| Previous changeset 1:f87325531be8 (2016-12-21) Next changeset 3:fcf2463f85c1 (2017-05-29) |
|
Commit message:
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit b'bd13ffd1c3e126a6dc59dd3c478347ec1b5824a3\n' |
|
modified:
macros.xml rnafold.xml |
|
added:
rnafold_SHAPE.py test-data/sample_3.fa test-data/sample_3.react test-data/sample_3_result.txt |
| b |
| diff -r f87325531be8 -r 84aad99aca1f macros.xml --- a/macros.xml Wed Dec 21 17:33:12 2016 -0500 +++ b/macros.xml Tue May 16 16:30:38 2017 -0400 |
| b |
| @@ -2,6 +2,7 @@ <xml name="requirements"> <requirements> <requirement type="package" version="2.2.10">viennarna</requirement> + <yield/> </requirements> </xml> <token name="@VERSION@">2.2.10</token> |
| b |
| diff -r f87325531be8 -r 84aad99aca1f rnafold.xml --- a/rnafold.xml Wed Dec 21 17:33:12 2016 -0500 +++ b/rnafold.xml Tue May 16 16:30:38 2017 -0400 |
| [ |
| b'@@ -1,23 +1,31 @@\n-<tool id="viennarna_rnafold" name="@EXECUTABLE@" version="@VERSION@.0">\n+<tool id="viennarna_rnafold" name="@EXECUTABLE@" version="@VERSION@.1">\n <description>Calculate minimum free energy secondary structures and partition function of RNAs</description>\n <macros>\n <token name="@EXECUTABLE@">RNAfold</token>\n <import>macros.xml</import>\n </macros>\n- <expand macro="requirements" />\n+ <expand macro="requirements">\n+\t <requirement type="package" version="1.65">biopython</requirement>\n+ </expand>\n <expand macro="stdio" />\n <expand macro="version_command" />\n <command>\n <![CDATA[\n #if str($input_source.select_fasta) == "false"\n #if str($input_source.input_sequence).lstrip()[0] == ">"\n- echo "${input_source.input_sequence}" > "input.fasta" &&\n+ echo \'${input_source.input_sequence}\' > "input.fasta" &&\n #else\n echo ">Sequence" > "input.fasta" &&\n- echo "${input_source.input_sequence}" >> "input.fasta" &&\n+ echo \'${input_source.input_sequence}\' >> "input.fasta" &&\n #end if\n- #end if \n- RNAfold\n+ #end if\n+\n+ #if str($constraints.shapeOption.shapeSelector) == "isUsed"\n+ python \'$__tool_directory__/rnafold_SHAPE.py\'\n+ #else\n+ RNAfold\n+ #end if\n+\n -T $temperature\n --dangles=$dangling\n #if $layout_type ==0\n@@ -33,7 +41,7 @@\n #if $measelect.pfScale <> 1.07\n --pfScale=$measelect.pfScale\n #end if\n- #end if \n+ #end if\n $advancedOptions.noconversion\n $advancedOptions.gquad\n $advancedOptions.nolp\n@@ -49,7 +57,7 @@\n #end if\n #if $advancedOptions.betaScale <> 1.0\n --betaScale=$advancedOptions.betaScale\n- #end if\t\n+ #end if\n #if $constraints.maxBPspan <> -1\n --maxBPspan=$constraints.maxBPspan\n #end if\n@@ -69,7 +77,7 @@\n --shapeMethod=$s\n #else if str($constraints.shapeOption.shapeMethod.methodSelector) == "Z"\n #set $s="Zb"+str($constraints.shapeOption.shapeMethod.b)\n- --shapeMethod=$s\t\t\t\n+ --shapeMethod=$s\n #if str($constraints.shapeOption.shapeMethod.shapeConversion.conversionSelector) == "C"\n #set $c="C"+str($constraints.shapeOption.shapeMethod.shapeConversion.c)\n --shapeConversion=$c\n@@ -90,8 +98,8 @@\n #end if\n #if $constraints.motif\n --motif=\'$constraints.motif\'\n- #end if\t\n- < \n+ #end if\n+ <\n #if str($input_source.select_fasta) == "false"\n "input.fasta"\n #else\n@@ -120,11 +128,11 @@\n <option value="1">1: unpaired bases participate in one dangling end only</option>\n <option value="2" selected="True">2: unpaired bases participate in all dangling ends</option>\n <option value="3">3: allow coaxial stacking</option>\n- </param> \n+ </param>\n <param name="layout_type" type="select" label="Layout algorithm" argument="--layout_type" >\n <option value="1" selected="true">Default: Naview layout</option>\n <option value="0">Simple radial layout</option>\n- </param> \n+ </param>\n <conditional name="measelect">\n <param name="mea" type="select" label="Calculate Maximum Expected accuracy" argument="--MEA">\n <option value="no">No</option>\n@@ -138,7 +146,7 @@\n <param name="pf" type="boolean" checked="false" truevalue="--partfunc" falsevalue="" label="Calculate Partition Function" help="--partfunc"/>\n <param argument="--pfScale" type="float" value="1.07" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences."/>\n </when>\n- </conditional>\t \n+ </conditional'..b' <param name="id_digits" \n- type="integer" value="4" min="1" max="18" \n- label="The number of digits of the counter in automatically generated sequence IDs" \n- help="When sequences IDs are automatically generated, they receive an increasing number, starting with 1. This number will always be left\xe2\x88\x92padded by leading zeros, such that the number takes up a certain width. Using this parameter, the width can be specified to the users need. We allow numbers in the range [1:18]." \n+ <param name="id_digits"\n+ type="integer" value="4" min="1" max="18"\n+ label="The number of digits of the counter in automatically generated sequence IDs"\n+ help="When sequences IDs are automatically generated, they receive an increasing number, starting with 1. This number will always be left\xe2\x88\x92padded by leading zeros, such that the number takes up a certain width. Using this parameter, the width can be specified to the users need. We allow numbers in the range [1:18]."\n argument="--id-digits"/>\n- <param name="id_start" \n- type="integer" value="1" min="0" \n- label="First number in automatically generated sequence IDs" \n- help="When sequence IDs are automatically generated, they receive an increasing number, usually starting with 1. Using this parameter, the first number can be specified to the users requirements. Note: negative numbers are not allowed. Note: Setting this parameter implies continuous sequence IDs, i.e. it activates the \xe2\x88\x92\xe2\x88\x92continuous\xe2\x88\x92ids flag.." \n+ <param name="id_start"\n+ type="integer" value="1" min="0"\n+ label="First number in automatically generated sequence IDs"\n+ help="When sequence IDs are automatically generated, they receive an increasing number, usually starting with 1. Using this parameter, the first number can be specified to the users requirements. Note: negative numbers are not allowed. Note: Setting this parameter implies continuous sequence IDs, i.e. it activates the \xe2\x88\x92\xe2\x88\x92continuous\xe2\x88\x92ids flag.."