. The default limits are 3*k bp for ABYSS and 10000 bp for PopBubbles" />
         <param argument="SS" type="boolean" label="Assemble in strand-specific mode" help="Requires that all libraries are strand-specific RNA-Seq libraries. Assumes that the first read in a read pair is reveresed with respect to the transcripts sequenced" />
-        <param argument="m" type="integer" value="50" min="0" optional="true" label="Minimum overlap of two unitigs (in bp)" />
+        <param argument="m" type="integer" value="" min="0" optional="true" label="Minimum overlap of two unitigs (in bp)" help="Defaults to 0 (interpreted as k - 1) if mate-pair libraries are provided or if k<=50, otherwise 50" />
         <param argument="p" type="float" value="0.9" optional="true" label="Minimum sequence identity of a bubble" />
         <param argument="a" type="integer" value="2" min="0" optional="true" label="Maximum number of branches of a bubble" />
         <param argument="l" type="integer" value="" min="1"  optional="true" label="Minimum alignment length of a read (in bp)" help="Defaults to the value of k" />
         <param argument="s" type="integer" value="200" min="0" optional="true" label="Minimum unitig length required for building contigs (in bp)" help="The seed length should be at least twice the value of k. If more sequence is assembled than the expected genome size, try increasing this value" />
         <param argument="n" type="integer" value="10" min="0" optional="true" label="Minimum number of pairs required for building contigs" />
         <param argument="d" type="integer" value="6" min="0" optional="true" label="Allowable error of a distance estimate (in bp)" />
-        <param argument="S" type="integer" value="" min="0" optional="true" label="Minimum contig length required for building scaffolds (in bp)" help="Defaults to the value of s" />
-        <param argument="N" type="integer" value="" min="0" optional="true" label="Minimum number of pairs required for building scaffolds" help="Defaults to the value of n" />
+        <param argument="S" type="text" value="" label="Minimum contig size required for building scaffolds (in bp)" help="It can be an interval. Defaults to 100-5000">
+            <validator type="regex" message="Must be a an integer or an interval">^([0-9]+(-[0-9]+)?)?$</validator>
+        </param>
+        <param argument="N" type="text" value="" label="Minimum number of pairs required for building scaffolds" help="It can be an interval. Defaults to 15-20">
+            <validator type="regex" message="Must be a an integer or an interval">^([0-9]+(-[0-9]+)?)?$</validator>
+        </param>
     </inputs>

     <outputs>
@@ -189,9 +194,7 @@
         <data name="long_scaffolds" format="fasta" label="${tool.name} on ${on_string}: scaffolds" from_work_dir="abyss-long-scaffs.fa">
             <filter>long_seqs</filter>
         </data>
-        <data name="bubbles" format="fasta" label="${tool.name} on ${on_string}: bubbles" from_work_dir="abyss-bubbles.fa" />
         <data name="indels" format="fasta" label="${tool.name} on ${on_string}: indels" from_work_dir="abyss-indel.fa" />
-        <data name="coverage_histogram_outfile" format="tabular" label="${tool.name} on ${on_string}: coverage histogram" from_work_dir="coverage.hist" />
         <data name="stats" format="tabular" label="${tool.name} on ${on_string}: stats" from_work_dir="abyss-stats.tab" />
     </outputs>

@@ -208,18 +211,14 @@
             <output name="unitigs" file="abyss-unitigs1.fa" />
             <output name="contigs_outfile" file="abyss-contigs1.fa" />
             <output name="scaffolds" file="abyss-scaffolds1.fa" />
-            <output name="bubbles" file="empty_file.fasta" />
             <output name="indels" file="empty_file.fasta" />
-            <output name="coverage_histogram_outfile" file="coverage1.hist" />
             <output name="stats" file="abyss-stats1.tab" />
         </test>
         <test>
             <param name="se_reads" ftype="fastqsanger" value="assembly_sample-R1.fastq.gz,assembly_sample-R2.fastq.gz" />
             <param name="k" value="50" />
             <output name="unitigs" file="abyss-unitigs2.fa" />
-            <output name="bubbles" file="empty_file.fasta" />
             <output name="indels" file="empty_file.fasta" />
-            <output name="coverage_histogram_outfile" file="coverage2.hist" />
             <output name="stats" file="abyss-stats2.tab" />
         </test>
         <test>
@@ -228,13 +227,11 @@
             <param name="k" value="50" />
             <output name="unitigs" file="abyss-unitigs3.fa" />
             <output name="long_scaffolds" file="abyss-long-scaffolds3.fa" />
-            <output name="bubbles" file="empty_file.fasta" />
             <output name="indels" file="empty_file.fasta" />
-            <output name="coverage_histogram_outfile" file="coverage3.hist" />
             <output name="stats" file="abyss-stats3.tab" />
         </test>
     </tests>
-    <help>
+    <help><![CDATA[
**What it does**

`ABySS`_ is a de novo sequence assembler intended for short paired-end reads and large genomes.
@@ -255,7 +252,7 @@

**License and citation**

-This Galaxy tool is Copyright © 2015-2016 `Earlham Institute`_ and is released under the `MIT license`_.
+This Galaxy tool is Copyright © 2015-2021 `Earlham Institute`_ and is released under the `MIT license`_.

