Galaxy |

Changeset 3:997f5136985f (2014-08-14)

Previous changeset 2:dfe9332138cf (2014-08-14)

Commit message:
Uploaded

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/AUTHORS
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/AUTHORS Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,4 @@
+Authors of FASTX toolkit.
+See also the files THANKS and ChangeLog.
+
+Assaf Gordon designed and implemented FASTX toolkit.

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/COPYING
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/COPYING Thu Aug 14 04:52:17 2014 -0400

b'@@ -0,0 +1,661 @@\n+ GNU AFFERO GENERAL PUBLIC LICENSE\n+ Version 3, 19 November 2007\n+\n+ Copyright (C) 2007 Free Software Foundation, Inc. <http://fsf.org/>\n+ Everyone is permitted to copy and distribute verbatim copies\n+ of this license document, but changing it is not allowed.\n+\n+ Preamble\n+\n+ The GNU Affero General Public License is a free, copyleft license for\n+software and other kinds of works, specifically designed to ensure\n+cooperation with the community in the case of network server software.\n+\n+ The licenses for most software and other practical works are designed\n+to take away your freedom to share and change the works. By contrast,\n+our General Public Licenses are intended to guarantee your freedom to\n+share and change all versions of a program--to make sure it remains free\n+software for all its users.\n+\n+ When we speak of free software, we are referring to freedom, not\n+price. Our General Public Licenses are designed to make sure that you\n+have the freedom to distribute copies of free software (and charge for\n+them if you wish), that you receive source code or can get it if you\n+want it, that you can change the software or use pieces of it in new\n+free programs, and that you know you can do these things.\n+\n+ Developers that use our General Public Licenses protect your rights\n+with two steps: (1) assert copyright on the software, and (2) offer\n+you this License which gives you legal permission to copy, distribute\n+and/or modify the software.\n+\n+ A secondary benefit of defending all users\' freedom is that\n+improvements made in alternate versions of the program, if they\n+receive widespread use, become available for other developers to\n+incorporate. Many developers of free software are heartened and\n+encouraged by the resulting cooperation. However, in the case of\n+software used on network servers, this result may fail to come about.\n+The GNU General Public License permits making a modified version and\n+letting the public access it on a server without ever releasing its\n+source code to the public.\n+\n+ The GNU Affero General Public License is designed specifically to\n+ensure that, in such cases, the modified source code becomes available\n+to the community. It requires the operator of a network server to\n+provide the source code of the modified version running there to the\n+users of that server. Therefore, public use of a modified version, on\n+a publicly accessible server, gives the public access to the source\n+code of the modified version.\n+\n+ An older license, called the Affero General Public License and\n+published by Affero, was designed to accomplish similar goals. This is\n+a different license, not a version of the Affero GPL, but Affero has\n+released a new version of the Affero GPL which permits relicensing under\n+this license.\n+\n+ The precise terms and conditions for copying, distribution and\n+modification follow.\n+\n+ TERMS AND CONDITIONS\n+\n+ 0. Definitions.\n+\n+ "This License" refers to version 3 of the GNU Affero General Public License.\n+\n+ "Copyright" also means copyright-like laws that apply to other kinds of\n+works, such as semiconductor masks.\n+\n+ "The Program" refers to any copyrightable work licensed under this\n+License. Each licensee is addressed as "you". "Licensees" and\n+"recipients" may be individuals or organizations.\n+\n+ To "modify" a work means to copy from or adapt all or part of the work\n+in a fashion requiring copyright permission, other than the making of an\n+exact copy. The resulting work is called a "modified version" of the\n+earlier work or a work "based on" the earlier work.\n+\n+ A "covered work" means either the unmodified Program or a work based\n+on the Program.\n+\n+ To "propagate" a work means to do anything with it that, without\n+permission, would make you directly or secondarily liable for\n+infringement under applicable copyright law, except executing it on a\n+computer or modi'..b'on any\n+author or copyright holder as a result of your choosing to follow a\n+later version.\n+\n+ 15. Disclaimer of Warranty.\n+\n+ THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY\n+APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT\n+HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY\n+OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO,\n+THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR\n+PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM\n+IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF\n+ALL NECESSARY SERVICING, REPAIR OR CORRECTION.\n+\n+ 16. Limitation of Liability.\n+\n+ IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING\n+WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS\n+THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY\n+GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE\n+USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF\n+DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD\n+PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS),\n+EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF\n+SUCH DAMAGES.\n+\n+ 17. Interpretation of Sections 15 and 16.\n+\n+ If the disclaimer of warranty and limitation of liability provided\n+above cannot be given local legal effect according to their terms,\n+reviewing courts shall apply local law that most closely approximates\n+an absolute waiver of all civil liability in connection with the\n+Program, unless a warranty or assumption of liability accompanies a\n+copy of the Program in return for a fee.\n+\n+ END OF TERMS AND CONDITIONS\n+\n+ How to Apply These Terms to Your New Programs\n+\n+ If you develop a new program, and you want it to be of the greatest\n+possible use to the public, the best way to achieve this is to make it\n+free software which everyone can redistribute and change under these terms.\n+\n+ To do so, attach the following notices to the program. It is safest\n+to attach them to the start of each source file to most effectively\n+state the exclusion of warranty; and each file should have at least\n+the "copyright" line and a pointer to where the full notice is found.\n+\n+ <one line to give the program\'s name and a brief idea of what it does.>\n+ Copyright (C) <year> <name of author>\n+\n+ This program is free software: you can redistribute it and/or modify\n+ it under the terms of the GNU Affero General Public License as published by\n+ the Free Software Foundation, either version 3 of the License, or\n+ (at your option) any later version.\n+\n+ This program is distributed in the hope that it will be useful,\n+ but WITHOUT ANY WARRANTY; without even the implied warranty of\n+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\n+ GNU Affero General Public License for more details.\n+\n+ You should have received a copy of the GNU Affero General Public License\n+ along with this program. If not, see <http://www.gnu.org/licenses/>.\n+\n+Also add information on how to contact you by electronic and paper mail.\n+\n+ If your software can interact with users remotely through a computer\n+network, you should also make sure that it provides a way for users to\n+get its source. For example, if your program is a web application, its\n+interface could display a "Source" link that leads users to an archive\n+of the code. There are many ways you could offer source, and different\n+solutions will be better for different programs; see section 13 for the\n+specific requirements.\n+\n+ You should also get your employer (if you work as a programmer) or school,\n+if any, to sign a "copyright disclaimer" for the program, if necessary.\n+For more information on this, and how to apply and follow the GNU AGPL, see\n+<http://www.gnu.org/licenses/>.\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/INSTALL
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/INSTALL Thu Aug 14 04:52:17 2014 -0400

b"@@ -0,0 +1,237 @@\n+Installation Instructions\n+*************************\n+\n+Copyright (C) 1994, 1995, 1996, 1999, 2000, 2001, 2002, 2004, 2005,\n+2006, 2007 Free Software Foundation, Inc.\n+\n+This file is free documentation; the Free Software Foundation gives\n+unlimited permission to copy, distribute and modify it.\n+\n+Basic Installation\n+==================\n+\n+Briefly, the shell commands `./configure; make; make install' should\n+configure, build, and install this package. The following\n+more-detailed instructions are generic; see the `README' file for\n+instructions specific to this package.\n+\n+ The `configure' shell script attempts to guess correct values for\n+various system-dependent variables used during compilation. It uses\n+those values to create a `Makefile' in each directory of the package.\n+It may also create one or more `.h' files containing system-dependent\n+definitions. Finally, it creates a shell script `config.status' that\n+you can run in the future to recreate the current configuration, and a\n+file `config.log' containing compiler output (useful mainly for\n+debugging `configure').\n+\n+ It can also use an optional file (typically called `config.cache'\n+and enabled with `--cache-file=config.cache' or simply `-C') that saves\n+the results of its tests to speed up reconfiguring. Caching is\n+disabled by default to prevent problems with accidental use of stale\n+cache files.\n+\n+ If you need to do unusual things to compile the package, please try\n+to figure out how `configure' could check whether to do them, and mail\n+diffs or instructions to the address given in the `README' so they can\n+be considered for the next release. If you are using the cache, and at\n+some point `config.cache' contains results you don't want to keep, you\n+may remove or edit it.\n+\n+ The file `configure.ac' (or `configure.in') is used to create\n+`configure' by a program called `autoconf'. You need `configure.ac' if\n+you want to change it or regenerate `configure' using a newer version\n+of `autoconf'.\n+\n+The simplest way to compile this package is:\n+\n+ 1. `cd' to the directory containing the package's source code and type\n+ `./configure' to configure the package for your system.\n+\n+ Running `configure' might take a while. While running, it prints\n+ some messages telling which features it is checking for.\n+\n+ 2. Type `make' to compile the package.\n+\n+ 3. Optionally, type `make check' to run any self-tests that come with\n+ the package.\n+\n+ 4. Type `make install' to install the programs and any data files and\n+ documentation.\n+\n+ 5. You can remove the program binaries and object files from the\n+ source code directory by typing `make clean'. To also remove the\n+ files that `configure' created (so you can compile the package for\n+ a different kind of computer), type `make distclean'. There is\n+ also a `make maintainer-clean' target, but that is intended mainly\n+ for the package's developers. If you use it, you may have to get\n+ all sorts of other programs in order to regenerate files that came\n+ with the distribution.\n+\n+ 6. Often, you can also type `make uninstall' to remove the installed\n+ files again.\n+\n+Compilers and Options\n+=====================\n+\n+Some systems require unusual options for compilation or linking that the\n+`configure' script does not know about. Run `./configure --help' for\n+details on some of the pertinent environment variables.\n+\n+ You can give `configure' initial values for configuration parameters\n+by setting variables in the command line or in the environment. Here\n+is an example:\n+\n+ ./configure CC=c99 CFLAGS=-g LIBS=-lposix\n+\n+ *Note Defining Variables::, for more details.\n+\n+Compiling For Multiple Architectures\n+====================================\n+\n+You can compile the package for more than one kind of computer at the\n+same time, by placing the object files for each architecture in their\n+own directory. To do this, you can use GNU `make'. `cd'"..b'n to `--with-PACKAGE\' options, where PACKAGE\n+is something like `gnu-as\' or `x\' (for the X Window System). The\n+`README\' should mention any `--enable-\' and `--with-\' options that the\n+package recognizes.\n+\n+ For packages that use the X Window System, `configure\' can usually\n+find the X include and library files automatically, but if it doesn\'t,\n+you can use the `configure\' options `--x-includes=DIR\' and\n+`--x-libraries=DIR\' to specify their locations.\n+\n+Specifying the System Type\n+==========================\n+\n+There may be some features `configure\' cannot figure out automatically,\n+but needs to determine by the type of machine the package will run on.\n+Usually, assuming the package is built to be run on the _same_\n+architectures, `configure\' can figure that out, but if it prints a\n+message saying it cannot guess the machine type, give it the\n+`--build=TYPE\' option. TYPE can either be a short name for the system\n+type, such as `sun4\', or a canonical name which has the form:\n+\n+ CPU-COMPANY-SYSTEM\n+\n+where SYSTEM can have one of these forms:\n+\n+ OS KERNEL-OS\n+\n+ See the file `config.sub\' for the possible values of each field. If\n+`config.sub\' isn\'t included in this package, then this package doesn\'t\n+need to know the machine type.\n+\n+ If you are _building_ compiler tools for cross-compiling, you should\n+use the option `--target=TYPE\' to select the type of system they will\n+produce code for.\n+\n+ If you want to _use_ a cross compiler, that generates code for a\n+platform different from the build platform, you should specify the\n+"host" platform (i.e., that on which the generated programs will\n+eventually be run) with `--host=TYPE\'.\n+\n+Sharing Defaults\n+================\n+\n+If you want to set default values for `configure\' scripts to share, you\n+can create a site shell script called `config.site\' that gives default\n+values for variables like `CC\', `cache_file\', and `prefix\'.\n+`configure\' looks for `PREFIX/share/config.site\' if it exists, then\n+`PREFIX/etc/config.site\' if it exists. Or, you can set the\n+`CONFIG_SITE\' environment variable to the location of the site script.\n+A warning: not all `configure\' scripts look for a site script.\n+\n+Defining Variables\n+==================\n+\n+Variables not defined in a site shell script can be set in the\n+environment passed to `configure\'. However, some packages may run\n+configure again during the build, and the customized values of these\n+variables may be lost. In order to avoid this problem, you should set\n+them in the `configure\' command line, using `VAR=value\'. For example:\n+\n+ ./configure CC=/usr/local2/bin/gcc\n+\n+causes the specified `gcc\' to be used as the C compiler (unless it is\n+overridden in the site shell script).\n+\n+Unfortunately, this technique does not work for `CONFIG_SHELL\' due to\n+an Autoconf bug. Until the bug is fixed you can use this workaround:\n+\n+ CONFIG_SHELL=/bin/bash /bin/bash ./configure CONFIG_SHELL=/bin/bash\n+\n+`configure\' Invocation\n+======================\n+\n+`configure\' recognizes the following options to control how it operates.\n+\n+`--help\'\n+`-h\'\n+ Print a summary of the options to `configure\', and exit.\n+\n+`--version\'\n+`-V\'\n+ Print the version of Autoconf used to generate the `configure\'\n+ script, and exit.\n+\n+`--cache-file=FILE\'\n+ Enable the cache: use and save the results of the tests in FILE,\n+ traditionally `config.cache\'. FILE defaults to `/dev/null\' to\n+ disable caching.\n+\n+`--config-cache\'\n+`-C\'\n+ Alias for `--cache-file=config.cache\'.\n+\n+`--quiet\'\n+`--silent\'\n+`-q\'\n+ Do not print messages saying which checks are being made. To\n+ suppress all normal output, redirect it to `/dev/null\' (any error\n+ messages will still be shown).\n+\n+`--srcdir=DIR\'\n+ Look for the package\'s source code in directory DIR. Usually\n+ `configure\' can determine that directory automatically.\n+\n+`configure\' also accepts some other, not widely useful, options. Run\n+`configure --help\' for more details.\n+\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,16 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+EXTRA_DIST = reconf configure README install_galaxy_files.sh
+
+SUBDIRS = m4 src doc galaxy scripts
+
+AUTOMAKE_OPTIONS = dist-bzip2 no-dist-gzip
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,624 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+subdir = .\n+DIST_COMMON = README $(am__configure_deps) $(srcdir)/Makefile.am \\\n+\t$(srcdir)/Makefile.in $(srcdir)/config.h.in \\\n+\t$(top_srcdir)/configure AUTHORS COPYING ChangeLog INSTALL NEWS \\\n+\tTHANKS config/config.guess config/config.sub config/depcomp \\\n+\tconfig/install-sh config/missing\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+am__CONFIG_DISTCLEAN_FILES = config.status config.cache config.log \\\n+ configure.lineno config.status.lineno\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = config.h\n+CONFIG_CLEAN_FILES =\n+SOURCES =\n+DIST_SOURCES =\n+RECURSIVE_TARGETS = all-recursive check-recursive dvi-recursive \\\n+\thtml-recursive info-recursive install-data-recursive \\\n+\tinstall-dvi-recursive install-exec-recursive \\\n+\tinstall-html-recursive install-info-recursive \\\n+\tinstall-pdf-recursive install-ps-recursive install-recursive \\\n+\tinstallcheck-recursive installdirs-recursive pdf-recursive \\\n+\tps-recursive uninstall-recursive\n+RECURSIVE_CLEAN_TARGETS = mostlyclean-recursive clean-recursive\t\\\n+ distclean-recursive maintainer-clean-recursive\n+ETAGS = etags\n+CTAGS = ctags\n+DIST_SUBDIRS = $(SUBDIRS)\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+distdir = $(PACKAGE)-$(VERSION)\n+top_distdir = $(distdir)\n+am__remove_distdir = \\\n+ { test ! -d $(distdir) \\\n+ || { find $(distdir) -type d ! -perm -200 -exec chmod u+w {} \';\' \\\n+ && rm -fr $(distdir); }; }\n+GZIP_ENV = --best\n+DIST_ARCHIVES = $(distdir).tar.bz2\n+distuninstallcheck_listfiles = find . -type f -print\n+distcleancheck_listfiles = find . -type f -print\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+IN'..b'm -rf "$$dc_destdir" \\\n+\t && $(MAKE) $(AM_MAKEFLAGS) dist \\\n+\t && rm -rf $(DIST_ARCHIVES) \\\n+\t && $(MAKE) $(AM_MAKEFLAGS) distcleancheck\n+\t$(am__remove_distdir)\n+\t@(echo "$(distdir) archives ready for distribution: "; \\\n+\t list=\'$(DIST_ARCHIVES)\'; for i in $$list; do echo $$i; done) | \\\n+\t sed -e 1h -e 1s/./=/g -e 1p -e 1x -e \'$$p\' -e \'$$x\'\n+distuninstallcheck:\n+\t@cd $(distuninstallcheck_dir) \\\n+\t&& test `$(distuninstallcheck_listfiles) | wc -l` -le 1 \\\n+\t || { echo "ERROR: files left after uninstall:" ; \\\n+\t if test -n "$(DESTDIR)"; then \\\n+\t echo " (check DESTDIR support)"; \\\n+\t fi ; \\\n+\t $(distuninstallcheck_listfiles) ; \\\n+\t exit 1; } >&2\n+distcleancheck: distclean\n+\t@if test \'$(srcdir)\' = . ; then \\\n+\t echo "ERROR: distcleancheck can only run from a VPATH build" ; \\\n+\t exit 1 ; \\\n+\tfi\n+\t@test `$(distcleancheck_listfiles) | wc -l` -eq 0 \\\n+\t || { echo "ERROR: files left in build directory after distclean:" ; \\\n+\t $(distcleancheck_listfiles) ; \\\n+\t exit 1; } >&2\n+check-am: all-am\n+check: check-recursive\n+all-am: Makefile config.h\n+installdirs: installdirs-recursive\n+installdirs-am:\n+install: install-recursive\n+install-exec: install-exec-recursive\n+install-data: install-data-recursive\n+uninstall: uninstall-recursive\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-recursive\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-recursive\n+\n+clean-am: clean-generic mostlyclean-am\n+\n+distclean: distclean-recursive\n+\t-rm -f $(am__CONFIG_DISTCLEAN_FILES)\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-generic distclean-hdr distclean-tags\n+\n+dvi: dvi-recursive\n+\n+dvi-am:\n+\n+html: html-recursive\n+\n+info: info-recursive\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-recursive\n+\n+install-exec-am:\n+\n+install-html: install-html-recursive\n+\n+install-info: install-info-recursive\n+\n+install-man:\n+\n+install-pdf: install-pdf-recursive\n+\n+install-ps: install-ps-recursive\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-recursive\n+\t-rm -f $(am__CONFIG_DISTCLEAN_FILES)\n+\t-rm -rf $(top_srcdir)/autom4te.cache\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-recursive\n+\n+mostlyclean-am: mostlyclean-generic\n+\n+pdf: pdf-recursive\n+\n+pdf-am:\n+\n+ps: ps-recursive\n+\n+ps-am:\n+\n+uninstall-am:\n+\n+.MAKE: $(RECURSIVE_CLEAN_TARGETS) $(RECURSIVE_TARGETS) install-am \\\n+\tinstall-strip\n+\n+.PHONY: $(RECURSIVE_CLEAN_TARGETS) $(RECURSIVE_TARGETS) CTAGS GTAGS \\\n+\tall all-am am--refresh check check-am clean clean-generic \\\n+\tctags ctags-recursive dist dist-all dist-bzip2 dist-gzip \\\n+\tdist-lzma dist-shar dist-tarZ dist-zip distcheck distclean \\\n+\tdistclean-generic distclean-hdr distclean-tags distcleancheck \\\n+\tdistdir distuninstallcheck dvi dvi-am html html-am info \\\n+\tinfo-am install install-am install-data install-data-am \\\n+\tinstall-dvi install-dvi-am install-exec install-exec-am \\\n+\tinstall-html install-html-am install-info install-info-am \\\n+\tinstall-man install-pdf install-pdf-am install-ps \\\n+\tinstall-ps-am install-strip installcheck installcheck-am \\\n+\tinstalldirs installdirs-am maintainer-clean \\\n+\tmaintainer-clean-generic mostlyclean mostlyclean-generic pdf \\\n+\tpdf-am ps ps-am tags tags-recursive uninstall uninstall-am\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/NEWS
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/NEWS Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,26 @@
+FASTX toolkit -- History of visible changes.
+
+Copyright (C) 2008, Assaf Gordon <gordon@cshl.edu>
+See the end for copying conditions.
+
+Please send FASTX toolkit bug reports to gordon@cshl.edu.
+
+Version 0.0.6
+
+* First public release
+
+-------------------------------------------------------
+Copying information:
+
+Copyright (C) 2008, Assaf Gordon <gordon@cshl.edu>
+
+   Permission is granted to anyone to make or distribute verbatim copies
+   of this document as received, in any medium, provided that the
+   copyright notice and this permission notice are preserved,
+   thus giving the recipient permission to redistribute in turn.
+
+   Permission is granted to distribute modified versions
+   of this document, or of portions of it,
+   under the above conditions, provided also that they
+   carry prominent notices stating who last changed them.
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/README
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/README Thu Aug 14 04:52:17 2014 -0400