\n argument="--id-start"/>\n- </section> \n+ </section>\n </inputs>\n <outputs>\n <data format="dbn" name="tabular_file"/>\n@@ -292,19 +300,26 @@\n <param name="fasta_input" value="rnafold_input1.fa"/>\n <output name="out_file1" file="rnafold_result1.txt"/>\n </test>\n- \n <test>\n <param name="select_fasta" value="true" />\n <param name="fasta_input" value="rnafold_input2.fa"/>\n <param name="temperature" value="75"/>\n <output name="out_file1" file="rnafold_result2.txt"/>\n </test>\n- \n <test>\n <param name="select_fasta" value="false" />\n <param name="input_sequence" value="TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA"/>\n <output name="out_file1" file="rnafold_result3.txt"/>\n </test>\n+ <test>\n+ <param name="select_fasta" value="true" />\n+ <param name="fasta_input" value="sample_3.fa"/>\n+ <conditional name="shapeOption">\n+ <param name="shapeSelector" value="isUsed"/>\n+ </conditional>\n+ <param name="shapeFile" value="sample_3.react"/>\n+ <output name="out_file1" file="sample_3_result.txt"/>\n+ </test>\n </tests>\n <help>\n <![CDATA[\n@@ -343,7 +358,7 @@\n \n - several possible postscript images bundled together in a tar file\n - secondary structure for each sequence in the input file\n- - if partition function is calculated (--MEA or --partfunc is set) then also the pairing probabilty matrix is generated for each sequence \n+ - if partition function is calculated (--MEA or --partfunc is set) then also the pairing probabilty matrix is generated for each sequence\n \n ]]>\n </help>\n' |
| b |
| diff -r f87325531be8 -r 84aad99aca1f rnafold_SHAPE.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/rnafold_SHAPE.py Tue May 16 16:30:38 2017 -0400 |
| [ |
| @@ -0,0 +1,45 @@ +### overcoming the problem of SHAPE data working with a single line. +### creating multiple multiple files containg SHAPE data for a single sequence and running RNAfold for every +### single sequence. + +import os +import sys +from os import system +from Bio import SeqIO +import re +from subprocess import Popen, PIPE + +params_list = sys.argv[1:] +param_list_no_shape = [s for s in params_list if not "--shape=" in s ] +shape_file = [s for s in params_list if "--shape=" in s ] +assert (len(shape_file) == 1) + +shape_file = shape_file[0] +shape_file = shape_file.replace('--shape=', '') + +params_no_shape = " ".join(str(x) for x in param_list_no_shape) + +pattern = re.compile("^>.*$") +id_line = "" +with open(shape_file, 'r') as f: + content = f.read() + lines = content.split('\n') + for line in lines: + if pattern.match(line): + id_line = line.split()[0] + id_line = id_line[1:] + continue + else: + with open(id_line +'.tmp', "a") as clFile: + clFile.write(line + "\n") + +input_file = sys.stdin + +for record in SeqIO.parse(input_file, "fasta"): + seq = ">{}\n{}".format(record.id,record.seq) + cmd = " RNAfold --shape=" + record.id + '.tmp ' + params_no_shape + p = Popen(cmd , stdin=PIPE, shell=True, stdout=PIPE, stderr=PIPE) + out,err = p.communicate(seq.encode()) + if err: + raise RuntimeError("Error in calling RNAfold\n{}\n{}\n".format(out, err)) + print (out.decode('utf-8').strip()) |
| b |
| diff -r f87325531be8 -r 84aad99aca1f test-data/sample_3.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample_3.fa Tue May 16 16:30:38 2017 -0400 |
| b |