.. _Earlham Institute: http://www.earlham.ac.uk/
.. _MIT license: https://opensource.org/licenses/MIT
@@ -263,8 +260,9 @@
You can use this tool only if you agree to the license terms of: `ABySS`_.

.. _ABySS: https://github.com/bcgsc/abyss
-    </help>
+    ]]></help>
     <citations>
+        <citation type="doi">doi:10.1101/gr.214346.116</citation>
         <citation type="doi">10.1101/gr.089532.108</citation>
     </citations>
</tool>

diff -r 0e93176640ac -r 841084c5fc46 test-data/abyss-contigs1.fa
--- a/test-data/abyss-contigs1.fa Mon Sep 13 16:58:30 2021 +0000
+++ b/test-data/abyss-contigs1.fa Wed Oct 20 12:50:40 2021 +0000

@@ -1,2 +1,4 @@
->0 556 6128
-GAGTCGTCGGTATATCTGAATGGAGATACGACAATCAGCGGAGAATTCCCTCTGGGGTTTGCCGGGGTTATTCGGGTACAGGATAAAGCTTTGCTGGAAATTGGCAGTGGCGCTACGCTAACAATGCAGGATATTGACAGTTTTGAACATCATGGGACAAGAACCCTGGATTTGCCCCTATATTTCCAGACATCTGTTATCACTTAACCCATTACAAGCCCGCTGCCGCAGATATTCCCGTGGCGAGCGATAACCCAGCGCACTATGCGGATGCCATTCGTTATAATGCTCGAACGCCTCTGCAAGGTTCTTTGCTGCCGTTAACCCGTCTGGTTTGGGCATGATACTGATGTAGTCACGCTTTATCGTTTTCACGAAGCTCTCTGCTATTCCGTTACTCTCCGGACTCCGCACCGCCGTGTTCTTCGGTTCAAGTCCCAACATCCGGGCGAACTGGCGTGTTTCATTAGCCCGGTAGCATGAACCATTATCCGTCAGCCACTCCACTGGAGACGACGGAAGATCGTTGCCGAAGCGGCGTTCCACCGCTCCCAGC
+>0 115 1132 read:HWI-ST745_0097:7:1101:1007:1000#0/1
+AAAAACGCGCTTGCAGATGGGTCGCAGGTTACTTCCTTGCGCACAGGATATAGTTATACCAGCGTTATTGTCGTTAGTGGTGAGTCGTCGGTATATCTGAATGGAGATACGACAA
+>1 671 7018 read:HWI-ST745_0097:7:1101:1049:1000#0/1
+GTGGTGAGTCGTCGGTATATCTGAATGGAGATACGACAATCAGCGGAGAATTCCCTCTGGGGTTTGCCGGGGTTATTCGGGTACAGGATAAAGCTTTGCTGGAAATTGGCAGTGGCGCTACGCTAACAATGCAGGATATTGACAGTTTTGAACATCATGGGACAAGAACCCTGGATTTGCCCCTATATTTCCAGACATCTGTTATCACTTAACCCATTACAAGCCCGCTGCCGCAGATATTCCCGTGGCGAGCGATAACCCAGCGCACTATGCGGATGCCATTCGTTATAATGCTCGAACGCCTCTGCAAGGTTCTTTGCTGCCGTTAACCCGTCTGGTTTGGGCATGATACTGATGTAGTCACGCTTTATCGTTTTCACGAAGCTCTCTGCTATTCCGTTACTCTCCGGACTCCGCACCGCCGTGTTCTTCGGTTCAAGTCCCAACATCCGGGCGAACTGGCGTGTTTCATTAGCCCGGTAGCATGAACCATTATCCGTCAGCCACTCCACTGGAGACGACGGAAGATCGTTGCCGAAGCGGCGTTCCACCGCTCCCAGCATGACGTCCTGTACTGTTTCACTGTTGAAGCCGCCGGTAGTGACCGCCCAGTGCAGTGCCTCACGATCACAGCAGTCCAGCGCGAACGTGACACGCAGTCTCTCTCCGTT

diff -r 0e93176640ac -r 841084c5fc46 test-data/abyss-long-scaffolds3.fa
--- a/test-data/abyss-long-scaffolds3.fa Mon Sep 13 16:58:30 2021 +0000
+++ b/test-data/abyss-long-scaffolds3.fa Wed Oct 20 12:50:40 2021 +0000

diff -r 0e93176640ac -r 841084c5fc46 test-data/abyss-scaffolds1.fa
--- a/test-data/abyss-scaffolds1.fa Mon Sep 13 16:58:30 2021 +0000
+++ b/test-data/abyss-scaffolds1.fa Wed Oct 20 12:50:40 2021 +0000

diff -r 0e93176640ac -r 841084c5fc46 test-data/abyss-stats1.tab
--- a/test-data/abyss-stats1.tab Mon Sep 13 16:58:30 2021 +0000
+++ b/test-data/abyss-stats1.tab Wed Oct 20 12:50:40 2021 +0000