b'@@ -0,0 +1,274 @@\n+FASTX-Toolkit\n+=============\n+\n+\n+Short Summary\n+===============\n+\n+The FASTX-Toolkit is a collection of command line tools for Short-Reads \n+FASTA/FASTQ files preprocessing.\n+\n+\n+\n+More Details\n+==============\n+\n+Next-Generation sequencing machines usually produce FASTA or FASTQ files, \n+containing multiple short-reads sequences (possibly with quality information).\n+\n+The main processing of such FASTA/FASTQ files is mapping (aka aligning)\n+the sequences to reference genomes or other databases using specialized\n+programs. \n+\n+Example of such mapping programs are:\n+Blat (http://www.kentinformatics.com/index.asp), \n+SHRiMP (http://compbio.cs.toronto.edu/shrimp),\n+LastZ (http://www.bx.psu.edu/miller_lab),\n+MAQ (http://maq.sourceforge.net/)\n+And many many others.\n+\n+However, \n+It is sometimes more productive to preprocess the FASTA/FASTQ files before \n+mapping the sequences to the genome - manipulating the sequences to \n+produce better mapping results.\n+\n+The FASTX-Toolkit tools perform some of these preprocessing tasks.\n+\n+\n+\n+Available Tools\n+===============\n+\n+FASTQ-to-FASTA - Converts a FASTQ file to a FASTA file..\n+\n+FASTQ-Statistics - scans a FASTQ file, and produces some statistics about the \n+\tquality and the sequences in the file.\n+\t\n+FASTQ-Quality-BoxPlot, and\n+FASTQ-Nucleotides-Distribution - Generates charts based on the statistics \n+\tgenerated by FASTQ-Statistics. These charts can be used to quickly\n+\tsee the quality of the sequenced library.\n+\t\n+FASTQ-Quality-Converter - Converts from ASCII to numeric quality scores.\n+\n+FASTQ-Quality-Filter - removes low-quality sequences from FASTQ files.\n+\n+FASTX-Artifacts-Filter - removes some sequencing artifacts from FASTA/Q files.\n+\n+FASTX-Barcode-Splitter - A common practice is to sequence multiple biological\n+\tsamples in the same library (marking each sample using a dedicated \n+\tbarcode). The resulting FASTA/Q file contains intermixed sequences \n+\tfrom those samples. This tool separates FASTA/Q files into several \n+\tindividual files, based on the barcodes.\n+\t\n+FASTX-Clipper - Adapters (aka Linkers) are added to the library (before \n+\tsequencing), and should be removed from the resulting FASTA/Q file.\n+\tThis tool removes (clips) adapters.\n+\t\n+FASTA-Clipping-Histogram - After clipping a FASTA file, this tool generates a\n+\tchart showing the length of the clipped sequences.\n+\t\n+FASTX-Reverse-Complement - Produces a reverse-complement of FASTA/Q file.\n+\tIf a FASTQ file is given, the quality scores are also reversed.\n+\t\n+FASTX-Trimmer - Extract sub-seqeunces from FASTA/Q file. Two examples are:\n+\tRemoving barcodes from the 5\'-end of all sequences in a FASTQ file;\n+\tCutting 7 nucleotides from the 3\'-end of all sequences in a FASTA file.\n+\n+\n+\n+Galaxy\n+======\n+\n+Galaxy (http://g2.bx.psu.edu) is web-based framework for computational biology.\n+\n+While the programs in the FASTX-Toolkit are command-line based, the package \n+include the necessary files to integrate the tools into a Galaxy server,\n+Allowing users to execute this tools from their web-browser.\n+\n+If you run your own local mirror of a Galaxy server, you can integrate the\n+FASTX-Toolkit into your Galaxy server.\n+\n+\n+\n+Software Requirements\n+=====================\n+\n+1. GCC is required to compile most tools.\n+\n+2. FASTA-Clipping-Histogram tool requires Perl, the "PerlIO::gzip",\n+ "GD::Graph::bars" modules.\n+ \n+ Installing the perl modules can be accomplised by running:\n+\n+ $ sudo cpan \'PerlIO::gzip\'\n+ $ sudo cpan \'GD::Graph::bars\'\n+ \n+3. FASTX-Barcode-Splitter requires the GNU Sed program.\n+ \n+4. FASTQ-Quality-Boxplot and FASTQ-Nucleotides-Distribution requires the\n+ \'gnuplot\' program.\n+\n+\n+Installation\n+============\n+\n+To compile to tools, run:\n+\n+ $ ./configure\n+ $ make\n+ \n+To install the tools, run (as root):\n+\n+ $ sudo make install\n+\n+This will install the tools into /usr/local/bin.\n+To install the tools to a different location, change the \'configure\' step to:\n+\n+ $ ./configure --pref'..b'+(Run from Galaxy\'s main directory)\n+ $ sh run_functional_tests.sh -id cshl_fastq_qual_conv\n+ $ sh run_functional_tests.sh -id cshl_fastq_to_fasta\n+ $ sh run_functional_tests.sh -id cshl_fastq_qual_stat\n+ $ sh run_functional_tests.sh -id cshl_fastx_trimmer\n+ $ sh run_functional_tests.sh -id cshl_fastx_reverse_complement\n+ $ sh run_functional_tests.sh -id cshl_fastx_artifacts_filter\n+ $ sh run_functional_tests.sh -id cshl_fasta_collapser\n+ $ sh run_functional_tests.sh -id cshl_fastx_clipper\n+ \n+\n+Special configuration for Barcode-Splitter\n+==========================================\n+\n+When running the barcode-splitter tool from the command line you specify a \n+prefix direcotry - the output files will be written to that directory (similar\n+to GNU\'s split program usage).\n+\n+Running the barcode-splittter inside galaxy requires a special hack beacuse\n+(I don\'t know how to|Galaxy can\'t) create a variable number of output datasets.\n+The number of required output files is determined by the tool only AFTER reading \n+the barcodes description file.\n+\n+The Galaxy-version of Barcode-Splitter works like this:\n+1. A FASTA/FASTQ file, and a Barcode description file are fed to the tool.\n+2. The tool produces a single output dataset (inside galaxy). This output\n+ is an HTML file, containing links to the split FASTA files.\n+3. Users can use the links to get the split FASTA files.\n+ (Since Galaxy\'s \'upload data\' tool accepts URLs, this is not a real problem).\n+ \n+4. As the galaxy administrator, you\'ll have to edit \n+ \'fastx_barcode_splitter_galaxy_wrapper.sh\' script and change BASEPATH and \n+ PUBLICURL to point to a publicly accesibly path on your server.\n+ \n+Example:\n+\n+fastx_barcode_splitter_galaxy_wrapper.sh contains:\n+\n+ BASEPATH="/media/sdb1/galaxy/barcode_splits/"\n+ PUBLICURL="http://tango.cshl.edu/barcode_splits/"\n+\n+When a user runs the barcode splitter tool, the FASTA files will be generated in \n+"/media/sdb1/galaxy/barcode_splits/". \n+The URL "http://tango.cshl.edu/barcode_splits" is set (in an apache server) to\n+serve files from "/media/sdb1/galaxy/barcode_splits/", with the following \n+configuration:\n+\n+ Alias /barcode_splits "/media/sdb1/galaxy/barcode_splits/"\n+ <Directory "/media/sdb1/galaxy/barcode_splits/">\n+ AllowOverride None\n+ Order allow,deny\n+ Allow from all\n+ </Directory>\n+\n+\n+\n+\n+Licenses\n+========\n+\n+FASTX-Toolkit is distributed under the Affero GPL version 3 or later (AGPLv3),\n+\n+EXCEPT\n+\n+All files under the \'galaxy\' sub-directory are distributed under the\n+same license as Galaxy itself (which is an MIT-style license).\n+\n+\n+While IANAL, these licenses basically mean that:\n+1. You\'re free to use FASTX-toolkit,\n+\n+2. You\'re free to integrate FASTX-toolkit in your Galaxy mirror server \n+ (or any other server).\n+ \n+3. You\'re free to modify the files under \'galaxy\',\n+ without making your modifications public.\n+ \n+4. If you modify the FASTX-toolkit tools, and make those modifications \n+ publicly available (either as downloadable tools, part of another product),\n+ or as a web-based server - you must make the modified source code freely \n+ available (free as in speech).\n+ \n+See the COPYING file for the full Affero GPL.\n+See the GALAXY-LICENSE file for galaxy\'s license.\n+\n+Please remember: \n+ THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY\n+APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT\n+HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY\n+OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO,\n+THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR\n+PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM\n+IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF\n+ALL NECESSARY SERVICING, REPAIR OR CORRECTION.\n+\n+\n+=============\n+Please send all comments, suggestions, bug reports (or better yet - bug fixes)\n+to gordon@cshl.edu .\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/THANKS
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/THANKS Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,8 @@
+FASTX toolkit THANKS file
+
+FASTX toolkit has originally been written by Assaf Gordon.
+Many people have further contributed to FASTX-Toolkit by reporting problems,
+suggesting various improvements, or submitting actual code. Here is
+a list of these people. Help me keep it complete and exempt of errors.
+
+Many Hannon-lab members at CSHL (who prefered to remain anonymous).

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/aclocal.m4
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/aclocal.m4 Thu Aug 14 04:52:17 2014 -0400

[

b"@@ -0,0 +1,1255 @@\n+# generated automatically by aclocal 1.10.1 -*- Autoconf -*-\n+\n+# Copyright (C) 1996, 1997, 1998, 1999, 2000, 2001, 2002, 2003, 2004,\n+# 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This file is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+m4_ifndef([AC_AUTOCONF_VERSION],\n+ [m4_copy([m4_PACKAGE_VERSION], [AC_AUTOCONF_VERSION])])dnl\n+m4_if(AC_AUTOCONF_VERSION, [2.61],,\n+[m4_warning([this file was generated for autoconf 2.61.\n+You have another version of autoconf. It may work, but is not guaranteed to.\n+If you have problems, you may need to regenerate the build system entirely.\n+To do so, use the procedure documented by the package, typically `autoreconf'.])])\n+\n+dnl Autoconf support for C++\n+dnl Copyright (C) 1988 Eleftherios Gkioulekas <lf@amath.washington.edu>\n+dnl \n+dnl This program is free software; you can redistribute it and/or modify\n+dnl it under the terms of the GNU General Public License as published by\n+dnl the Free Software Foundation; either version 2 of the License, or\n+dnl (at your option) any later version.\n+dnl \n+dnl This program is distributed in the hope that it will be useful,\n+dnl but WITHOUT ANY WARRANTY; without even the implied warranty of\n+dnl MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\n+dnl GNU General Public License for more details.\n+dnl \n+dnl You should have received a copy of the GNU General Public License\n+dnl along with this program; if not, write to the Free Software \n+dnl Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.\n+dnl \n+dnl As a special exception to the GNU General Public License, if you \n+dnl distribute this file as part of a program that contains a configuration \n+dnl script generated by Autoconf, you may include it under the same \n+dnl distribution terms that you use for the rest of that program.\n+\n+# -------------------------------------------------------------------------\n+# Use this macro to configure your C compiler\n+# When called the macro does the following things:\n+# 1. It finds an appropriate C compiler.\n+# If you passed the flag --with-cc=foo then it uses that\n+# particular compiler\n+# 2. Check whether the compiler works.\n+# 3. Checks whether the compiler accepts the -g \n+# -------------------------------------------------------------------------\n+\n+AC_DEFUN(LF_CONFIGURE_CC,[\n+ dnl Sing the song\n+ AC_PROG_CC\n+ AC_PROG_CPP\n+ AC_AIX\n+ AC_ISC_POSIX\n+ AC_MINIX \n+ AC_HEADER_STDC\n+])\n+\n+\n+dnl Autoconf support for C++\n+dnl Copyright (C) 1988 Eleftherios Gkioulekas <lf@amath.washington.edu>\n+dnl \n+dnl This program is free software; you can redistribute it and/or modify\n+dnl it under the terms of the GNU General Public License as published by\n+dnl the Free Software Foundation; either version 2 of the License, or\n+dnl (at your option) any later version.\n+dnl \n+dnl This program is distributed in the hope that it will be useful,\n+dnl but WITHOUT ANY WARRANTY; without even the implied warranty of\n+dnl MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\n+dnl GNU General Public License for more details.\n+dnl \n+dnl You should have received a copy of the GNU General Public License\n+dnl along with this program; if not, write to the Free Software \n+dnl Foundation, Inc., 59 Temple Place - Suite 330, Boston, MA 02111-1307, USA.\n+dnl \n+dnl As a special exception to the GNU General Public License, if you \n+dnl distribute this file as part of a program that contains a configuration \n+dnl script generated by Autoconf, you may include it under the same \n+dnl distribution terms that you use for the rest of that program.\n+\n+# ----------------------"..b'ironments, therefore Automake\n+# will honor the `STRIP\' environment variable to overrule this program.\n+dnl Don\'t test for $cross_compiling = yes, because it might be `maybe\'.\n+if test "$cross_compiling" != no; then\n+ AC_CHECK_TOOL([STRIP], [strip], :)\n+fi\n+INSTALL_STRIP_PROGRAM="\\$(install_sh) -c -s"\n+AC_SUBST([INSTALL_STRIP_PROGRAM])])\n+\n+# Copyright (C) 2006 Free Software Foundation, Inc.\n+#\n+# This file is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# _AM_SUBST_NOTMAKE(VARIABLE)\n+# ---------------------------\n+# Prevent Automake from outputting VARIABLE = @VARIABLE@ in Makefile.in.\n+# This macro is traced by Automake.\n+AC_DEFUN([_AM_SUBST_NOTMAKE])\n+\n+# Check how to create a tarball. -*- Autoconf -*-\n+\n+# Copyright (C) 2004, 2005 Free Software Foundation, Inc.\n+#\n+# This file is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# serial 2\n+\n+# _AM_PROG_TAR(FORMAT)\n+# --------------------\n+# Check how to create a tarball in format FORMAT.\n+# FORMAT should be one of `v7\', `ustar\', or `pax\'.\n+#\n+# Substitute a variable $(am__tar) that is a command\n+# writing to stdout a FORMAT-tarball containing the directory\n+# $tardir.\n+# tardir=directory && $(am__tar) > result.tar\n+#\n+# Substitute a variable $(am__untar) that extract such\n+# a tarball read from stdin.\n+# $(am__untar) < result.tar\n+AC_DEFUN([_AM_PROG_TAR],\n+[# Always define AMTAR for backward compatibility.\n+AM_MISSING_PROG([AMTAR], [tar])\n+m4_if([$1], [v7],\n+ [am__tar=\'${AMTAR} chof - "$$tardir"\'; am__untar=\'${AMTAR} xf -\'],\n+ [m4_case([$1], [ustar],, [pax],,\n+ [m4_fatal([Unknown tar format])])\n+AC_MSG_CHECKING([how to create a $1 tar archive])\n+# Loop over all known methods to create a tar archive until one works.\n+_am_tools=\'gnutar m4_if([$1], [ustar], [plaintar]) pax cpio none\'\n+_am_tools=${am_cv_prog_tar_$1-$_am_tools}\n+# Do not fold the above two line into one, because Tru64 sh and\n+# Solaris sh will not grok spaces in the rhs of `-\'.\n+for _am_tool in $_am_tools\n+do\n+ case $_am_tool in\n+ gnutar)\n+ for _am_tar in tar gnutar gtar;\n+ do\n+ AM_RUN_LOG([$_am_tar --version]) && break\n+ done\n+ am__tar="$_am_tar --format=m4_if([$1], [pax], [posix], [$1]) -chf - "\'"$$tardir"\'\n+ am__tar_="$_am_tar --format=m4_if([$1], [pax], [posix], [$1]) -chf - "\'"$tardir"\'\n+ am__untar="$_am_tar -xf -"\n+ ;;\n+ plaintar)\n+ # Must skip GNU tar: if it does not support --format= it doesn\'t create\n+ # ustar tarball either.\n+ (tar --version) >/dev/null 2>&1 && continue\n+ am__tar=\'tar chf - "$$tardir"\'\n+ am__tar_=\'tar chf - "$tardir"\'\n+ am__untar=\'tar xf -\'\n+ ;;\n+ pax)\n+ am__tar=\'pax -L -x $1 -w "$$tardir"\'\n+ am__tar_=\'pax -L -x $1 -w "$tardir"\'\n+ am__untar=\'pax -r\'\n+ ;;\n+ cpio)\n+ am__tar=\'find "$$tardir" -print | cpio -o -H $1 -L\'\n+ am__tar_=\'find "$tardir" -print | cpio -o -H $1 -L\'\n+ am__untar=\'cpio -i -H $1 -d\'\n+ ;;\n+ none)\n+ am__tar=false\n+ am__tar_=false\n+ am__untar=false\n+ ;;\n+ esac\n+\n+ # If the value was cached, stop now. We just wanted to have am__tar\n+ # and am__untar set.\n+ test -n "${am_cv_prog_tar_$1}" && break\n+\n+ # tar/untar a dummy directory, and stop if the command works\n+ rm -rf conftest.dir\n+ mkdir conftest.dir\n+ echo GrepMe > conftest.dir/file\n+ AM_RUN_LOG([tardir=conftest.dir && eval $am__tar_ >conftest.tar])\n+ rm -rf conftest.dir\n+ if test -s conftest.tar; then\n+ AM_RUN_LOG([$am__untar <conftest.tar])\n+ grep GrepMe conftest.dir/file >/dev/null 2>&1 && break\n+ fi\n+done\n+rm -rf conftest.dir\n+\n+AC_CACHE_VAL([am_cv_prog_tar_$1], [am_cv_prog_tar_$1=$_am_tool])\n+AC_MSG_RESULT([$am_cv_prog_tar_$1])])\n+AC_SUBST([am__tar])\n+AC_SUBST([am__untar])\n+]) # _AM_PROG_TAR\n+\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/config.h.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/config.h.in Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,81 @@
+/* config.h.in.  Generated from configure.ac by autoheader.  */
+
+/* Description */
+#undef CXX_HAS_BUGGY_FOR_LOOPS
+
+/* Description */
+#undef CXX_HAS_NO_BOOL
+
+/* Define to 1 if you have the <inttypes.h> header file. */
+#undef HAVE_INTTYPES_H
+
+/* Define to 1 if you have the <memory.h> header file. */
+#undef HAVE_MEMORY_H
+
+/* Define to 1 if you have the <stdint.h> header file. */
+#undef HAVE_STDINT_H
+
+/* Define to 1 if you have the <stdlib.h> header file. */
+#undef HAVE_STDLIB_H
+
+/* Define to 1 if you have the <strings.h> header file. */
+#undef HAVE_STRINGS_H
+
+/* Define to 1 if you have the <string.h> header file. */
+#undef HAVE_STRING_H
+
+/* Define to 1 if you have the <sys/stat.h> header file. */
+#undef HAVE_SYS_STAT_H
+
+/* Define to 1 if you have the <sys/types.h> header file. */
+#undef HAVE_SYS_TYPES_H
+
+/* Define to 1 if you have the <unistd.h> header file. */
+#undef HAVE_UNISTD_H
+
+/* Description */
+#undef NDEBUG
+
+/* Name of package */
+#undef PACKAGE
+
+/* Define to the address where bug reports for this package should be sent. */
+#undef PACKAGE_BUGREPORT
+
+/* Define to the full name of this package. */
+#undef PACKAGE_NAME
+
+/* Define to the full name and version of this package. */
+#undef PACKAGE_STRING
+
+/* Define to the one symbol short name of this package. */
+#undef PACKAGE_TARNAME
+
+/* Define to the version of this package. */
+#undef PACKAGE_VERSION
+
+/* Define to 1 if you have the ANSI C header files. */
+#undef STDC_HEADERS
+
+/* Version number of package */
+#undef VERSION
+
+/* Description */
+#undef YOUR_OS
+
+/* Define to 1 if on AIX 3.
+   System headers sometimes define this.
+   We just want to avoid a redefinition error message.  */
+#ifndef _ALL_SOURCE
+# undef _ALL_SOURCE
+#endif
+
+/* Define to 1 if on MINIX. */
+#undef _MINIX
+
+/* Define to 2 if the system does not provide POSIX.1 features except with
+   this defined. */
+#undef _POSIX_1_SOURCE
+
+/* Define to 1 if you need to in order for `stat' and other things to work. */
+#undef _POSIX_SOURCE