| @@ -0,0 +1,6 @@ +>SECIS_1 test +AUUUUAUCCAUGAAAGUGUUUCCUCUAAACCUAUGUGGAGGAACACCUGAUGUCCAGGAAAAU +>6S_1 test1 +GAAACCCUAAUGUAUUCGAUAUAGUUCCUGAUAUUUUUGAACCGAACAAUUUUUUAUACCUAGGGAGCUUGGAGUUCCGGCGCGGCGCACAUGCCUUCACACGAGGAAGUGCAAACCGUUAGACAGAGCACCCACCUGCUUUAAUUGAGAGCGGGUUCAAAGGAAGGGAAUCCUAAACGGUACGAUUGGGGUUUCU +>6S_2 +UUGUCCCUGCCGUGCUCGUGACUUGGCCAUACAUUCUCUGAACCUAUGUCUUACGGCAUAUGGGUUGCGGGAGUGUAGAGCUGGAGUGAUCGUCUACUCGUAGACGAACCCGAUGCUCUUCGGAUCGCGACCACCUUGAACCUCAGGGUUCGAGAUGCCGGCCUUGACGGCACAGGCGGGGCAUC |
| b |
| diff -r f87325531be8 -r 84aad99aca1f test-data/sample_3.react --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample_3.react Tue May 16 16:30:38 2017 -0400 |
| b |
| @@ -0,0 +1,447 @@ +>SECIS_1 +1 0.0657466222 +2 0.1280448842 +3 0.2786665403 +4 0.1391216354 +5 0.0272299574 +6 0.1717063095 +7 0.488732281 +8 3.3015172695 +9 0.414494604 +10 0.1957445189 +11 0.4670328791 +12 0.1943420556 +13 0.2099109521 +14 0.5846784488 +15 0.1296563697 +16 0.0359267698 +17 0.0438238841 +18 1.6364597431 +19 1.72206594665E-17 +20 0.0099928394 +21 0.0475042774 +22 0.0065948845 +23 0.0574522715 +24 0.2126102485 +25 1.2006488448 +26 0.6040825271 +27 0.4114049219 +28 1.1514597937 +29 1.216707413 +30 0.0186005737 +31 0.0841609069 +32 0.086771667 +33 1.1672973211 +34 0.8144419625 +35 0.2583987716 +36 0.0182542709 +37 0.0875979754 +38 0.094456587 +39 0.5206337515 +40 0.000517531 +41 0.0253820905 +42 0.2076338063 +43 0.0087295599 +44 0.0129264641 +45 0.0127365182 +46 0.1193338151 +47 0.0186183812 +48 0.3581141112 +49 0.0941009884 +50 0.2050905673 +51 0.0209195644 +52 0.6030952711 +53 5.2129588113 +54 0.1747678483 +55 1.2231479801 +56 0.4978854319 +57 0.5711590135 +58 0.2793524314 +59 0.0037936012 +60 0.2158137729 +61 0.5646393912 +62 0.6229186627 +63 0.0193621982 +>6S_1 +1 0.1158690877 +2 0.0774028501 +3 0.2349947573 +4 1.72206594665E-17 +5 0.0926174169 +6 0.0505177415 +7 0.0457131819 +8 0.0194615986 +9 2.1495069267 +10 0.0409639397 +11 0.2185631969 +12 0.1776745985 +13 0.0086422926 +14 0.0241577615 +15 0.0092855631 +16 0.3453240509 +17 0.1535840586 +18 0.0180643958 +19 0.1188776616 +20 0.3091581196 +21 0.3748109806 +22 0.6187506508 +23 0.3511511383 +24 0.6512026704 +25 0.3096370415 +26 0.5283368492 +27 0.7500060952 +28 0.0352720444 +29 0.3776026196 +30 0.3489100484 +31 1.3035405919 +32 0.1023638167 +33 0.133082988 +34 0.0024118398 +35 0.0281166587 +36 0.2818828676 +37 0.1316060603 +38 0.1813992598 +39 0.0047490217 +40 0.0204058553 +41 0.0675891142 +42 0.045119933 +43 0.0266727645 +44 0.0673921107 +45 0.0085752561 +46 0.495476266 +47 0.8224799434 +48 0.5574272341 +49 0.2431151153 +50 0.256015696 +51 0.0386339787 +52 0.6618567864 +53 0.0707284393 +54 1.1215284869 +55 0.0463423016 +56 0.3338809513 +57 0.3987796157 +58 1.1046527917 +59 0.6156154318 +60 0.1179259769 +61 2.0333569471 +62 0.1224421595 +63 0.0266055429 +64 0.0298356423 +65 0.3004015135 +66 2.1966900004 +67 0.0222153137 +68 0.0095300422 +69 0.0503009918 +70 0.0418994997 +71 0.0384566069 +72 2.6211662666 +73 0.1704872628 +74 0.8386436572 +75 0.6961218859 +76 0.1995308419 +77 0.0552442152 +78 0.1937915065 +79 0.1239592493 +80 0.0782601391 +81 0.0138965117 +82 0.0231978646 +83 0.0150709773 +84 0.4084290821 +85 0.0792668417 +86 