@@ -1,4 +1,4 @@
n n:500 L50 min N75 N50 N25 E-size max sum name
-1 1 1 556 556 556 556 556 556 556 abyss-unitigs.fa
-1 1 1 556 556 556 556 556 556 556 abyss-contigs.fa
-1 1 1 556 556 556 556 556 556 556 abyss-scaffolds.fa
+2 1 1 671 671 671 671 671 671 671 abyss-unitigs.fa
+2 1 1 671 671 671 671 671 671 671 abyss-contigs.fa
+2 1 1 671 671 671 671 671 671 671 abyss-scaffolds.fa

diff -r 0e93176640ac -r 841084c5fc46 test-data/abyss-stats2.tab
--- a/test-data/abyss-stats2.tab Mon Sep 13 16:58:30 2021 +0000
+++ b/test-data/abyss-stats2.tab Wed Oct 20 12:50:40 2021 +0000

@@ -1,2 +1,2 @@
n n:500 L50 min N75 N50 N25 E-size max sum name
-1 1 1 556 556 556 556 556 556 556 abyss-unitigs.fa
+2 1 1 671 671 671 671 671 671 671 abyss-unitigs.fa

diff -r 0e93176640ac -r 841084c5fc46 test-data/abyss-stats3.tab
--- a/test-data/abyss-stats3.tab Mon Sep 13 16:58:30 2021 +0000
+++ b/test-data/abyss-stats3.tab Wed Oct 20 12:50:40 2021 +0000

@@ -1,3 +1,3 @@
n n:500 L50 min N75 N50 N25 E-size max sum name
-1 1 1 556 556 556 556 556 556 556 abyss-unitigs.fa
-1 1 1 556 556 556 556 556 556 556 abyss-long-scaffs.fa
+2 1 1 671 671 671 671 671 671 671 abyss-unitigs.fa
+2 1 1 671 671 671 671 671 671 671 abyss-long-scaffs.fa

diff -r 0e93176640ac -r 841084c5fc46 test-data/abyss-unitigs1.fa
--- a/test-data/abyss-unitigs1.fa Mon Sep 13 16:58:30 2021 +0000
+++ b/test-data/abyss-unitigs1.fa Wed Oct 20 12:50:40 2021 +0000

diff -r 0e93176640ac -r 841084c5fc46 test-data/abyss-unitigs2.fa
--- a/test-data/abyss-unitigs2.fa Mon Sep 13 16:58:30 2021 +0000
+++ b/test-data/abyss-unitigs2.fa Wed Oct 20 12:50:40 2021 +0000

diff -r 0e93176640ac -r 841084c5fc46 test-data/abyss-unitigs3.fa
--- a/test-data/abyss-unitigs3.fa Mon Sep 13 16:58:30 2021 +0000
+++ b/test-data/abyss-unitigs3.fa Wed Oct 20 12:50:40 2021 +0000

diff -r 0e93176640ac -r 841084c5fc46 test-data/coverage1.hist
--- a/test-data/coverage1.hist Mon Sep 13 16:58:30 2021 +0000
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

@@ -1,27 +0,0 @@
-1 4
-2 8
-3 6
-4 13
-5 20
-6 36
-7 70
-8 56
-9 60
-10 66
-11 56
-12 32
-13 27
-14 44
-15 24
-16 25
-17 39
-18 28
-19 23
-20 11
-21 12
-22 5
-23 5
-24 2
-25 2
-26 2
-27 16

diff -r 0e93176640ac -r 841084c5fc46 test-data/coverage2.hist
--- a/test-data/coverage2.hist Mon Sep 13 16:58:30 2021 +0000
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

@@ -1,27 +0,0 @@
-1 4
-2 8
-3 6
-4 13
-5 20
-6 36
-7 70
-8 56
-9 60
-10 66
-11 56
-12 32
-13 27
-14 44
-15 24
-16 25
-17 39
-18 28
-19 23
-20 11
-21 12
-22 5
-23 5
-24 2
-25 2
-26 2
-27 16

diff -r 0e93176640ac -r 841084c5fc46 test-data/coverage3.hist
--- a/test-data/coverage3.hist Mon Sep 13 16:58:30 2021 +0000
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

@@ -1,27 +0,0 @@
-1 4
-2 8
-3 6
-4 13
-5 20
-6 36
-7 70
-8 56
-9 60
-10 66
-11 56
-12 32
-13 27
-14 44
-15 24
-16 25
-17 39
-18 28
-19 23
-20 11
-21 12
-22 5
-23 5
-24 2
-25 2
-26 2
-27 16