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/config/config.guess
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/config/config.guess Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,1526 @@\n+#! /bin/sh\n+# Attempt to guess a canonical system name.\n+# Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999,\n+# 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008\n+# Free Software Foundation, Inc.\n+\n+timestamp=\'2008-01-23\'\n+\n+# This file is free software; you can redistribute it and/or modify it\n+# under the terms of the GNU General Public License as published by\n+# the Free Software Foundation; either version 2 of the License, or\n+# (at your option) any later version.\n+#\n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY; without even the implied warranty of\n+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU\n+# General Public License for more details.\n+#\n+# You should have received a copy of the GNU General Public License\n+# along with this program; if not, write to the Free Software\n+# Foundation, Inc., 51 Franklin Street - Fifth Floor, Boston, MA\n+# 02110-1301, USA.\n+#\n+# As a special exception to the GNU General Public License, if you\n+# distribute this file as part of a program that contains a\n+# configuration script generated by Autoconf, you may include it under\n+# the same distribution terms that you use for the rest of that program.\n+\n+\n+# Originally written by Per Bothner <per@bothner.com>.\n+# Please send patches to <config-patches@gnu.org>. Submit a context\n+# diff and a properly formatted ChangeLog entry.\n+#\n+# This script attempts to guess a canonical system name similar to\n+# config.sub. If it succeeds, it prints the system name on stdout, and\n+# exits with 0. Otherwise, it exits with 1.\n+#\n+# The plan is that this can be called by configure scripts if you\n+# don\'t specify an explicit build system type.\n+\n+me=`echo "$0" | sed -e \'s,.*/,,\'`\n+\n+usage="\\\n+Usage: $0 [OPTION]\n+\n+Output the configuration name of the system \\`$me\' is run on.\n+\n+Operation modes:\n+ -h, --help print this help, then exit\n+ -t, --time-stamp print date of last modification, then exit\n+ -v, --version print version number, then exit\n+\n+Report bugs and patches to <config-patches@gnu.org>."\n+\n+version="\\\n+GNU config.guess ($timestamp)\n+\n+Originally written by Per Bothner.\n+Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001,\n+2002, 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+\n+This is free software; see the source for copying conditions. There is NO\n+warranty; not even for MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE."\n+\n+help="\n+Try \\`$me --help\' for more information."\n+\n+# Parse command line\n+while test $# -gt 0 ; do\n+ case $1 in\n+ --time-stamp | --time* | -t )\n+ echo "$timestamp" ; exit ;;\n+ --version | -v )\n+ echo "$version" ; exit ;;\n+ --help | --h* | -h )\n+ echo "$usage"; exit ;;\n+ -- ) # Stop option processing\n+ shift; break ;;\n+ - )\t# Use stdin as input.\n+ break ;;\n+ -* )\n+ echo "$me: invalid option $1$help" >&2\n+ exit 1 ;;\n+ * )\n+ break ;;\n+ esac\n+done\n+\n+if test $# != 0; then\n+ echo "$me: too many arguments$help" >&2\n+ exit 1\n+fi\n+\n+trap \'exit 1\' 1 2 15\n+\n+# CC_FOR_BUILD -- compiler used by this script. Note that the use of a\n+# compiler to aid in system detection is discouraged as it requires\n+# temporary files to be created and, as you can see below, it is a\n+# headache to deal with in a portable fashion.\n+\n+# Historically, `CC_FOR_BUILD\' used to be named `HOST_CC\'. We still\n+# use `HOST_CC\' if defined, but it is deprecated.\n+\n+# Portable tmp directory creation inspired by the Autoconf team.\n+\n+set_cc_for_build=\'\n+trap "exitcode=\\$?; (rm -f \\$tmpfiles 2>/dev/null; rmdir \\$tmp 2>/dev/null) && exit \\$exitcode" 0 ;\n+trap "rm -f \\$tmpfiles 2>/dev/null; rmdir \\$tmp 2>/dev/null; exit 1" 1 2 13 15 ;\n+: ${TMPDIR=/tmp} ;\n+ { tmp=`(umask 077 && mktemp -d "$TMPDIR/cgXXXXXX") 2>/dev/null` && test -n "$tmp" && test -d "$tmp" ; } ||\n+ { test -n "$RANDOM" && tmp=$TMPDIR/cg$$-$RANDOM && (umask 077 && m'..b'\'s/.*NeXT Mach \$[0-9]*\$.*/\\1/p\') 2>/dev/null`;\n+ if (version < 4)\n+ printf ("%s-next-nextstep%d\\n", __ARCHITECTURE__, version);\n+ else\n+ printf ("%s-next-openstep%d\\n", __ARCHITECTURE__, version);\n+ exit (0);\n+#endif\n+\n+#if defined (MULTIMAX) || defined (n16)\n+#if defined (UMAXV)\n+ printf ("ns32k-encore-sysv\\n"); exit (0);\n+#else\n+#if defined (CMU)\n+ printf ("ns32k-encore-mach\\n"); exit (0);\n+#else\n+ printf ("ns32k-encore-bsd\\n"); exit (0);\n+#endif\n+#endif\n+#endif\n+\n+#if defined (__386BSD__)\n+ printf ("i386-pc-bsd\\n"); exit (0);\n+#endif\n+\n+#if defined (sequent)\n+#if defined (i386)\n+ printf ("i386-sequent-dynix\\n"); exit (0);\n+#endif\n+#if defined (ns32000)\n+ printf ("ns32k-sequent-dynix\\n"); exit (0);\n+#endif\n+#endif\n+\n+#if defined (_SEQUENT_)\n+ struct utsname un;\n+\n+ uname(&un);\n+\n+ if (strncmp(un.version, "V2", 2) == 0) {\n+\tprintf ("i386-sequent-ptx2\\n"); exit (0);\n+ }\n+ if (strncmp(un.version, "V1", 2) == 0) { /* XXX is V1 correct? */\n+\tprintf ("i386-sequent-ptx1\\n"); exit (0);\n+ }\n+ printf ("i386-sequent-ptx\\n"); exit (0);\n+\n+#endif\n+\n+#if defined (vax)\n+# if !defined (ultrix)\n+# include <sys/param.h>\n+# if defined (BSD)\n+# if BSD == 43\n+ printf ("vax-dec-bsd4.3\\n"); exit (0);\n+# else\n+# if BSD == 199006\n+ printf ("vax-dec-bsd4.3reno\\n"); exit (0);\n+# else\n+ printf ("vax-dec-bsd\\n"); exit (0);\n+# endif\n+# endif\n+# else\n+ printf ("vax-dec-bsd\\n"); exit (0);\n+# endif\n+# else\n+ printf ("vax-dec-ultrix\\n"); exit (0);\n+# endif\n+#endif\n+\n+#if defined (alliant) && defined (i860)\n+ printf ("i860-alliant-bsd\\n"); exit (0);\n+#endif\n+\n+ exit (1);\n+}\n+EOF\n+\n+$CC_FOR_BUILD -o $dummy $dummy.c 2>/dev/null && SYSTEM_NAME=`$dummy` &&\n+\t{ echo "$SYSTEM_NAME"; exit; }\n+\n+# Apollos put the system type in the environment.\n+\n+test -d /usr/apollo && { echo ${ISP}-apollo-${SYSTYPE}; exit; }\n+\n+# Convex versions that predate uname can use getsysinfo(1)\n+\n+if [ -x /usr/convex/getsysinfo ]\n+then\n+ case `getsysinfo -f cpu_type` in\n+ c1*)\n+\techo c1-convex-bsd\n+\texit ;;\n+ c2*)\n+\tif getsysinfo -f scalar_acc\n+\tthen echo c32-convex-bsd\n+\telse echo c2-convex-bsd\n+\tfi\n+\texit ;;\n+ c34*)\n+\techo c34-convex-bsd\n+\texit ;;\n+ c38*)\n+\techo c38-convex-bsd\n+\texit ;;\n+ c4*)\n+\techo c4-convex-bsd\n+\texit ;;\n+ esac\n+fi\n+\n+cat >&2 <<EOF\n+$0: unable to guess system type\n+\n+This script, last modified $timestamp, has failed to recognize\n+the operating system you are using. It is advised that you\n+download the most up to date version of the config scripts from\n+\n+ http://git.savannah.gnu.org/gitweb/?p=config.git;a=blob_plain;f=config.guess;hb=HEAD\n+and\n+ http://git.savannah.gnu.org/gitweb/?p=config.git;a=blob_plain;f=config.sub;hb=HEAD\n+\n+If the version you run ($0) is already up to date, please\n+send the following data and any information you think might be\n+pertinent to <config-patches@gnu.org> in order to provide the needed\n+information to handle your system.\n+\n+config.guess timestamp = $timestamp\n+\n+uname -m = `(uname -m) 2>/dev/null || echo unknown`\n+uname -r = `(uname -r) 2>/dev/null || echo unknown`\n+uname -s = `(uname -s) 2>/dev/null || echo unknown`\n+uname -v = `(uname -v) 2>/dev/null || echo unknown`\n+\n+/usr/bin/uname -p = `(/usr/bin/uname -p) 2>/dev/null`\n+/bin/uname -X = `(/bin/uname -X) 2>/dev/null`\n+\n+hostinfo = `(hostinfo) 2>/dev/null`\n+/bin/universe = `(/bin/universe) 2>/dev/null`\n+/usr/bin/arch -k = `(/usr/bin/arch -k) 2>/dev/null`\n+/bin/arch = `(/bin/arch) 2>/dev/null`\n+/usr/bin/oslevel = `(/usr/bin/oslevel) 2>/dev/null`\n+/usr/convex/getsysinfo = `(/usr/convex/getsysinfo) 2>/dev/null`\n+\n+UNAME_MACHINE = ${UNAME_MACHINE}\n+UNAME_RELEASE = ${UNAME_RELEASE}\n+UNAME_SYSTEM = ${UNAME_SYSTEM}\n+UNAME_VERSION = ${UNAME_VERSION}\n+EOF\n+\n+exit 1\n+\n+# Local variables:\n+# eval: (add-hook \'write-file-hooks \'time-stamp)\n+# time-stamp-start: "timestamp=\'"\n+# time-stamp-format: "%:y-%02m-%02d"\n+# time-stamp-end: "\'"\n+# End:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/config/config.sub
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/config/config.sub Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,1658 @@\n+#! /bin/sh\n+# Configuration validation subroutine script.\n+# Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999,\n+# 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008\n+# Free Software Foundation, Inc.\n+\n+timestamp=\'2008-01-16\'\n+\n+# This file is (in principle) common to ALL GNU software.\n+# The presence of a machine in this file suggests that SOME GNU software\n+# can handle that machine. It does not imply ALL GNU software can.\n+#\n+# This file is free software; you can redistribute it and/or modify\n+# it under the terms of the GNU General Public License as published by\n+# the Free Software Foundation; either version 2 of the License, or\n+# (at your option) any later version.\n+#\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY; without even the implied warranty of\n+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\n+# GNU General Public License for more details.\n+#\n+# You should have received a copy of the GNU General Public License\n+# along with this program; if not, write to the Free Software\n+# Foundation, Inc., 51 Franklin Street - Fifth Floor, Boston, MA\n+# 02110-1301, USA.\n+#\n+# As a special exception to the GNU General Public License, if you\n+# distribute this file as part of a program that contains a\n+# configuration script generated by Autoconf, you may include it under\n+# the same distribution terms that you use for the rest of that program.\n+\n+\n+# Please send patches to <config-patches@gnu.org>. Submit a context\n+# diff and a properly formatted ChangeLog entry.\n+#\n+# Configuration subroutine to validate and canonicalize a configuration type.\n+# Supply the specified configuration type as an argument.\n+# If it is invalid, we print an error message on stderr and exit with code 1.\n+# Otherwise, we print the canonical config type on stdout and succeed.\n+\n+# This file is supposed to be the same for all GNU packages\n+# and recognize all the CPU types, system types and aliases\n+# that are meaningful with *any* GNU software.\n+# Each package is responsible for reporting which valid configurations\n+# it does not support. The user should be able to distinguish\n+# a failure to support a valid configuration from a meaningless\n+# configuration.\n+\n+# The goal of this file is to map all the various variations of a given\n+# machine specification into a single specification in the form:\n+#\tCPU_TYPE-MANUFACTURER-OPERATING_SYSTEM\n+# or in some cases, the newer four-part form:\n+#\tCPU_TYPE-MANUFACTURER-KERNEL-OPERATING_SYSTEM\n+# It is wrong to echo any other type of specification.\n+\n+me=`echo "$0" | sed -e \'s,.*/,,\'`\n+\n+usage="\\\n+Usage: $0 [OPTION] CPU-MFR-OPSYS\n+ $0 [OPTION] ALIAS\n+\n+Canonicalize a configuration name.\n+\n+Operation modes:\n+ -h, --help print this help, then exit\n+ -t, --time-stamp print date of last modification, then exit\n+ -v, --version print version number, then exit\n+\n+Report bugs and patches to <config-patches@gnu.org>."\n+\n+version="\\\n+GNU config.sub ($timestamp)\n+\n+Copyright (C) 1992, 1993, 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001,\n+2002, 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+\n+This is free software; see the source for copying conditions. There is NO\n+warranty; not even for MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE."\n+\n+help="\n+Try \\`$me --help\' for more information."\n+\n+# Parse command line\n+while test $# -gt 0 ; do\n+ case $1 in\n+ --time-stamp | --time* | -t )\n+ echo "$timestamp" ; exit ;;\n+ --version | -v )\n+ echo "$version" ; exit ;;\n+ --help | --h* | -h )\n+ echo "$usage"; exit ;;\n+ -- ) # Stop option processing\n+ shift; break ;;\n+ - )\t# Use stdin as input.\n+ break ;;\n+ -* )\n+ echo "$me: invalid option $1$help"\n+ exit 1 ;;\n+\n+ *local*)\n+ # First pass through any local machine types.\n+ echo $1\n+ exit ;;\n+\n+ * )\n+ break ;;\n+ esac\n+done\n+\n+case $# in\n+ 0) ec'..b'nning of $os.\n+\t\tos=`echo $os | sed \'s/[^-]*-//\'`\n+\t\techo Invalid configuration \\`$1\\\': system \\`$os\\\' not recognized 1>&2\n+\t\texit 1\n+\t\t;;\n+esac\n+else\n+\n+# Here we handle the default operating systems that come with various machines.\n+# The value should be what the vendor currently ships out the door with their\n+# machine or put another way, the most popular os provided with the machine.\n+\n+# Note that if you\'re going to try to match "-MANUFACTURER" here (say,\n+# "-sun"), then you have to tell the case statement up towards the top\n+# that MANUFACTURER isn\'t an operating system. Otherwise, code above\n+# will signal an error saying that MANUFACTURER isn\'t an operating\n+# system, and we\'ll never get to this point.\n+\n+case $basic_machine in\n+ score-*)\n+\t\tos=-elf\n+\t\t;;\n+ spu-*)\n+\t\tos=-elf\n+\t\t;;\n+\t*-acorn)\n+\t\tos=-riscix1.2\n+\t\t;;\n+\tarm*-rebel)\n+\t\tos=-linux\n+\t\t;;\n+\tarm*-semi)\n+\t\tos=-aout\n+\t\t;;\n+ c4x-* | tic4x-*)\n+ \tos=-coff\n+\t\t;;\n+\t# This must come before the *-dec entry.\n+\tpdp10-*)\n+\t\tos=-tops20\n+\t\t;;\n+\tpdp11-*)\n+\t\tos=-none\n+\t\t;;\n+\t*-dec | vax-*)\n+\t\tos=-ultrix4.2\n+\t\t;;\n+\tm68*-apollo)\n+\t\tos=-domain\n+\t\t;;\n+\ti386-sun)\n+\t\tos=-sunos4.0.2\n+\t\t;;\n+\tm68000-sun)\n+\t\tos=-sunos3\n+\t\t# This also exists in the configure program, but was not the\n+\t\t# default.\n+\t\t# os=-sunos4\n+\t\t;;\n+\tm68*-cisco)\n+\t\tos=-aout\n+\t\t;;\n+ mep-*)\n+\t\tos=-elf\n+\t\t;;\n+\tmips*-cisco)\n+\t\tos=-elf\n+\t\t;;\n+\tmips*-*)\n+\t\tos=-elf\n+\t\t;;\n+\tor32-*)\n+\t\tos=-coff\n+\t\t;;\n+\t*-tti)\t# must be before sparc entry or we get the wrong os.\n+\t\tos=-sysv3\n+\t\t;;\n+\tsparc-* | *-sun)\n+\t\tos=-sunos4.1.1\n+\t\t;;\n+\t*-be)\n+\t\tos=-beos\n+\t\t;;\n+\t*-haiku)\n+\t\tos=-haiku\n+\t\t;;\n+\t*-ibm)\n+\t\tos=-aix\n+\t\t;;\n+ \t*-knuth)\n+\t\tos=-mmixware\n+\t\t;;\n+\t*-wec)\n+\t\tos=-proelf\n+\t\t;;\n+\t*-winbond)\n+\t\tos=-proelf\n+\t\t;;\n+\t*-oki)\n+\t\tos=-proelf\n+\t\t;;\n+\t*-hp)\n+\t\tos=-hpux\n+\t\t;;\n+\t*-hitachi)\n+\t\tos=-hiux\n+\t\t;;\n+\ti860-* | *-att | *-ncr | *-altos | *-motorola | *-convergent)\n+\t\tos=-sysv\n+\t\t;;\n+\t*-cbm)\n+\t\tos=-amigaos\n+\t\t;;\n+\t*-dg)\n+\t\tos=-dgux\n+\t\t;;\n+\t*-dolphin)\n+\t\tos=-sysv3\n+\t\t;;\n+\tm68k-ccur)\n+\t\tos=-rtu\n+\t\t;;\n+\tm88k-omron*)\n+\t\tos=-luna\n+\t\t;;\n+\t*-next )\n+\t\tos=-nextstep\n+\t\t;;\n+\t*-sequent)\n+\t\tos=-ptx\n+\t\t;;\n+\t*-crds)\n+\t\tos=-unos\n+\t\t;;\n+\t*-ns)\n+\t\tos=-genix\n+\t\t;;\n+\ti370-*)\n+\t\tos=-mvs\n+\t\t;;\n+\t*-next)\n+\t\tos=-nextstep3\n+\t\t;;\n+\t*-gould)\n+\t\tos=-sysv\n+\t\t;;\n+\t*-highlevel)\n+\t\tos=-bsd\n+\t\t;;\n+\t*-encore)\n+\t\tos=-bsd\n+\t\t;;\n+\t*-sgi)\n+\t\tos=-irix\n+\t\t;;\n+\t*-siemens)\n+\t\tos=-sysv4\n+\t\t;;\n+\t*-masscomp)\n+\t\tos=-rtu\n+\t\t;;\n+\tf30[01]-fujitsu | f700-fujitsu)\n+\t\tos=-uxpv\n+\t\t;;\n+\t*-rom68k)\n+\t\tos=-coff\n+\t\t;;\n+\t*-*bug)\n+\t\tos=-coff\n+\t\t;;\n+\t*-apple)\n+\t\tos=-macos\n+\t\t;;\n+\t*-atari*)\n+\t\tos=-mint\n+\t\t;;\n+\t*)\n+\t\tos=-none\n+\t\t;;\n+esac\n+fi\n+\n+# Here we handle the case where we know the os, and the CPU type, but not the\n+# manufacturer. We pick the logical manufacturer.\n+vendor=unknown\n+case $basic_machine in\n+\t*-unknown)\n+\t\tcase $os in\n+\t\t\t-riscix*)\n+\t\t\t\tvendor=acorn\n+\t\t\t\t;;\n+\t\t\t-sunos*)\n+\t\t\t\tvendor=sun\n+\t\t\t\t;;\n+\t\t\t-aix*)\n+\t\t\t\tvendor=ibm\n+\t\t\t\t;;\n+\t\t\t-beos*)\n+\t\t\t\tvendor=be\n+\t\t\t\t;;\n+\t\t\t-hpux*)\n+\t\t\t\tvendor=hp\n+\t\t\t\t;;\n+\t\t\t-mpeix*)\n+\t\t\t\tvendor=hp\n+\t\t\t\t;;\n+\t\t\t-hiux*)\n+\t\t\t\tvendor=hitachi\n+\t\t\t\t;;\n+\t\t\t-unos*)\n+\t\t\t\tvendor=crds\n+\t\t\t\t;;\n+\t\t\t-dgux*)\n+\t\t\t\tvendor=dg\n+\t\t\t\t;;\n+\t\t\t-luna*)\n+\t\t\t\tvendor=omron\n+\t\t\t\t;;\n+\t\t\t-genix*)\n+\t\t\t\tvendor=ns\n+\t\t\t\t;;\n+\t\t\t-mvs* | -opened*)\n+\t\t\t\tvendor=ibm\n+\t\t\t\t;;\n+\t\t\t-os400*)\n+\t\t\t\tvendor=ibm\n+\t\t\t\t;;\n+\t\t\t-ptx*)\n+\t\t\t\tvendor=sequent\n+\t\t\t\t;;\n+\t\t\t-tpf*)\n+\t\t\t\tvendor=ibm\n+\t\t\t\t;;\n+\t\t\t-vxsim* | -vxworks* | -windiss*)\n+\t\t\t\tvendor=wrs\n+\t\t\t\t;;\n+\t\t\t-aux*)\n+\t\t\t\tvendor=apple\n+\t\t\t\t;;\n+\t\t\t-hms*)\n+\t\t\t\tvendor=hitachi\n+\t\t\t\t;;\n+\t\t\t-mpw* | -macos*)\n+\t\t\t\tvendor=apple\n+\t\t\t\t;;\n+\t\t\t-*mint | -mint[0-9]* | -*MiNT | -MiNT[0-9]*)\n+\t\t\t\tvendor=atari\n+\t\t\t\t;;\n+\t\t\t-vos*)\n+\t\t\t\tvendor=stratus\n+\t\t\t\t;;\n+\t\tesac\n+\t\tbasic_machine=`echo $basic_machine | sed "s/unknown/$vendor/"`\n+\t\t;;\n+esac\n+\n+echo $basic_machine$os\n+exit\n+\n+# Local variables:\n+# eval: (add-hook \'write-file-hooks \'time-stamp)\n+# time-stamp-start: "timestamp=\'"\n+# time-stamp-format: "%:y-%02m-%02d"\n+# time-stamp-end: "\'"\n+# End:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/config/depcomp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/config/depcomp Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,589 @@\n+#! /bin/sh\n+# depcomp - compile a program generating dependencies as side-effects\n+\n+scriptversion=2007-03-29.01\n+\n+# Copyright (C) 1999, 2000, 2003, 2004, 2005, 2006, 2007 Free Software\n+# Foundation, Inc.\n+\n+# This program is free software; you can redistribute it and/or modify\n+# it under the terms of the GNU General Public License as published by\n+# the Free Software Foundation; either version 2, or (at your option)\n+# any later version.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY; without even the implied warranty of\n+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\n+# GNU General Public License for more details.\n+\n+# You should have received a copy of the GNU General Public License\n+# along with this program; if not, write to the Free Software\n+# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA\n+# 02110-1301, USA.\n+\n+# As a special exception to the GNU General Public License, if you\n+# distribute this file as part of a program that contains a\n+# configuration script generated by Autoconf, you may include it under\n+# the same distribution terms that you use for the rest of that program.\n+\n+# Originally written by Alexandre Oliva <oliva@dcc.unicamp.br>.\n+\n+case $1 in\n+ \'\')\n+ echo "$0: No command. Try \\`$0 --help\' for more information." 1>&2\n+ exit 1;\n+ ;;\n+ -h | --h*)\n+ cat <<\\EOF\n+Usage: depcomp [--help] [--version] PROGRAM [ARGS]\n+\n+Run PROGRAMS ARGS to compile a file, generating dependencies\n+as side-effects.\n+\n+Environment variables:\n+ depmode Dependency tracking mode.\n+ source Source file read by `PROGRAMS ARGS\'.\n+ object Object file output by `PROGRAMS ARGS\'.\n+ DEPDIR directory where to store dependencies.\n+ depfile Dependency file to output.\n+ tmpdepfile Temporary file to use when outputing dependencies.\n+ libtool Whether libtool is used (yes/no).\n+\n+Report bugs to <bug-automake@gnu.org>.\n+EOF\n+ exit $?\n+ ;;\n+ -v | --v*)\n+ echo "depcomp $scriptversion"\n+ exit $?\n+ ;;\n+esac\n+\n+if test -z "$depmode" || test -z "$source" || test -z "$object"; then\n+ echo "depcomp: Variables source, object and depmode must be set" 1>&2\n+ exit 1\n+fi\n+\n+# Dependencies for sub/bar.o or sub/bar.obj go into sub/.deps/bar.Po.\n+depfile=${depfile-`echo "$object" |\n+ sed \'s|[^\\\\/]*$|\'${DEPDIR-.deps}\'/&|;s|\\.\$[^.]*\$$|.P\\1|;s|Pobj$|Po|\'`}\n+tmpdepfile=${tmpdepfile-`echo "$depfile" | sed \'s/\\.\$[^.]*\$$/.T\\1/\'`}\n+\n+rm -f "$tmpdepfile"\n+\n+# Some modes work just like other modes, but use different flags. We\n+# parameterize here, but still list the modes in the big case below,\n+# to make depend.m4 easier to write. Note that we *cannot* use a case\n+# here, because this file can only contain one case statement.\n+if test "$depmode" = hp; then\n+ # HP compiler uses -M and no extra arg.\n+ gccflag=-M\n+ depmode=gcc\n+fi\n+\n+if test "$depmode" = dashXmstdout; then\n+ # This is just like dashmstdout with a different argument.\n+ dashmflag=-xM\n+ depmode=dashmstdout\n+fi\n+\n+case "$depmode" in\n+gcc3)\n+## gcc 3 implements dependency tracking that does exactly what\n+## we want. Yay! Note: for some reason libtool 1.4 doesn\'t like\n+## it if -MD -MP comes after the -MF stuff. Hmm.\n+## Unfortunately, FreeBSD c89 acceptance of flags depends upon\n+## the command line argument order; so add the flags where they\n+## appear in depend2.am. Note that the slowdown incurred here\n+## affects only configure: in makefiles, %FASTDEP% shortcuts this.\n+ for arg\n+ do\n+ case $arg in\n+ -c) set fnord "$@" -MT "$object" -MD -MP -MF "$tmpdepfile" "$arg" ;;\n+ *) set fnord "$@" "$arg" ;;\n+ esac\n+ shift # fnord\n+ shift # $arg\n+ done\n+ "$@"\n+ stat=$?\n+ if test $stat -eq 0; then :\n+ else\n+ rm -f "$tmpdepfile"\n+ exit $stat\n+ fi\n+ mv "$tmpdepfile" "$depfile"\n+ ;;\n+\n+gcc)\n+## There are various ways to get dependency output from gcc. Here\'s\n+## why we pick this rather obscure method:'..b'haracters before searching for `:\'\n+ # in the target name. This is to cope with DOS-style filenames:\n+ # a dependency such as `c:/foo/bar\' could be seen as target `c\' otherwise.\n+ "$@" $dashmflag |\n+ sed \'s:^[ ]*[^: ][^:][^:]*\\:[ ]*:\'"$object"\'\\: :\' > "$tmpdepfile"\n+ rm -f "$depfile"\n+ cat < "$tmpdepfile" > "$depfile"\n+ tr \' \' \'\n+\' < "$tmpdepfile" | \\\n+## Some versions of the HPUX 10.20 sed can\'t process this invocation\n+## correctly. Breaking it into two sed invocations is a workaround.\n+ sed -e \'s/^\\\\$//\' -e \'/^$/d\' -e \'/:$/d\' | sed -e \'s/$/ :/\' >> "$depfile"\n+ rm -f "$tmpdepfile"\n+ ;;\n+\n+dashXmstdout)\n+ # This case only exists to satisfy depend.m4. It is never actually\n+ # run, as this mode is specially recognized in the preamble.\n+ exit 1\n+ ;;\n+\n+makedepend)\n+ "$@" || exit $?\n+ # Remove any Libtool call\n+ if test "$libtool" = yes; then\n+ while test $1 != \'--mode=compile\'; do\n+ shift\n+ done\n+ shift\n+ fi\n+ # X makedepend\n+ shift\n+ cleared=no\n+ for arg in "$@"; do\n+ case $cleared in\n+ no)\n+ set ""; shift\n+ cleared=yes ;;\n+ esac\n+ case "$arg" in\n+ -D*|-I*)\n+ set fnord "$@" "$arg"; shift ;;\n+ # Strip any option that makedepend may not understand. Remove\n+ # the object too, otherwise makedepend will parse it as a source file.\n+ -*|$object)\n+ ;;\n+ *)\n+ set fnord "$@" "$arg"; shift ;;\n+ esac\n+ done\n+ obj_suffix="`echo $object | sed \'s/^.*\\././\'`"\n+ touch "$tmpdepfile"\n+ ${MAKEDEPEND-makedepend} -o"$obj_suffix" -f"$tmpdepfile" "$@"\n+ rm -f "$depfile"\n+ cat < "$tmpdepfile" > "$depfile"\n+ sed \'1,2d\' "$tmpdepfile" | tr \' \' \'\n+\' | \\\n+## Some versions of the HPUX 10.20 sed can\'t process this invocation\n+## correctly. Breaking it into two sed invocations is a workaround.\n+ sed -e \'s/^\\\\$//\' -e \'/^$/d\' -e \'/:$/d\' | sed -e \'s/$/ :/\' >> "$depfile"\n+ rm -f "$tmpdepfile" "$tmpdepfile".bak\n+ ;;\n+\n+cpp)\n+ # Important note: in order to support this mode, a compiler *must*\n+ # always write the preprocessed file to stdout.\n+ "$@" || exit $?\n+\n+ # Remove the call to Libtool.\n+ if test "$libtool" = yes; then\n+ while test $1 != \'--mode=compile\'; do\n+ shift\n+ done\n+ shift\n+ fi\n+\n+ # Remove `-o $object\'.\n+ IFS=" "\n+ for arg\n+ do\n+ case $arg in\n+ -o)\n+ shift\n+ ;;\n+ $object)\n+ shift\n+ ;;\n+ *)\n+ set fnord "$@" "$arg"\n+ shift # fnord\n+ shift # $arg\n+ ;;\n+ esac\n+ done\n+\n+ "$@" -E |\n+ sed -n -e \'/^# [0-9][0-9]* "\$[^"]*\$".*/ s:: \\1 \\\\:p\' \\\n+ -e \'/^#line [0-9][0-9]* "\$[^"]*\$".*/ s:: \\1 \\\\:p\' |\n+ sed \'$ s: \\\\$::\' > "$tmpdepfile"\n+ rm -f "$depfile"\n+ echo "$object : \\\\" > "$depfile"\n+ cat < "$tmpdepfile" >> "$depfile"\n+ sed < "$tmpdepfile" \'/^$/d;s/^ //;s/ \\\\$//;s/$/ :/\' >> "$depfile"\n+ rm -f "$tmpdepfile"\n+ ;;\n+\n+msvisualcpp)\n+ # Important note: in order to support this mode, a compiler *must*\n+ # always write the preprocessed file to stdout, regardless of -o,\n+ # because we must use -o when running libtool.\n+ "$@" || exit $?\n+ IFS=" "\n+ for arg\n+ do\n+ case "$arg" in\n+ "-Gm"|"/Gm"|"-Gi"|"/Gi"|"-ZI"|"/ZI")\n+\tset fnord "$@"\n+\tshift\n+\tshift\n+\t;;\n+ *)\n+\tset fnord "$@" "$arg"\n+\tshift\n+\tshift\n+\t;;\n+ esac\n+ done\n+ "$@" -E |\n+ sed -n \'/^#line [0-9][0-9]* "\$[^"]*\$"/ s::echo "`cygpath -u \\\\"\\1\\\\"`":p\' | sort | uniq > "$tmpdepfile"\n+ rm -f "$depfile"\n+ echo "$object : \\\\" > "$depfile"\n+ . "$tmpdepfile" | sed \'s% %\\\\ %g\' | sed -n \'/^\$.*\$$/ s::\t\\1 \\\\:p\' >> "$depfile"\n+ echo "\t" >> "$depfile"\n+ . "$tmpdepfile" | sed \'s% %\\\\ %g\' | sed -n \'/^\$.*\$$/ s::\\1\\::p\' >> "$depfile"\n+ rm -f "$tmpdepfile"\n+ ;;\n+\n+none)\n+ exec "$@"\n+ ;;\n+\n+*)\n+ echo "Unknown depmode $depmode" 1>&2\n+ exit 1\n+ ;;\n+esac\n+\n+exit 0\n+\n+# Local Variables:\n+# mode: shell-script\n+# sh-indentation: 2\n+# eval: (add-hook \'write-file-hooks \'time-stamp)\n+# time-stamp-start: "scriptversion="\n+# time-stamp-format: "%:y-%02m-%02d.%02H"\n+# time-stamp-end: "$"\n+# End:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/config/install-sh
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/config/install-sh Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,519 @@\n+#!/bin/sh\n+# install - install a program, script, or datafile\n+\n+scriptversion=2006-12-25.00\n+\n+# This originates from X11R5 (mit/util/scripts/install.sh), which was\n+# later released in X11R6 (xc/config/util/install.sh) with the\n+# following copyright and license.\n+#\n+# Copyright (C) 1994 X Consortium\n+#\n+# Permission is hereby granted, free of charge, to any person obtaining a copy\n+# of this software and associated documentation files (the "Software"), to\n+# deal in the Software without restriction, including without limitation the\n+# rights to use, copy, modify, merge, publish, distribute, sublicense, and/or\n+# sell copies of the Software, and to permit persons to whom the Software is\n+# furnished to do so, subject to the following conditions:\n+#\n+# The above copyright notice and this permission notice shall be included in\n+# all copies or substantial portions of the Software.\n+#\n+# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR\n+# IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,\n+# FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE\n+# X CONSORTIUM BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN\n+# AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNEC-\n+# TION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.\n+#\n+# Except as contained in this notice, the name of the X Consortium shall not\n+# be used in advertising or otherwise to promote the sale, use or other deal-\n+# ings in this Software without prior written authorization from the X Consor-\n+# tium.\n+#\n+#\n+# FSF changes to this file are in the public domain.\n+#\n+# Calling this script install-sh is preferred over install.sh, to prevent\n+# `make\' implicit rules from creating a file called install from it\n+# when there is no Makefile.\n+#\n+# This script is compatible with the BSD install script, but was written\n+# from scratch.\n+\n+nl=\'\n+\'\n+IFS=" ""\t$nl"\n+\n+# set DOITPROG to echo to test this script\n+\n+# Don\'t use :- since 4.3BSD and earlier shells don\'t like it.\n+doit=${DOITPROG-}\n+if test -z "$doit"; then\n+ doit_exec=exec\n+else\n+ doit_exec=$doit\n+fi\n+\n+# Put in absolute file names if you don\'t have them in your path;\n+# or use environment vars.\n+\n+chgrpprog=${CHGRPPROG-chgrp}\n+chmodprog=${CHMODPROG-chmod}\n+chownprog=${CHOWNPROG-chown}\n+cmpprog=${CMPPROG-cmp}\n+cpprog=${CPPROG-cp}\n+mkdirprog=${MKDIRPROG-mkdir}\n+mvprog=${MVPROG-mv}\n+rmprog=${RMPROG-rm}\n+stripprog=${STRIPPROG-strip}\n+\n+posix_glob=\'?\'\n+initialize_posix_glob=\'\n+ test "$posix_glob" != "?" || {\n+ if (set -f) 2>/dev/null; then\n+ posix_glob=\n+ else\n+ posix_glob=:\n+ fi\n+ }\n+\'\n+\n+posix_mkdir=\n+\n+# Desired mode of installed file.\n+mode=0755\n+\n+chgrpcmd=\n+chmodcmd=$chmodprog\n+chowncmd=\n+mvcmd=$mvprog\n+rmcmd="$rmprog -f"\n+stripcmd=\n+\n+src=\n+dst=\n+dir_arg=\n+dst_arg=\n+\n+copy_on_change=false\n+no_target_directory=\n+\n+usage="\\\n+Usage: $0 [OPTION]... [-T] SRCFILE DSTFILE\n+ or: $0 [OPTION]... SRCFILES... DIRECTORY\n+ or: $0 [OPTION]... -t DIRECTORY SRCFILES...\n+ or: $0 [OPTION]... -d DIRECTORIES...\n+\n+In the 1st form, copy SRCFILE to DSTFILE.\n+In the 2nd and 3rd, copy all SRCFILES to DIRECTORY.\n+In the 4th, create DIRECTORIES.\n+\n+Options:\n+ --help display this help and exit.\n+ --version display version info and exit.\n+\n+ -c (ignored)\n+ -C install only if different (preserve the last data modification time)\n+ -d create directories instead of installing files.\n+ -g GROUP $chgrpprog installed files to GROUP.\n+ -m MODE $chmodprog installed files to MODE.\n+ -o USER $chownprog installed files to USER.\n+ -s $stripprog installed files.\n+ -t DIRECTORY install into DIRECTORY.\n+ -T report an error if DSTFILE is a directory.\n+\n+Environment variables override the default commands:\n+ CHGRPPROG CHMODPROG CHOWNPROG CMPPROG CPPROG MKDIRPROG MVPROG\n+ RMPROG STRIPPROG\n+"\n+\n+w'..b'es as we go.\n+\n+ case $dstdir in\n+\t/*) prefix=\'/\';;\n+\t-*) prefix=\'./\';;\n+\t*) prefix=\'\';;\n+ esac\n+\n+ eval "$initialize_posix_glob"\n+\n+ oIFS=$IFS\n+ IFS=/\n+ $posix_glob set -f\n+ set fnord $dstdir\n+ shift\n+ $posix_glob set +f\n+ IFS=$oIFS\n+\n+ prefixes=\n+\n+ for d\n+ do\n+\ttest -z "$d" && continue\n+\n+\tprefix=$prefix$d\n+\tif test -d "$prefix"; then\n+\t prefixes=\n+\telse\n+\t if $posix_mkdir; then\n+\t (umask=$mkdir_umask &&\n+\t $doit_exec $mkdirprog $mkdir_mode -p -- "$dstdir") && break\n+\t # Don\'t fail if two instances are running concurrently.\n+\t test -d "$prefix" || exit 1\n+\t else\n+\t case $prefix in\n+\t *\\\'*) qprefix=`echo "$prefix" | sed "s/\'/\'\\\\\\\\\\\\\\\\\'\'/g"`;;\n+\t *) qprefix=$prefix;;\n+\t esac\n+\t prefixes="$prefixes \'$qprefix\'"\n+\t fi\n+\tfi\n+\tprefix=$prefix/\n+ done\n+\n+ if test -n "$prefixes"; then\n+\t# Don\'t fail if two instances are running concurrently.\n+\t(umask $mkdir_umask &&\n+\t eval "\\$doit_exec \\$mkdirprog $prefixes") ||\n+\t test -d "$dstdir" || exit 1\n+\tobsolete_mkdir_used=true\n+ fi\n+ fi\n+ fi\n+\n+ if test -n "$dir_arg"; then\n+ { test -z "$chowncmd" || $doit $chowncmd "$dst"; } &&\n+ { test -z "$chgrpcmd" || $doit $chgrpcmd "$dst"; } &&\n+ { test "$obsolete_mkdir_used$chowncmd$chgrpcmd" = false ||\n+ test -z "$chmodcmd" || $doit $chmodcmd $mode "$dst"; } || exit 1\n+ else\n+\n+ # Make a couple of temp file names in the proper directory.\n+ dsttmp=$dstdir/_inst.$$_\n+ rmtmp=$dstdir/_rm.$$_\n+\n+ # Trap to clean up those temp files at exit.\n+ trap \'ret=$?; rm -f "$dsttmp" "$rmtmp" && exit $ret\' 0\n+\n+ # Copy the file name to the temp name.\n+ (umask $cp_umask && $doit_exec $cpprog "$src" "$dsttmp") &&\n+\n+ # and set any options; do chmod last to preserve setuid bits.\n+ #\n+ # If any of these fail, we abort the whole thing. If we want to\n+ # ignore errors from any of these, just make sure not to ignore\n+ # errors from the above "$doit $cpprog $src $dsttmp" command.\n+ #\n+ { test -z "$chowncmd" || $doit $chowncmd "$dsttmp"; } &&\n+ { test -z "$chgrpcmd" || $doit $chgrpcmd "$dsttmp"; } &&\n+ { test -z "$stripcmd" || $doit $stripcmd "$dsttmp"; } &&\n+ { test -z "$chmodcmd" || $doit $chmodcmd $mode "$dsttmp"; } &&\n+\n+ # If -C, don\'t bother to copy if it wouldn\'t change the file.\n+ if $copy_on_change &&\n+ old=`LC_ALL=C ls -dlL "$dst"\t2>/dev/null` &&\n+ new=`LC_ALL=C ls -dlL "$dsttmp"\t2>/dev/null` &&\n+\n+ eval "$initialize_posix_glob" &&\n+ $posix_glob set -f &&\n+ set X $old && old=:$2:$4:$5:$6 &&\n+ set X $new && new=:$2:$4:$5:$6 &&\n+ $posix_glob set +f &&\n+\n+ test "$old" = "$new" &&\n+ $cmpprog "$dst" "$dsttmp" >/dev/null 2>&1\n+ then\n+ rm -f "$dsttmp"\n+ else\n+ # Rename the file to the real destination.\n+ $doit $mvcmd -f "$dsttmp" "$dst" 2>/dev/null ||\n+\n+ # The rename failed, perhaps because mv can\'t rename something else\n+ # to itself, or perhaps because mv is so ancient that it does not\n+ # support -f.\n+ {\n+\t# Now remove or move aside any old file at destination location.\n+\t# We try this two ways since rm can\'t unlink itself on some\n+\t# systems and the destination file might be busy for other\n+\t# reasons. In this case, the final cleanup might fail but the new\n+\t# file should still install successfully.\n+\t{\n+\t test ! -f "$dst" ||\n+\t $doit $rmcmd -f "$dst" 2>/dev/null ||\n+\t { $doit $mvcmd -f "$dst" "$rmtmp" 2>/dev/null &&\n+\t { $doit $rmcmd -f "$rmtmp" 2>/dev/null; :; }\n+\t } ||\n+\t { echo "$0: cannot unlink or rename $dst" >&2\n+\t (exit 1); exit 1\n+\t }\n+\t} &&\n+\n+\t# Now rename the file to the real destination.\n+\t$doit $mvcmd "$dsttmp" "$dst"\n+ }\n+ fi || exit 1\n+\n+ trap \'\' 0\n+ fi\n+done\n+\n+# Local variables:\n+# eval: (add-hook \'write-file-hooks \'time-stamp)\n+# time-stamp-start: "scriptversion="\n+# time-stamp-format: "%:y-%02m-%02d.%02H"\n+# time-stamp-end: "$"\n+# End:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/config/missing
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/config/missing Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,367 @@\n+#! /bin/sh\n+# Common stub for a few missing GNU programs while installing.\n+\n+scriptversion=2006-05-10.23\n+\n+# Copyright (C) 1996, 1997, 1999, 2000, 2002, 2003, 2004, 2005, 2006\n+# Free Software Foundation, Inc.\n+# Originally by Fran,cois Pinard <pinard@iro.umontreal.ca>, 1996.\n+\n+# This program is free software; you can redistribute it and/or modify\n+# it under the terms of the GNU General Public License as published by\n+# the Free Software Foundation; either version 2, or (at your option)\n+# any later version.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY; without even the implied warranty of\n+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\n+# GNU General Public License for more details.\n+\n+# You should have received a copy of the GNU General Public License\n+# along with this program; if not, write to the Free Software\n+# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA\n+# 02110-1301, USA.\n+\n+# As a special exception to the GNU General Public License, if you\n+# distribute this file as part of a program that contains a\n+# configuration script generated by Autoconf, you may include it under\n+# the same distribution terms that you use for the rest of that program.\n+\n+if test $# -eq 0; then\n+ echo 1>&2 "Try \\`$0 --help\' for more information"\n+ exit 1\n+fi\n+\n+run=:\n+sed_output=\'s/.* --output[ =]\$[^ ]*\$.*/\\1/p\'\n+sed_minuso=\'s/.* -o \$[^ ]*\$.*/\\1/p\'\n+\n+# In the cases where this matters, `missing\' is being run in the\n+# srcdir already.\n+if test -f configure.ac; then\n+ configure_ac=configure.ac\n+else\n+ configure_ac=configure.in\n+fi\n+\n+msg="missing on your system"\n+\n+case $1 in\n+--run)\n+ # Try to run requested program, and just exit if it succeeds.\n+ run=\n+ shift\n+ "$@" && exit 0\n+ # Exit code 63 means version mismatch. This often happens\n+ # when the user try to use an ancient version of a tool on\n+ # a file that requires a minimum version. In this case we\n+ # we should proceed has if the program had been absent, or\n+ # if --run hadn\'t been passed.\n+ if test $? = 63; then\n+ run=:\n+ msg="probably too old"\n+ fi\n+ ;;\n+\n+ -h|--h|--he|--hel|--help)\n+ echo "\\\n+$0 [OPTION]... PROGRAM [ARGUMENT]...\n+\n+Handle \\`PROGRAM [ARGUMENT]...\' for when PROGRAM is missing, or return an\n+error status if there is no known handling for PROGRAM.\n+\n+Options:\n+ -h, --help display this help and exit\n+ -v, --version output version information and exit\n+ --run try to run the given command, and emulate it if it fails\n+\n+Supported PROGRAM values:\n+ aclocal touch file \\`aclocal.m4\'\n+ autoconf touch file \\`configure\'\n+ autoheader touch file \\`config.h.in\'\n+ autom4te touch the output file, or create a stub one\n+ automake touch all \\`Makefile.in\' files\n+ bison create \\`y.tab.[ch]\', if possible, from existing .[ch]\n+ flex create \\`lex.yy.c\', if possible, from existing .c\n+ help2man touch the output file\n+ lex create \\`lex.yy.c\', if possible, from existing .c\n+ makeinfo touch the output file\n+ tar try tar, gnutar, gtar, then tar without non-portable flags\n+ yacc create \\`y.tab.[ch]\', if possible, from existing .[ch]\n+\n+Send bug reports to <bug-automake@gnu.org>."\n+ exit $?\n+ ;;\n+\n+ -v|--v|--ve|--ver|--vers|--versi|--versio|--version)\n+ echo "missing $scriptversion (GNU Automake)"\n+ exit $?\n+ ;;\n+\n+ -*)\n+ echo 1>&2 "$0: Unknown \\`$1\' option"\n+ echo 1>&2 "Try \\`$0 --help\' for more information"\n+ exit 1\n+ ;;\n+\n+esac\n+\n+# Now exit if we have it, but it failed. Also exit now if we\n+# don\'t have it and --version was passed (most likely to detect\n+# the program).\n+case $1 in\n+ lex|yacc)\n+ # Not GNU programs, they don\'t have --version.\n+ ;;\n+\n+ tar)\n+ if test -n "$run"; then\n+ echo 1>&2 "ERROR: \\`tar\' requires --run"\n+ exit 1\n+ elif test "x$2" = "x--version" || test "x$2" = "x--help"; then\n+ '..b'f y.tab.h; then\n+\techo >y.tab.h\n+ fi\n+ if test ! -f y.tab.c; then\n+\techo \'main() { return 0; }\' >y.tab.c\n+ fi\n+ ;;\n+\n+ lex|flex)\n+ echo 1>&2 "\\\n+WARNING: \\`$1\' is $msg. You should only need it if\n+ you modified a \\`.l\' file. You may need the \\`Flex\' package\n+ in order for those modifications to take effect. You can get\n+ \\`Flex\' from any GNU archive site."\n+ rm -f lex.yy.c\n+ if test $# -ne 1; then\n+ eval LASTARG="\\${$#}"\n+\tcase $LASTARG in\n+\t*.l)\n+\t SRCFILE=`echo "$LASTARG" | sed \'s/l$/c/\'`\n+\t if test -f "$SRCFILE"; then\n+\t cp "$SRCFILE" lex.yy.c\n+\t fi\n+\t ;;\n+\tesac\n+ fi\n+ if test ! -f lex.yy.c; then\n+\techo \'main() { return 0; }\' >lex.yy.c\n+ fi\n+ ;;\n+\n+ help2man)\n+ echo 1>&2 "\\\n+WARNING: \\`$1\' is $msg. You should only need it if\n+\t you modified a dependency of a manual page. You may need the\n+\t \\`Help2man\' package in order for those modifications to take\n+\t effect. You can get \\`Help2man\' from any GNU archive site."\n+\n+ file=`echo "$*" | sed -n "$sed_output"`\n+ test -z "$file" && file=`echo "$*" | sed -n "$sed_minuso"`\n+ if test -f "$file"; then\n+\ttouch $file\n+ else\n+\ttest -z "$file" || exec >$file\n+\techo ".ab help2man is required to generate this page"\n+\texit 1\n+ fi\n+ ;;\n+\n+ makeinfo)\n+ echo 1>&2 "\\\n+WARNING: \\`$1\' is $msg. You should only need it if\n+ you modified a \\`.texi\' or \\`.texinfo\' file, or any other file\n+ indirectly affecting the aspect of the manual. The spurious\n+ call might also be the consequence of using a buggy \\`make\' (AIX,\n+ DU, IRIX). You might want to install the \\`Texinfo\' package or\n+ the \\`GNU make\' package. Grab either from any GNU archive site."\n+ # The file to touch is that specified with -o ...\n+ file=`echo "$*" | sed -n "$sed_output"`\n+ test -z "$file" && file=`echo "$*" | sed -n "$sed_minuso"`\n+ if test -z "$file"; then\n+ # ... or it is the one specified with @setfilename ...\n+ infile=`echo "$*" | sed \'s/.* \$[^ ]*\$ *$/\\1/\'`\n+ file=`sed -n \'\n+\t/^@setfilename/{\n+\t s/.* \$[^ ]*\$ *$/\\1/\n+\t p\n+\t q\n+\t}\' $infile`\n+ # ... or it is derived from the source name (dir/f.texi becomes f.info)\n+ test -z "$file" && file=`echo "$infile" | sed \'s,.*/,,;s,.[^.]*$,,\'`.info\n+ fi\n+ # If the file does not exist, the user really needs makeinfo;\n+ # let\'s fail without touching anything.\n+ test -f $file || exit 1\n+ touch $file\n+ ;;\n+\n+ tar)\n+ shift\n+\n+ # We have already tried tar in the generic part.\n+ # Look for gnutar/gtar before invocation to avoid ugly error\n+ # messages.\n+ if (gnutar --version > /dev/null 2>&1); then\n+ gnutar "$@" && exit 0\n+ fi\n+ if (gtar --version > /dev/null 2>&1); then\n+ gtar "$@" && exit 0\n+ fi\n+ firstarg="$1"\n+ if shift; then\n+\tcase $firstarg in\n+\t*o*)\n+\t firstarg=`echo "$firstarg" | sed s/o//`\n+\t tar "$firstarg" "$@" && exit 0\n+\t ;;\n+\tesac\n+\tcase $firstarg in\n+\t*h*)\n+\t firstarg=`echo "$firstarg" | sed s/h//`\n+\t tar "$firstarg" "$@" && exit 0\n+\t ;;\n+\tesac\n+ fi\n+\n+ echo 1>&2 "\\\n+WARNING: I can\'t seem to be able to run \\`tar\' with the given arguments.\n+ You may want to install GNU tar or Free paxutils, or check the\n+ command line arguments."\n+ exit 1\n+ ;;\n+\n+ *)\n+ echo 1>&2 "\\\n+WARNING: \\`$1\' is needed, and is $msg.\n+ You might have modified some files without having the\n+ proper tools for further handling them. Check the \\`README\' file,\n+ it often tells you about the needed prerequisites for installing\n+ this package. You may also peek at any GNU archive site, in case\n+ some other package would contain this missing \\`$1\' program."\n+ exit 1\n+ ;;\n+esac\n+\n+exit 0\n+\n+# Local variables:\n+# eval: (add-hook \'write-file-hooks \'time-stamp)\n+# time-stamp-start: "scriptversion="\n+# time-stamp-format: "%:y-%02m-%02d.%02H"\n+# time-stamp-end: "$"\n+# End:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/configure
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/configure Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,6955 @@\n+#! /bin/sh\n+# Guess values for system-dependent variables and create Makefiles.\n+# Generated by GNU Autoconf 2.61 for FASTX Toolkit 0.0.6.\n+#\n+# Report bugs to <Assaf Gordon gordon@cshl.edu>.\n+#\n+# Copyright (C) 1992, 1993, 1994, 1995, 1996, 1998, 1999, 2000, 2001,\n+# 2002, 2003, 2004, 2005, 2006 Free Software Foundation, Inc.\n+# This configure script is free software; the Free Software Foundation\n+# gives unlimited permission to copy, distribute and modify it.\n+## --------------------- ##\n+## M4sh Initialization. ##\n+## --------------------- ##\n+\n+# Be more Bourne compatible\n+DUALCASE=1; export DUALCASE # for MKS sh\n+if test -n "${ZSH_VERSION+set}" && (emulate sh) >/dev/null 2>&1; then\n+ emulate sh\n+ NULLCMD=:\n+ # Zsh 3.x and 4.x performs word splitting on ${1+"$@"}, which\n+ # is contrary to our usage. Disable this feature.\n+ alias -g \'${1+"$@"}\'=\'"$@"\'\n+ setopt NO_GLOB_SUBST\n+else\n+ case `(set -o) 2>/dev/null` in\n+ *posix*) set -o posix ;;\n+esac\n+\n+fi\n+\n+\n+\n+\n+# PATH needs CR\n+# Avoid depending upon Character Ranges.\n+as_cr_letters=\'abcdefghijklmnopqrstuvwxyz\'\n+as_cr_LETTERS=\'ABCDEFGHIJKLMNOPQRSTUVWXYZ\'\n+as_cr_Letters=$as_cr_letters$as_cr_LETTERS\n+as_cr_digits=\'0123456789\'\n+as_cr_alnum=$as_cr_Letters$as_cr_digits\n+\n+# The user is always right.\n+if test "${PATH_SEPARATOR+set}" != set; then\n+ echo "#! /bin/sh" >conf$$.sh\n+ echo "exit 0" >>conf$$.sh\n+ chmod +x conf$$.sh\n+ if (PATH="/nonexistent;."; conf$$.sh) >/dev/null 2>&1; then\n+ PATH_SEPARATOR=\';\'\n+ else\n+ PATH_SEPARATOR=:\n+ fi\n+ rm -f conf$$.sh\n+fi\n+\n+# Support unset when possible.\n+if ( (MAIL=60; unset MAIL) || exit) >/dev/null 2>&1; then\n+ as_unset=unset\n+else\n+ as_unset=false\n+fi\n+\n+\n+# IFS\n+# We need space, tab and new line, in precisely that order. Quoting is\n+# there to prevent editors from complaining about space-tab.\n+# (If _AS_PATH_WALK were called with IFS unset, it would disable word\n+# splitting by setting IFS to empty value.)\n+as_nl=\'\n+\'\n+IFS=" ""\t$as_nl"\n+\n+# Find who we are. Look in the path if we contain no directory separator.\n+case $0 in\n+ *[\\\\/]* ) as_myself=$0 ;;\n+ *) as_save_IFS=$IFS; IFS=$PATH_SEPARATOR\n+for as_dir in $PATH\n+do\n+ IFS=$as_save_IFS\n+ test -z "$as_dir" && as_dir=.\n+ test -r "$as_dir/$0" && as_myself=$as_dir/$0 && break\n+done\n+IFS=$as_save_IFS\n+\n+ ;;\n+esac\n+# We did not find ourselves, most probably we were run as `sh COMMAND\'\n+# in which case we are not to be found in the path.\n+if test "x$as_myself" = x; then\n+ as_myself=$0\n+fi\n+if test ! -f "$as_myself"; then\n+ echo "$as_myself: error: cannot find myself; rerun with an absolute file name" >&2\n+ { (exit 1); exit 1; }\n+fi\n+\n+# Work around bugs in pre-3.0 UWIN ksh.\n+for as_var in ENV MAIL MAILPATH\n+do ($as_unset $as_var) >/dev/null 2>&1 && $as_unset $as_var\n+done\n+PS1=\'$ \'\n+PS2=\'> \'\n+PS4=\'+ \'\n+\n+# NLS nuisances.\n+for as_var in \\\n+ LANG LANGUAGE LC_ADDRESS LC_ALL LC_COLLATE LC_CTYPE LC_IDENTIFICATION \\\n+ LC_MEASUREMENT LC_MESSAGES LC_MONETARY LC_NAME LC_NUMERIC LC_PAPER \\\n+ LC_TELEPHONE LC_TIME\n+do\n+ if (set +x; test -z "`(eval $as_var=C; export $as_var) 2>&1`"); then\n+ eval $as_var=C; export $as_var\n+ else\n+ ($as_unset $as_var) >/dev/null 2>&1 && $as_unset $as_var\n+ fi\n+done\n+\n+# Required to use basename.\n+if expr a : \'\$a\$\' >/dev/null 2>&1 &&\n+ test "X`expr 00001 : \'.*\$...\$\'`" = X001; then\n+ as_expr=expr\n+else\n+ as_expr=false\n+fi\n+\n+if (basename -- /) >/dev/null 2>&1 && test "X`basename -- / 2>&1`" = "X/"; then\n+ as_basename=basename\n+else\n+ as_basename=false\n+fi\n+\n+\n+# Name of the executable.\n+as_me=`$as_basename -- "$0" ||\n+$as_expr X/"$0" : \'.*/\$[^/][^/]*\$/*$\' \\| \\\n+\t X"$0" : \'X\$//\$$\' \\| \\\n+\t X"$0" : \'X\$/\$\' \\| . 2>/dev/null ||\n+echo X/"$0" |\n+ sed \'/^.*\\/\$[^/][^/]*\$\\/*$/{\n+\t s//\\1/\n+\t q\n+\t }\n+\t /^X\\/\$\\/\\/\$$/{\n+\t s//\\1/\n+\t q\n+\t }\n+\t /^X\\/\$\\/\$.*/{\n+\t s//\\1/\n+\t q\n+\t }\n+\t s/.*/./; q\'`\n+\n+# CDPATH.\n+$as_unset CDPATH\n+\n+\n+if test "x$CONFIG_SHELL" = x; then\n+ if (eval "'..b'\$//\$$\' \\| \\\n+\t X"$mf" : \'X\$/\$\' \\| . 2>/dev/null ||\n+echo X"$mf" |\n+ sed \'/^X\$.*[^/]\$\\/\\/*[^/][^/]*\\/*$/{\n+\t s//\\1/\n+\t q\n+\t }\n+\t /^X\$\\/\\/\$[^/].*/{\n+\t s//\\1/\n+\t q\n+\t }\n+\t /^X\$\\/\\/\$$/{\n+\t s//\\1/\n+\t q\n+\t }\n+\t /^X\$\\/\$.*/{\n+\t s//\\1/\n+\t q\n+\t }\n+\t s/.*/./; q\'`\n+ else\n+ continue\n+ fi\n+ # Extract the definition of DEPDIR, am__include, and am__quote\n+ # from the Makefile without running `make\'.\n+ DEPDIR=`sed -n \'s/^DEPDIR = //p\' < "$mf"`\n+ test -z "$DEPDIR" && continue\n+ am__include=`sed -n \'s/^am__include = //p\' < "$mf"`\n+ test -z "am__include" && continue\n+ am__quote=`sed -n \'s/^am__quote = //p\' < "$mf"`\n+ # When using ansi2knr, U may be empty or an underscore; expand it\n+ U=`sed -n \'s/^U = //p\' < "$mf"`\n+ # Find all dependency output files, they are included files with\n+ # $(DEPDIR) in their names. We invoke sed twice because it is the\n+ # simplest approach to changing $(DEPDIR) to its actual value in the\n+ # expansion.\n+ for file in `sed -n "\n+ s/^$am__include $am__quote\$.*(DEPDIR).*\$$am__quote"\'$/\\1/p\' <"$mf" | \\\n+ sed -e \'s/\\$(DEPDIR)/\'"$DEPDIR"\'/g\' -e \'s/\\$U/\'"$U"\'/g\'`; do\n+ # Make sure the directory exists.\n+ test -f "$dirpart/$file" && continue\n+ fdir=`$as_dirname -- "$file" ||\n+$as_expr X"$file" : \'X\$.*[^/]\$//*[^/][^/]*/*$\' \\| \\\n+\t X"$file" : \'X\$//\$[^/]\' \\| \\\n+\t X"$file" : \'X\$//\$$\' \\| \\\n+\t X"$file" : \'X\$/\$\' \\| . 2>/dev/null ||\n+echo X"$file" |\n+ sed \'/^X\$.*[^/]\$\\/\\/*[^/][^/]*\\/*$/{\n+\t s//\\1/\n+\t q\n+\t }\n+\t /^X\$\\/\\/\$[^/].*/{\n+\t s//\\1/\n+\t q\n+\t }\n+\t /^X\$\\/\\/\$$/{\n+\t s//\\1/\n+\t q\n+\t }\n+\t /^X\$\\/\$.*/{\n+\t s//\\1/\n+\t q\n+\t }\n+\t s/.*/./; q\'`\n+ { as_dir=$dirpart/$fdir\n+ case $as_dir in #(\n+ -*) as_dir=./$as_dir;;\n+ esac\n+ test -d "$as_dir" || { $as_mkdir_p && mkdir -p "$as_dir"; } || {\n+ as_dirs=\n+ while :; do\n+ case $as_dir in #(\n+ *\\\'*) as_qdir=`echo "$as_dir" | sed "s/\'/\'\\\\\\\\\\\\\\\\\'\'/g"`;; #(\n+ *) as_qdir=$as_dir;;\n+ esac\n+ as_dirs="\'$as_qdir\' $as_dirs"\n+ as_dir=`$as_dirname -- "$as_dir" ||\n+$as_expr X"$as_dir" : \'X\$.*[^/]\$//*[^/][^/]*/*$\' \\| \\\n+\t X"$as_dir" : \'X\$//\$[^/]\' \\| \\\n+\t X"$as_dir" : \'X\$//\$$\' \\| \\\n+\t X"$as_dir" : \'X\$/\$\' \\| . 2>/dev/null ||\n+echo X"$as_dir" |\n+ sed \'/^X\$.*[^/]\$\\/\\/*[^/][^/]*\\/*$/{\n+\t s//\\1/\n+\t q\n+\t }\n+\t /^X\$\\/\\/\$[^/].*/{\n+\t s//\\1/\n+\t q\n+\t }\n+\t /^X\$\\/\\/\$$/{\n+\t s//\\1/\n+\t q\n+\t }\n+\t /^X\$\\/\$.*/{\n+\t s//\\1/\n+\t q\n+\t }\n+\t s/.*/./; q\'`\n+ test -d "$as_dir" && break\n+ done\n+ test -z "$as_dirs" || eval "mkdir $as_dirs"\n+ } || test -d "$as_dir" || { { echo "$as_me:$LINENO: error: cannot create directory $as_dir" >&5\n+echo "$as_me: error: cannot create directory $as_dir" >&2;}\n+ { (exit 1); exit 1; }; }; }\n+ # echo "creating $dirpart/$file"\n+ echo \'# dummy\' > "$dirpart/$file"\n+ done\n+done\n+ ;;\n+\n+ esac\n+done # for ac_tag\n+\n+\n+{ (exit 0); exit 0; }\n+_ACEOF\n+chmod +x $CONFIG_STATUS\n+ac_clean_files=$ac_clean_files_save\n+\n+\n+# configure is writing to config.log, and then calls config.status.\n+# config.status does its own redirection, appending to config.log.\n+# Unfortunately, on DOS this fails, as config.log is still kept open\n+# by configure, so config.status won\'t be able to write to it; its\n+# output is simply discarded. So we exec the FD to /dev/null,\n+# effectively closing config.log, so it can be properly (re)opened and\n+# appended to by config.status. When coming back to configure, we\n+# need to make the FD available again.\n+if test "$no_create" != yes; then\n+ ac_cs_success=:\n+ ac_config_status_args=\n+ test "$silent" = yes &&\n+ ac_config_status_args="$ac_config_status_args --quiet"\n+ exec 5>/dev/null\n+ $SHELL $CONFIG_STATUS $ac_config_status_args || ac_cs_success=false\n+ exec 5>>config.log\n+ # Use ||, not &&, to avoid exiting from the if with $? = 1, which\n+ # would make configure fail if this is the last instruction.\n+ $ac_cs_success || { (exit 1); exit 1; }\n+fi\n+\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/configure.ac
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/configure.ac Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,92 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+AC_INIT([FASTX Toolkit],
+        [0.0.6],
+        [Assaf Gordon gordon@cshl.edu],
+        [fastx_toolkit])
+AC_CONFIG_AUX_DIR(config)
+AM_CONFIG_HEADER(config.h)
+AM_INIT_AUTOMAKE([dist-bzip2])
+
+# 23dec08, Gordon
+# Only added those things because 'autoheader' was complaining...
+AC_DEFINE([CXX_HAS_BUGGY_FOR_LOOPS], [], [Description])
+AC_DEFINE([CXX_HAS_NO_BOOL], [], [Description])
+AC_DEFINE([NDEBUG], [], [Description])
+AC_DEFINE([YOUR_OS], [], [Description])
+
+dnl --enable-wall
+EXTRA_CHECKS="-Wall -Wextra -Wformat-nonliteral -Wformat-security -Wswitch-default -Wswitch-enum -Wunused-parameter -Wfloat-equal -Werror"
+AC_ARG_ENABLE(wall,
+[  --enable-wall          Enable many common GCC warnings (-Wall,-Wextra, -Werror etc., default enabled)],
+[case "${enableval}" in
+  yes) wall=true ;;
+  no)  wall=false ;;
+  *) AC_MSG_ERROR(bad value ${enableval} for --enable-wall) ;;
+esac],[wall=true])
+if test "$wall" = "true"
+then
+  CFLAGS="${CFLAGS} ${EXTRA_CHECKS}"
+  CXXFLAGS="${CXXFLAGS} ${EXTRA_CHECKS}"
+fi
+
+dnl --enable-debug
+AC_ARG_ENABLE(debug,
+[  --enable-debug          Enable debug mode (default enabled)],
+[case "${enableval}" in
+  yes) debug=true ;;
+  no)  debug=false ;;
+  *) AC_MSG_ERROR(bad value ${enableval} for --enable-debug) ;;
+esac],[debug=true])
+if test "$debug" = "true"
+then
+  CFLAGS="${CFLAGS} -DDEBUG -g -O1"
+  CXXFLAGS="${CFLAGS} -DDEBUG -g -O1"
+else
+  CFLAGS="${CFLAGS} -O3"
+  CXXFLAGS="${CFLAGS} -O3"
+fi
+
+
+LF_CONFIGURE_CC
+LF_CONFIGURE_CXX
+LF_HOST_TYPE
+LF_SET_WARNINGS
+AC_PROG_RANLIB
+
+AC_CONFIG_FILES([
+   Makefile
+   doc/Makefile
+   m4/Makefile
+   src/Makefile
+   src/libfastx/Makefile
+   src/fastx_clipper/Makefile
+   src/fastq_to_fasta/Makefile
+   src/fastx_quality_stats/Makefile
+   src/fastq_quality_converter/Makefile
+   src/fastx_trimmer/Makefile
+   src/fastq_quality_filter/Makefile
+   src/fastx_artifacts_filter/Makefile
+   src/fastx_reverse_complement/Makefile
+   src/fastx_collapser/Makefile
+   src/seqalign_test/Makefile
+   galaxy/Makefile
+   galaxy/tools/Makefile
+   galaxy/tools/fastx_toolkit/Makefile
+   galaxy/tools/fastx_toolkit_with_gzip_and_output_label/Makefile
+   galaxy/test-data/Makefile
+   galaxy/static/Makefile
+   galaxy/static/fastx_icons/Makefile
+   galaxy/tool-data/Makefile
+   scripts/Makefile
+])
+
+AC_OUTPUT