1.0630476211 +87 0.2524739666 +88 0.0229636507 +89 0.1153934877 +90 0.2693801005 +91 0.0071337145 +92 1.0279231796 +93 0.0574241281 +94 0.103312087 +95 0.2100864561 +96 0.0252070712 +97 0.6067864142 +98 0.0607860625 +99 0.5416948523 +100 0.7090251541 +101 2.0470096713 +102 0.0368697578 +103 0.1221648319 +104 0.0484836208 +105 0.7188621431 +106 0.2405585888 +107 0.1071170724 +108 0.6859305671 +109 0.0997679124 +110 0.0342400356 +111 0.0201635 +112 0.4527960874 +113 0.7018417748 +114 0.2561295384 +115 0.2788440973 +116 0.2437240042 +117 0.0984135237 +118 0.1146045041 +119 0.2116296362 +120 0.0360702095 +121 0.2006613525 +122 0.0635994434 +123 0.8384420629 +124 0.3546527057 +125 0.014380068 +126 0.0041004554 +127 0.2404132813 +128 0.0016204246 +129 0.016365643 +130 0.0025333389 +131 0.0207130798 +132 0.2199275512 +133 0.2973627433 +134 1.7680018464 +135 0.3120917444 +136 0.854288287 +137 0.4309335923 +138 2.3003988746 +139 0.047166557 +140 0.7391255635 +141 0.1357653755 +142 0.4672659386 +143 0.3601080698 +144 0.9111911856 +145 0.7435427597 +146 0.3353115579 +147 1.0513358906 +148 0.1406855309 +149 0.3543459659 +150 0.0561408821 +151 0.563013834 +152 0.1549691284 +153 0.7460309808 +154 0.0486849156 +155 0.1080587915 +156 0.0699642772 +157 0.4423435657 +158 0.0171555252 +159 0.0064557797 +160 0.4739275466 +161 0.2617128164 +162 0.0879369647 +163 0.0062762841 +164 0.1060085461 +165 0.0971932081 +166 0.3139785044 +167 0.0771649003 +168 0.0753029618 +169 0.5676607679 +170 0.9836368904 +171 0.6193661835 +172 0.3890022353 +173 0.3304911731 +174 0.9354752573 +175 2.5683088408 +176 0.6777050636 +177 0.0195000778 +178 0.0532349161 +179 0.0993391181 +180 0.0667310411 +181 0.0123690861 +182 0.0165201319 +183 0.2056431695 +184 0.0114477122 +185 0.1684423923 +186 0.6236165725 +187 0.2533573459 +188 7.4644850979 +189 1.72206594665E-17 +190 0.0510513818 +191 0.071993023 +192 0.093087642 +193 0.026770297 +194 0.1003921418 +195 0.731799564 +196 0.3882654324 +>6S_2 +1 5.135077189 +2 0.0137794619 +3 0.0198585136 +4 0.0394762621 +5 0.1032256038 +6 0.0124879331 +7 0.050343991 +8 0.0266906427 +9 0.0867862234 +10 0.0250443701 +11 0.1241682715 +12 0.0888505404 +13 1.72206594665E-17 +14 0.0443782398 +15 0.0331749933 +16 1.190843321 +17 0.0083605324 +18 0.1025127456 +19 0.0318835351 +20 0.6764653014 +21 1.6659553696 +22 0.0532195755 +23 0.1306535914 +24 3.2368938797 +25 0.2999875752 +26 0.1771608894 +27 0.0735275063 +28 1.1463641343 +29 0.3436951718 +30 0.6339043401 +31 0.8229568123 +32 0.0567986298 +33 0.3413998482 +34 0.1291037675 +35 0.561127074 +36 0.0076983354 +37 0.147000237 +38 0.0214390185 +39 0.5304305785 +40 0.0785507542 +41 0.0483731004 +42 0.0976091996 +43 1.2125480978 +44 0.1865263845 +45 0.6312459899 +46 0.1817958047 +47 2.8617198725 +48 0.2055922577 +49 1.3068827801 +50 0.2629492567 +51 0.8571308379 +52 0.2726647331 +53 1.129084224 +54 0.275119436 +55 0.5874419445 +56 0.3657294569 +57 0.2500734975 +58 1.0443534711 +59 4.5331285532 +60 0.2551985691 +61 0.1800315837 +62 1.2079574507 +63 0.1377332438 +64 0.034281766 +65 0.0098202871 +66 0.9938878178 +67 0.0331980613 +68 0.2884058117 +69 0.1471099733 +70 0.0250835628 +71 0.0040433138 +72 2.1207460501 +73 0.7413016698 +74 0.2856087978 +75 0.1043896327 +76 2.5426831833 +77 0.024753755 +78 0.0197741979 +79 0.0256614712 +80 0.0931195919 +81 0.2341548619 +82 0.9442989 +83 0.6902004027 +84 0.2615426874 +85 0.1968596889 +86 0.1317761893 +87 0.3101105886 +88 0.3109082689 +89 0.6036478733 +90 0.1383132052 +91 1.72206594665E-17 +92 1.3701244222 +93 0.0259262955 +94 0.0427849321 +95 0.0059202715 +96 0.4620195968 +97 1.1627066739 +98 0.1193652803 +99 0.5039174355 +100 0.7685843498 +101 3.3504451177 +102 0.0156110762 +103 0.0405202895 +104 0.0448853051 +105 0.1130352336 +106 0.0128895533 +107 0.0140152443 +108 0.8487385272 +109 0.5411302314 +110 0.1921994675 +111 0.0804367301 +112 2.1393979849 +113 0.657192459 +114 0.9680746376 +115 0.0181673032 +116 0.1293355582 +117 0.0385348779 +118 0.0599847607 +119 0.0286153267 +120 0.0529816257 +121 0.0738905329 +122 1.9826160191 +123 0.6850277412 +124 0.0240149916 +125 0.1003714264 +126 0.0282377438 +127 0.016091267 +128 0.0654324545 +129 1.3672926211 +130 0.3123897874 +131 0.0125997931 +132 0.0326682275 +133 0.8141700098 +134 2.7208263459 +135 0.9376426669 +136 0.2104407859 +137 0.9213456642 +138 0.9496557623 +139 0.0158974709 +140 1.0394051723 +141 3.395502997 +142 0.2786545217 +143 0.0944673368 +144 0.1658691067 +145 1.5138095878 +146 0.2388473327 +147 0.0071582802 +148 0.0399196127 +149 0.0269685694 +150 0.0343298406 +151 0.0260244978 +152 0.1131275763 +153 0.0217325853 +154 0.1015784545 +155 0.0991349861 +156 1.4195713543 +157 0.5085589945 +158 0.1250938659 +159 0.788081555 +160 0.1135816768 +161 0.0633806979 +162 2.7826494 +163 1.8003487205 +164 0.7686439584 +165 0.0397996113 +166 0.8340757785 +167 0.0060961894 +168 0.0003936337 +169 0.0179660084 +170 0.033466093 +171 0.0469772809 +172 0.1070226766 +173 0.3447929483 +174 0.8559366126 +175 0.1279778477 +176 0.2188243998 +177 0.0449863446 +178 0.0382790499 +179 0.0022221768 +180 0.0311889472 +181 0.0257878168 +182 0.0172539125 +183 0.2710934097 +184 0.0914500662 +185 0.208503114 \ No newline at end of file |
| b |
| diff -r f87325531be8 -r 84aad99aca1f test-data/sample_3_result.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample_3_result.txt Tue May 16 16:30:38 2017 -0400 |
| b |
| @@ -0,0 +1,9 @@ +>SECIS_1 +AUUUUAUCCAUGAAAGUGUUUCCUCUAAACCUAUGUGGAGGAACACCUGAUGUCCAGGAAAAU +.((((...(((.(..(((.((((((((........))))))))))).).))).....)))).. (-27.97) +>6S_1 +GAAACCCUAAUGUAUUCGAUAUAGUUCCUGAUAUUUUUGAACCGAACAAUUUUUUAUACCUAGGGAGCUUGGAGUUCCGGCGCGGCGCACAUGCCUUCACACGAGGAAGUGCAAACCGUUAGACAGAGCACCCACCUGCUUUAAUUGAGAGCGGGUUCAAAGGAAGGGAAUCCUAAACGGUACGAUUGGGGUUUCU +(((((((...(((((.((.....((((((....((((((((((...................(((.((((.....((.((((.(..((((.(.((((.....))))).))))...))))).))..)))).)))....(((((.....))))).))))))))))..))))))......)))))))....))))))). (-110.38) +>6S_2 +UUGUCCCUGCCGUGCUCGUGACUUGGCCAUACAUUCUCUGAACCUAUGUCUUACGGCAUAUGGGUUGCGGGAGUGUAGAGCUGGAGUGAUCGUCUACUCGUAGACGAACCCGAUGCUCUUCGGAUCGCGACCACCUUGAACCUCAGGGUUCGAGAUGCCGGCCUUGACGGCACAGGCGGGGCAUC +.((.(((((((((((.(((.(...((((...((.((((.((((((..(((....))).....((((((((...((.(((((.((.((..((((((......))))))))))...))))).))..)))))))).............))))))))))))..)))).).))))))).))))))))).. (-129.27) |