| Previous changeset 6:0a3a602cd1e3 (2019-02-09) Next changeset 8:9e3e80cc4ad4 (2020-11-18) |
|
Commit message:
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/unicycler commit 1f2e4636dbff27bc41f500f31b5500e12f0b56c8" |
|
modified:
unicycler.xml |
| b |
| diff -r 0a3a602cd1e3 -r 88c240872a65 unicycler.xml --- a/unicycler.xml Sat Feb 09 17:02:48 2019 -0500 +++ b/unicycler.xml Tue Oct 08 02:47:44 2019 -0400 |
| b |
| @@ -1,7 +1,13 @@ <tool id="unicycler" name="Create assemblies with Unicycler" version="@VERSION@.0"> <macros> - <token name="@VERSION@">0.4.7</token> + <token name="@VERSION@">0.4.8</token> </macros> + <edam_topics> + <edam_topic>topic_0196</edam_topic> + </edam_topics> + <edam_operations> + <edam_operation>operation_0525</edam_operation> + </edam_operations> <requirements> <requirement type="package" version="@VERSION@">unicycler</requirement> </requirements> @@ -88,6 +94,9 @@ #end if --kmer_count '$spades.kmer_count' --depth_filter '$spades.depth_filter' +#if $spades.largest_component + --largest_component +#end if ## Rotation Options section ## ---------------------------------------------------------- $rotation.no_rotate @@ -163,6 +172,8 @@ <param argument="--kmer_count" type="integer" min="0" value="10" label="Number of k-mer steps to use in SPAdes assembly"/> <param argument="--depth_filter" type="float" min="0" max="1" value="0.25" label="Filter out contigs lower than this fraction of the chromosomal depth" help="It is done if does not result in graph dead ends"/> + <param argument="--largest_component" type="boolean" checked="false" + label="Only keep the largest connected component of the assembly graph"/> </section> <section name="rotation" expanded="false" title="Rotation options" help="These options control the rotation of completed circular sequence near the end of the Unicycler pipeline. Use this ONLY if you know what you are doing!"> @@ -231,7 +242,7 @@ </section> <output name="assembly_graph" ftype="tabular"> <assert_contents> - <has_text text="TACGGGGAAGGACGTC"/> + <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC"/> </assert_contents> </output> <output name="assembly" ftype="fasta"> @@ -286,7 +297,7 @@ </section> <output name="assembly_graph" ftype="tabular"> <assert_contents> - <has_text text="TACGGGGAAGGACGTC" /> + <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC" /> </assert_contents> </output> <output name="assembly" ftype="fasta"> @@ -333,7 +344,7 @@ </section> <output name="assembly_graph" ftype="tabular"> <assert_contents> - <has_text text="TACGGGGAAGGACGTC" /> + <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC" /> </assert_contents> </output> <output name="assembly" ftype="fasta"> |