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/doc/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/doc/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,10 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/doc/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/doc/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,316 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+subdir = doc\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+SOURCES =\n+DIST_SOURCES =\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARATOR@\n+RANLIB = @RANLIB@\n+SET_MAKE = @SET_MAKE@\n+SHELL = @SHELL@\n+STRIP = @STRIP@\n+VERSION = @VERSION@\n+abs_builddir = @abs_builddir@\n+abs_srcdir = @abs_srcdir@\n+abs_top_builddir = @abs_top_builddir@\n+abs_top_srcdir = @abs_top_srcdir@\n+ac_ct_CC = @ac_ct_CC@\n+ac_ct_CXX = @ac_ct_CXX@\n+am__include = @am__include@\n+am__leading_dot = @am__leading_dot@\n+am__quote = @am__quote@\n+am__tar = @am__tar@\n+am__untar = @am__untar@\n+bindir = @bindir@\n+build = @build@\n+build_alias = @build_alias@\n+build_cpu = @build_cpu@\n+build_os = @build_os@\n+build_vendor = @build_vendor@\n+builddir = @builddir@\n+canonical_host_type = @canonical_host_type@\n+datadir = @datadir@\n+datarootdir = @datarootdir@\n+docdir = @docdir@\n+dvidir = @dvidir@\n+exec_prefix = @exec_prefix@\n+host = @host@\n+host_alias = @host_alias@\n+host_cpu = @host_cpu@\n+host_os = @host_o'..b'\\\n+\t *config.status*) \\\n+\t cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \\\n+\t *) \\\n+\t echo \' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)\'; \\\n+\t cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \\\n+\tesac;\n+\n+$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)\n+\tcd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh\n+\n+$(top_srcdir)/configure: $(am__configure_deps)\n+\tcd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh\n+$(ACLOCAL_M4): $(am__aclocal_m4_deps)\n+\tcd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh\n+tags: TAGS\n+TAGS:\n+\n+ctags: CTAGS\n+CTAGS:\n+\n+\n+distdir: $(DISTFILES)\n+\t@srcdirstrip=`echo "$(srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\ttopsrcdirstrip=`echo "$(top_srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\tlist=\'$(DISTFILES)\'; \\\n+\t dist_files=`for file in $$list; do echo $$file; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-am\n+all-am: Makefile\n+installdirs:\n+install: install-am\n+install-exec: install-exec-am\n+install-data: install-data-am\n+uninstall: uninstall-am\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-am\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-am\n+\n+clean-am: clean-generic mostlyclean-am\n+\n+distclean: distclean-am\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-generic\n+\n+dvi: dvi-am\n+\n+dvi-am:\n+\n+html: html-am\n+\n+info: info-am\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-am\n+\n+install-exec-am:\n+\n+install-html: install-html-am\n+\n+install-info: install-info-am\n+\n+install-man:\n+\n+install-pdf: install-pdf-am\n+\n+install-ps: install-ps-am\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-am\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-am\n+\n+mostlyclean-am: mostlyclean-generic\n+\n+pdf: pdf-am\n+\n+pdf-am:\n+\n+ps: ps-am\n+\n+ps-am:\n+\n+uninstall-am:\n+\n+.MAKE: install-am install-strip\n+\n+.PHONY: all all-am check check-am clean clean-generic distclean \\\n+\tdistclean-generic distdir dvi dvi-am html html-am info info-am \\\n+\tinstall install-am install-data install-data-am install-dvi \\\n+\tinstall-dvi-am install-exec install-exec-am install-html \\\n+\tinstall-html-am install-info install-info-am install-man \\\n+\tinstall-pdf install-pdf-am install-ps install-ps-am \\\n+\tinstall-strip installcheck installcheck-am installdirs \\\n+\tmaintainer-clean maintainer-clean-generic mostlyclean \\\n+\tmostlyclean-generic pdf pdf-am ps ps-am uninstall uninstall-am\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,13 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+SUBDIRS = tools test-data static tool-data
+
+EXTRA_DIST = README fastx_toolkit_conf.xml

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,476 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+subdir = galaxy\n+DIST_COMMON = README $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+SOURCES =\n+DIST_SOURCES =\n+RECURSIVE_TARGETS = all-recursive check-recursive dvi-recursive \\\n+\thtml-recursive info-recursive install-data-recursive \\\n+\tinstall-dvi-recursive install-exec-recursive \\\n+\tinstall-html-recursive install-info-recursive \\\n+\tinstall-pdf-recursive install-ps-recursive install-recursive \\\n+\tinstallcheck-recursive installdirs-recursive pdf-recursive \\\n+\tps-recursive uninstall-recursive\n+RECURSIVE_CLEAN_TARGETS = mostlyclean-recursive clean-recursive\t\\\n+ distclean-recursive maintainer-clean-recursive\n+ETAGS = etags\n+CTAGS = ctags\n+DIST_SUBDIRS = $(SUBDIRS)\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARATOR@\n+RANLIB = @RANLIB@\n+SET_MAKE = @SET_MAKE@\n+SHELL = @SHELL@\n+STRIP = @STRIP@\n+VERSION = @VERSION@\n+abs_builddir = @abs_builddir@\n+abs_srcdir = @abs_srcdir@\n+abs_top_builddir = @abs_top_builddir@\n+abs_top_srcdir = @abs_top_srcdir@\n+ac_ct_CC = @ac_ct_CC@\n+ac_'..b'ile; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+\tlist=\'$(DIST_SUBDIRS)\'; for subdir in $$list; do \\\n+\t if test "$$subdir" = .; then :; else \\\n+\t test -d "$(distdir)/$$subdir" \\\n+\t || $(MKDIR_P) "$(distdir)/$$subdir" \\\n+\t || exit 1; \\\n+\t distdir=`$(am__cd) $(distdir) && pwd`; \\\n+\t top_distdir=`$(am__cd) $(top_distdir) && pwd`; \\\n+\t (cd $$subdir && \\\n+\t $(MAKE) $(AM_MAKEFLAGS) \\\n+\t top_distdir="$$top_distdir" \\\n+\t distdir="$$distdir/$$subdir" \\\n+\t\tam__remove_distdir=: \\\n+\t\tam__skip_length_check=: \\\n+\t distdir) \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-recursive\n+all-am: Makefile\n+installdirs: installdirs-recursive\n+installdirs-am:\n+install: install-recursive\n+install-exec: install-exec-recursive\n+install-data: install-data-recursive\n+uninstall: uninstall-recursive\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-recursive\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-recursive\n+\n+clean-am: clean-generic mostlyclean-am\n+\n+distclean: distclean-recursive\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-generic distclean-tags\n+\n+dvi: dvi-recursive\n+\n+dvi-am:\n+\n+html: html-recursive\n+\n+info: info-recursive\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-recursive\n+\n+install-exec-am:\n+\n+install-html: install-html-recursive\n+\n+install-info: install-info-recursive\n+\n+install-man:\n+\n+install-pdf: install-pdf-recursive\n+\n+install-ps: install-ps-recursive\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-recursive\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-recursive\n+\n+mostlyclean-am: mostlyclean-generic\n+\n+pdf: pdf-recursive\n+\n+pdf-am:\n+\n+ps: ps-recursive\n+\n+ps-am:\n+\n+uninstall-am:\n+\n+.MAKE: $(RECURSIVE_CLEAN_TARGETS) $(RECURSIVE_TARGETS) install-am \\\n+\tinstall-strip\n+\n+.PHONY: $(RECURSIVE_CLEAN_TARGETS) $(RECURSIVE_TARGETS) CTAGS GTAGS \\\n+\tall all-am check check-am clean clean-generic ctags \\\n+\tctags-recursive distclean distclean-generic distclean-tags \\\n+\tdistdir dvi dvi-am html html-am info info-am install \\\n+\tinstall-am install-data install-data-am install-dvi \\\n+\tinstall-dvi-am install-exec install-exec-am install-html \\\n+\tinstall-html-am install-info install-info-am install-man \\\n+\tinstall-pdf install-pdf-am install-ps install-ps-am \\\n+\tinstall-strip installcheck installcheck-am installdirs \\\n+\tinstalldirs-am maintainer-clean maintainer-clean-generic \\\n+\tmostlyclean mostlyclean-generic pdf pdf-am ps ps-am tags \\\n+\ttags-recursive uninstall uninstall-am\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/README
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/README Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,15 @@
+FASTX-Toolkit - Galaxy Files
+============================
+
+These files allows easy integration of the FASTX-toolkit tools in the
+Galaxy framework.
+
+Installation
+============
+See the README file.
+
+LICENSE
+=======
+All files under the 'galaxy' sub-directory are licensed under
+Galaxy's license. see GALAXY-LICENSE file.
+(The rest of the FASTX-Toolkit files are licensed under AGPLv3 or later).

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/fastx_toolkit_conf.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/fastx_toolkit_conf.xml Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,21 @@
+#
+# Add the following sections to your Galaxy server's tool_conf.xml file.
+#
+  <section name="FASTA/Q Information" id="cshl_library_information">
+    <tool file="fastx_toolkit/fastx_quality_statistics.xml" />
+    <tool file="fastx_toolkit/fastq_quality_boxplot.xml" />
+    <tool file="fastx_toolkit/fastx_nucleotides_distribution.xml" />
+    <tool file="fastx_toolkit/fasta_clipping_histogram.xml" />
+  </section>
+
+  <section name="FASTA/Q Preprocessing" id="cshl_fastx_manipulation">
+    <tool file="fastx_toolkit/fastq_to_fasta.xml" />
+    <tool file="fastx_toolkit/fastq_quality_converter.xml" />
+    <tool file="fastx_toolkit/fastx_clipper.xml" />
+    <tool file="fastx_toolkit/fastx_trimmer.xml" />
+    <tool file="fastx_toolkit/fastx_reverse_complement.xml" />
+    <tool file="fastx_toolkit/fastx_artifacts_filter.xml" />
+    <tool file="fastx_toolkit/fastq_quality_filter.xml" />
+    <tool file="fastx_toolkit/fastx_collapser.xml" />
+    <tool file="fastx_toolkit/fastx_barcode_splitter.xml" />
+  </section>

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/static/Makefile.am Thu Aug 14 04:52:17 2014 -0400

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/static/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,475 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+subdir = galaxy/static\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+SOURCES =\n+DIST_SOURCES =\n+RECURSIVE_TARGETS = all-recursive check-recursive dvi-recursive \\\n+\thtml-recursive info-recursive install-data-recursive \\\n+\tinstall-dvi-recursive install-exec-recursive \\\n+\tinstall-html-recursive install-info-recursive \\\n+\tinstall-pdf-recursive install-ps-recursive install-recursive \\\n+\tinstallcheck-recursive installdirs-recursive pdf-recursive \\\n+\tps-recursive uninstall-recursive\n+RECURSIVE_CLEAN_TARGETS = mostlyclean-recursive clean-recursive\t\\\n+ distclean-recursive maintainer-clean-recursive\n+ETAGS = etags\n+CTAGS = ctags\n+DIST_SUBDIRS = $(SUBDIRS)\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARATOR@\n+RANLIB = @RANLIB@\n+SET_MAKE = @SET_MAKE@\n+SHELL = @SHELL@\n+STRIP = @STRIP@\n+VERSION = @VERSION@\n+abs_builddir = @abs_builddir@\n+abs_srcdir = @abs_srcdir@\n+abs_top_builddir = @abs_top_builddir@\n+abs_top_srcdir = @abs_top_srcdir@\n+ac_ct_CC = @ac_ct_CC@\n+ac_'..b'ile; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+\tlist=\'$(DIST_SUBDIRS)\'; for subdir in $$list; do \\\n+\t if test "$$subdir" = .; then :; else \\\n+\t test -d "$(distdir)/$$subdir" \\\n+\t || $(MKDIR_P) "$(distdir)/$$subdir" \\\n+\t || exit 1; \\\n+\t distdir=`$(am__cd) $(distdir) && pwd`; \\\n+\t top_distdir=`$(am__cd) $(top_distdir) && pwd`; \\\n+\t (cd $$subdir && \\\n+\t $(MAKE) $(AM_MAKEFLAGS) \\\n+\t top_distdir="$$top_distdir" \\\n+\t distdir="$$distdir/$$subdir" \\\n+\t\tam__remove_distdir=: \\\n+\t\tam__skip_length_check=: \\\n+\t distdir) \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-recursive\n+all-am: Makefile\n+installdirs: installdirs-recursive\n+installdirs-am:\n+install: install-recursive\n+install-exec: install-exec-recursive\n+install-data: install-data-recursive\n+uninstall: uninstall-recursive\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-recursive\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-recursive\n+\n+clean-am: clean-generic mostlyclean-am\n+\n+distclean: distclean-recursive\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-generic distclean-tags\n+\n+dvi: dvi-recursive\n+\n+dvi-am:\n+\n+html: html-recursive\n+\n+info: info-recursive\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-recursive\n+\n+install-exec-am:\n+\n+install-html: install-html-recursive\n+\n+install-info: install-info-recursive\n+\n+install-man:\n+\n+install-pdf: install-pdf-recursive\n+\n+install-ps: install-ps-recursive\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-recursive\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-recursive\n+\n+mostlyclean-am: mostlyclean-generic\n+\n+pdf: pdf-recursive\n+\n+pdf-am:\n+\n+ps: ps-recursive\n+\n+ps-am:\n+\n+uninstall-am:\n+\n+.MAKE: $(RECURSIVE_CLEAN_TARGETS) $(RECURSIVE_TARGETS) install-am \\\n+\tinstall-strip\n+\n+.PHONY: $(RECURSIVE_CLEAN_TARGETS) $(RECURSIVE_TARGETS) CTAGS GTAGS \\\n+\tall all-am check check-am clean clean-generic ctags \\\n+\tctags-recursive distclean distclean-generic distclean-tags \\\n+\tdistdir dvi dvi-am html html-am info info-am install \\\n+\tinstall-am install-data install-data-am install-dvi \\\n+\tinstall-dvi-am install-exec install-exec-am install-html \\\n+\tinstall-html-am install-info install-info-am install-man \\\n+\tinstall-pdf install-pdf-am install-ps install-ps-am \\\n+\tinstall-strip installcheck installcheck-am installdirs \\\n+\tinstalldirs-am maintainer-clean maintainer-clean-generic \\\n+\tmostlyclean mostlyclean-generic pdf pdf-am ps ps-am tags \\\n+\ttags-recursive uninstall uninstall-am\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/static/fastx_icons/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,22 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+EXTRA_DIST = fastx_clipper_example.png \
+      fastx_clipper_illustration.png \
+      barcode_splitter_output_example.png \
+      fastq_nucleotides_distribution_1.png \
+      fastq_nucleotides_distribution_2.png \
+      fastq_nucleotides_distribution_3.png \
+      fastq_nucleotides_distribution_4.png \
+      fasta_clipping_histogram_1.png \
+      fasta_clipping_histogram_2.png \
+      fastq_quality_boxplot_1.png \
+      fastq_quality_boxplot_2.png \
+      fastq_quality_boxplot_3.png

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/static/fastx_icons/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,329 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+subdir = galaxy/static/fastx_icons\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+SOURCES =\n+DIST_SOURCES =\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARATOR@\n+RANLIB = @RANLIB@\n+SET_MAKE = @SET_MAKE@\n+SHELL = @SHELL@\n+STRIP = @STRIP@\n+VERSION = @VERSION@\n+abs_builddir = @abs_builddir@\n+abs_srcdir = @abs_srcdir@\n+abs_top_builddir = @abs_top_builddir@\n+abs_top_srcdir = @abs_top_srcdir@\n+ac_ct_CC = @ac_ct_CC@\n+ac_ct_CXX = @ac_ct_CXX@\n+am__include = @am__include@\n+am__leading_dot = @am__leading_dot@\n+am__quote = @am__quote@\n+am__tar = @am__tar@\n+am__untar = @am__untar@\n+bindir = @bindir@\n+build = @build@\n+build_alias = @build_alias@\n+build_cpu = @build_cpu@\n+build_os = @build_os@\n+build_vendor = @build_vendor@\n+builddir = @builddir@\n+canonical_host_type = @canonical_host_type@\n+datadir = @datadir@\n+datarootdir = @datarootdir@\n+docdir = @docdir@\n+dvidir = @dvidir@\n+exec_prefix = @exec_prefix@\n+host = @host@\n+host_alias = @host_alias@\n+host_cpu = @host_c'..b'\\\n+\t *config.status*) \\\n+\t cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \\\n+\t *) \\\n+\t echo \' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)\'; \\\n+\t cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \\\n+\tesac;\n+\n+$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)\n+\tcd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh\n+\n+$(top_srcdir)/configure: $(am__configure_deps)\n+\tcd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh\n+$(ACLOCAL_M4): $(am__aclocal_m4_deps)\n+\tcd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh\n+tags: TAGS\n+TAGS:\n+\n+ctags: CTAGS\n+CTAGS:\n+\n+\n+distdir: $(DISTFILES)\n+\t@srcdirstrip=`echo "$(srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\ttopsrcdirstrip=`echo "$(top_srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\tlist=\'$(DISTFILES)\'; \\\n+\t dist_files=`for file in $$list; do echo $$file; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-am\n+all-am: Makefile\n+installdirs:\n+install: install-am\n+install-exec: install-exec-am\n+install-data: install-data-am\n+uninstall: uninstall-am\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-am\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-am\n+\n+clean-am: clean-generic mostlyclean-am\n+\n+distclean: distclean-am\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-generic\n+\n+dvi: dvi-am\n+\n+dvi-am:\n+\n+html: html-am\n+\n+info: info-am\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-am\n+\n+install-exec-am:\n+\n+install-html: install-html-am\n+\n+install-info: install-info-am\n+\n+install-man:\n+\n+install-pdf: install-pdf-am\n+\n+install-ps: install-ps-am\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-am\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-am\n+\n+mostlyclean-am: mostlyclean-generic\n+\n+pdf: pdf-am\n+\n+pdf-am:\n+\n+ps: ps-am\n+\n+ps-am:\n+\n+uninstall-am:\n+\n+.MAKE: install-am install-strip\n+\n+.PHONY: all all-am check check-am clean clean-generic distclean \\\n+\tdistclean-generic distdir dvi dvi-am html html-am info info-am \\\n+\tinstall install-am install-data install-data-am install-dvi \\\n+\tinstall-dvi-am install-exec install-exec-am install-html \\\n+\tinstall-html-am install-info install-info-am install-man \\\n+\tinstall-pdf install-pdf-am install-ps install-ps-am \\\n+\tinstall-strip installcheck installcheck-am installdirs \\\n+\tmaintainer-clean maintainer-clean-generic mostlyclean \\\n+\tmostlyclean-generic pdf pdf-am ps ps-am uninstall uninstall-am\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/barcode_splitter_output_example.png

Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/barcode_splitter_output_example.png has changed

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fasta_clipping_histogram_1.png

Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fasta_clipping_histogram_1.png has changed

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fasta_clipping_histogram_2.png

Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fasta_clipping_histogram_2.png has changed

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_nucleotides_distribution_1.png

Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_nucleotides_distribution_1.png has changed

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_nucleotides_distribution_2.png

Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_nucleotides_distribution_2.png has changed

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_nucleotides_distribution_3.png

Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_nucleotides_distribution_3.png has changed

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_nucleotides_distribution_4.png

Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_nucleotides_distribution_4.png has changed

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_quality_boxplot_1.png

Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_quality_boxplot_1.png has changed

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_quality_boxplot_2.png

Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_quality_boxplot_2.png has changed

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_quality_boxplot_3.png

Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastq_quality_boxplot_3.png has changed

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastx_clipper_example.png

Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastx_clipper_example.png has changed

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastx_clipper_illustration.png

Binary file fastx_toolkit-0.0.6/galaxy/static/fastx_icons/fastx_clipper_illustration.png has changed

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,45 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+EXTRA_DIST = fastq_qual_conv1a.out \
+ fastq_qual_conv1.fastq \
+ fastq_qual_conv1.out \
+ fastq_qual_conv2.fastq \
+ fastq_qual_conv2n.out \
+ fastq_qual_conv2.out \
+ fastq_qual_filter1a.out \
+ fastq_qual_filter1b.out \
+ fastq_qual_filter1.fastq \
+ fastq_stats1.fastq \
+ fastq_stats1.out \
+ fastq_to_fasta1a.out \
+ fastq_to_fasta1b.out \
+ fastq_to_fasta1.fastq \
+ fastx_artifacts1.fasta \
+ fastx_artifacts1.out \
+ fastx_artifacts2.fastq \
+ fastx_artifacts2.out \
+ fastx_clipper1a.out \
+ fastx_clipper1.fastq \
+ fastx_rev_comp1.fasta \
+ fastx_rev_comp2.fastq \
+ fastx_reverse_complement1.out \
+ fastx_reverse_complement2.out \
+ fastx_trimmer1.fasta \
+ fastx_trimmer1.out \
+ fastx_trimmer2.fastq \
+ fastx_trimmer2.out \
+ fasta_collapser1.fasta \
+ fasta_collapser1.out \
+ fastx_barcode_splitter1.fastq \
+ fastx_barcode_splitter1.txt \
+ fastx_barcode_splitter1.out
+
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,350 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+subdir = galaxy/test-data\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+SOURCES =\n+DIST_SOURCES =\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARATOR@\n+RANLIB = @RANLIB@\n+SET_MAKE = @SET_MAKE@\n+SHELL = @SHELL@\n+STRIP = @STRIP@\n+VERSION = @VERSION@\n+abs_builddir = @abs_builddir@\n+abs_srcdir = @abs_srcdir@\n+abs_top_builddir = @abs_top_builddir@\n+abs_top_srcdir = @abs_top_srcdir@\n+ac_ct_CC = @ac_ct_CC@\n+ac_ct_CXX = @ac_ct_CXX@\n+am__include = @am__include@\n+am__leading_dot = @am__leading_dot@\n+am__quote = @am__quote@\n+am__tar = @am__tar@\n+am__untar = @am__untar@\n+bindir = @bindir@\n+build = @build@\n+build_alias = @build_alias@\n+build_cpu = @build_cpu@\n+build_os = @build_os@\n+build_vendor = @build_vendor@\n+builddir = @builddir@\n+canonical_host_type = @canonical_host_type@\n+datadir = @datadir@\n+datarootdir = @datarootdir@\n+docdir = @docdir@\n+dvidir = @dvidir@\n+exec_prefix = @exec_prefix@\n+host = @host@\n+host_alias = @host_alias@\n+host_cpu = @host_cpu@\n+host'..b'\\\n+\t *config.status*) \\\n+\t cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \\\n+\t *) \\\n+\t echo \' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)\'; \\\n+\t cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \\\n+\tesac;\n+\n+$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)\n+\tcd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh\n+\n+$(top_srcdir)/configure: $(am__configure_deps)\n+\tcd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh\n+$(ACLOCAL_M4): $(am__aclocal_m4_deps)\n+\tcd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh\n+tags: TAGS\n+TAGS:\n+\n+ctags: CTAGS\n+CTAGS:\n+\n+\n+distdir: $(DISTFILES)\n+\t@srcdirstrip=`echo "$(srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\ttopsrcdirstrip=`echo "$(top_srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\tlist=\'$(DISTFILES)\'; \\\n+\t dist_files=`for file in $$list; do echo $$file; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-am\n+all-am: Makefile\n+installdirs:\n+install: install-am\n+install-exec: install-exec-am\n+install-data: install-data-am\n+uninstall: uninstall-am\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-am\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-am\n+\n+clean-am: clean-generic mostlyclean-am\n+\n+distclean: distclean-am\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-generic\n+\n+dvi: dvi-am\n+\n+dvi-am:\n+\n+html: html-am\n+\n+info: info-am\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-am\n+\n+install-exec-am:\n+\n+install-html: install-html-am\n+\n+install-info: install-info-am\n+\n+install-man:\n+\n+install-pdf: install-pdf-am\n+\n+install-ps: install-ps-am\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-am\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-am\n+\n+mostlyclean-am: mostlyclean-generic\n+\n+pdf: pdf-am\n+\n+pdf-am:\n+\n+ps: ps-am\n+\n+ps-am:\n+\n+uninstall-am:\n+\n+.MAKE: install-am install-strip\n+\n+.PHONY: all all-am check check-am clean clean-generic distclean \\\n+\tdistclean-generic distdir dvi dvi-am html html-am info info-am \\\n+\tinstall install-am install-data install-data-am install-dvi \\\n+\tinstall-dvi-am install-exec install-exec-am install-html \\\n+\tinstall-html-am install-info install-info-am install-man \\\n+\tinstall-pdf install-pdf-am install-ps install-ps-am \\\n+\tinstall-strip installcheck installcheck-am installdirs \\\n+\tmaintainer-clean maintainer-clean-generic mostlyclean \\\n+\tmostlyclean-generic pdf pdf-am ps ps-am uninstall uninstall-am\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fasta_collapser1.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fasta_collapser1.fasta Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,84 @@
+>1
+TGTATTTACAATGACTAGAAA
+>2
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>3
+AGTACAAGGACATGC
+>4
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>5
+AGTACAAGGACATGC
+>6
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>7
+AGTACAAGGACATGC
+>8
+AGTACAAGGACATGC
+>9
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>10
+AGTACAAGGACATGC
+>11
+AGTACAAGGACATGC
+>12
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>13
+CGATTGCCGAAGTCTACCA
+>14
+AGTACAAGGACATGC
+>15
+CCTTGTAGTGGATTCTGATGA
+>16
+AGTACAAGGACATGC
+>17
+AGTACAAGGACATGC
+>18
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>19
+AGTACAAGGACATGC
+>20
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>21
+AGTACAAGGACATGC
+>22
+AGTACAAGGACATGC
+>23
+CTGCTGCGATCGGTGTGC
+>24
+AGTACAAGGACATGC
+>25
+ACCATTCGAGCATAC
+>26
+AGTACAAGGACATGC
+>27
+TCAAATTCTAGATTTTTACGG
+>28
+AGTACAAGGACATGC
+>29
+TGATTTCCAGAGCCAAT
+>30
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>31
+TTACCTCACGATATTGTAATA
+>32
+ATGACTTCATCGTCCACCCTTTAGAACT
+>33
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>34
+TTCAACGCCGCCGTGAAC
+>35
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>36
+CTGCTGCGATCGGTGTGC
+>37
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>38
+TTCAACGCCGCCGTGAAC
+>39
+TTCAACGCCGCCGTGAAC
+>40
+CTGCTGCGATCGGTGTGC
+>41
+TTCAACGCCGCCGTGAAC
+>42
+TTCAACGCCGCCGTGAAC

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fasta_collapser1.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fasta_collapser1.out Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,24 @@
+>1-3
+CTGCTGCGATCGGTGTGC
+>2-1
+TTACCTCACGATATTGTAATA
+>3-1
+CCTTGTAGTGGATTCTGATGA
+>4-1
+TGATTTCCAGAGCCAAT
+>5-11
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>6-1
+ACCATTCGAGCATAC
+>7-1
+CGATTGCCGAAGTCTACCA
+>8-5
+TTCAACGCCGCCGTGAAC
+>9-1
+ATGACTTCATCGTCCACCCTTTAGAACT
+>10-15
+AGTACAAGGACATGC
+>11-1
+TCAAATTCTAGATTTTTACGG
+>12-1
+TGTATTTACAATGACTAGAAA

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv1.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv1.fastq Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,36 @@
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GTACGCATGACCGAACCCCCCNCCCCCCCCCATGTC
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaaabbXEZabaaaaaaaa]]`
+@CSHL_3_FC042AGLLWW:1:2:7:33
+CAATGCCTCTACTCATCCCAGTAGAGGCCCGTGGCC
++CSHL_3_FC042AGLLWW:1:2:7:33
+Waaa^aZaaW^U_XaWaa\WMEP^KEZXRPEEEGaa
+@CSHL_3_FC042AGLLWW:1:2:7:169
+GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCCC
++CSHL_3_FC042AGLLWW:1:2:7:169
+a_M^a\Uaaa_M_aaaaaaaaaaaaaaaV\ZUGUUR
+@CSHL_3_FC042AGLLWW:1:2:7:1436
+AATTATTTATTAAATTTTAATAATATGGGAGACACT
++CSHL_3_FC042AGLLWW:1:2:7:1436
+a^aaaaaaaaaaaaaaa_U`aaaaa_S_aaaaaVV[
+@CSHL_3_FC042AGLLWW:1:2:7:292
+GGAGAAATACACACACACACTCATCGTCGTCCCCCG
++CSHL_3_FC042AGLLWW:1:2:7:292
+babaaaaaaaUMaaaaaaaaaaa\XEUUEP_]UERE
+@CSHL_3_FC042AGLLWW:1:2:7:1819
+AATTCAAACCACCCCAACCCACACACAGAGATACCC
++CSHL_3_FC042AGLLWW:1:2:7:1819
+a\\QVVVLaaLOEXUWUUEKUULEMUEUUKULIQMU
+@CSHL_3_FC042AGLLWW:1:2:7:1875
+GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCCC
++CSHL_3_FC042AGLLWW:1:2:7:1875
+aaaaaaaaaXUXXEXaaaaa`_ZaaaaaaaaaXEXU
+@CSHL_3_FC042AGLLWW:1:2:8:624
+ACTGGCGCTGTGGAGAGTGTCACACCCCCCCCCCCC
++CSHL_3_FC042AGLLWW:1:2:8:624
+aa[S^`X`aa_]]OOXMU^_[MU_aaaaaaaaaaaa
+@CSHL_3_FC042AGLLWW:1:2:8:250
+TGCCGCGCACACTGATGACGCGGCCGCTCGCGCTCT
++CSHL_3_FC042AGLLWW:1:2:8:250
+aaaaaaaa^aaaaaabbb[KXPEU[RXZ^JUKRKXE

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv1.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv1.out Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,36 @@
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GTACGCATGACCGAACCCCCCNCCCCCCCCCATGTC
++CSHL_3_FC042AGLLWW:1:2:7:203
+33 33 34 30 22 30 33 21 29 32 33 33 30 33 26 33 33 33 34 34 24 5 26 33 34 33 33 33 33 33 33 33 33 29 29 32
+@CSHL_3_FC042AGLLWW:1:2:7:33
+CAATGCCTCTACTCATCCCAGTAGAGGCCCGTGGCC
++CSHL_3_FC042AGLLWW:1:2:7:33
+23 33 33 33 30 33 26 33 33 23 30 21 31 24 33 23 33 33 28 23 13 5 16 30 11 5 26 24 18 16 5 5 5 7 33 33
+@CSHL_3_FC042AGLLWW:1:2:7:169
+GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCCC
++CSHL_3_FC042AGLLWW:1:2:7:169
+33 31 13 30 33 28 21 33 33 33 31 13 31 33 33 33 33 33 33 33 33 33 33 33 33 33 33 33 22 28 26 21 7 21 21 18
+@CSHL_3_FC042AGLLWW:1:2:7:1436
+AATTATTTATTAAATTTTAATAATATGGGAGACACT
++CSHL_3_FC042AGLLWW:1:2:7:1436
+33 30 33 33 33 33 33 33 33 33 33 33 33 33 33 33 33 31 21 32 33 33 33 33 33 31 19 31 33 33 33 33 33 22 22 27
+@CSHL_3_FC042AGLLWW:1:2:7:292
+GGAGAAATACACACACACACTCATCGTCGTCCCCCG
++CSHL_3_FC042AGLLWW:1:2:7:292
+34 33 34 33 33 33 33 33 33 33 21 13 33 33 33 33 33 33 33 33 33 33 33 28 24 5 21 21 5 16 31 29 21 5 18 5
+@CSHL_3_FC042AGLLWW:1:2:7:1819
+AATTCAAACCACCCCAACCCACACACAGAGATACCC
++CSHL_3_FC042AGLLWW:1:2:7:1819
+33 28 28 17 22 22 22 12 33 33 12 15 5 24 21 23 21 21 5 11 21 21 12 5 13 21 5 21 21 11 21 12 9 17 13 21
+@CSHL_3_FC042AGLLWW:1:2:7:1875
+GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCCC
++CSHL_3_FC042AGLLWW:1:2:7:1875
+33 33 33 33 33 33 33 33 33 24 21 24 24 5 24 33 33 33 33 33 32 31 26 33 33 33 33 33 33 33 33 33 24 5 24 21
+@CSHL_3_FC042AGLLWW:1:2:8:624
+ACTGGCGCTGTGGAGAGTGTCACACCCCCCCCCCCC
++CSHL_3_FC042AGLLWW:1:2:8:624
+33 33 27 19 30 32 24 32 33 33 31 29 29 15 15 24 13 21 30 31 27 13 21 31 33 33 33 33 33 33 33 33 33 33 33 33
+@CSHL_3_FC042AGLLWW:1:2:8:250
+TGCCGCGCACACTGATGACGCGGCCGCTCGCGCTCT
++CSHL_3_FC042AGLLWW:1:2:8:250
+33 33 33 33 33 33 33 33 30 33 33 33 33 33 33 34 34 34 27 11 24 16 5 21 27 18 24 26 30 10 21 11 18 11 24 5

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv1a.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv1a.out Thu Aug 14 04:52:17 2014 -0400

[

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv2.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv2.fastq Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,60 @@
+@CSHL_3_FC0420AGLLKK:2:1:233:1674
+GTTAGAGGGAATACACCCACTCTGTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:233:1674
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 32 40 40 40 40 16 20 25 9 21 37 40 40 16 29 26 30
+@CSHL_3_FC0420AGLLKK:2:1:136:448
+GTTCTCAGGACCCCTTCAGTAGTNGGCACCATCAA
++CSHL_3_FC0420AGLLKK:2:1:136:448
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 -5 13 17 28 40 40 8 17 27 8 13 10
+@CSHL_3_FC0420AGLLKK:2:1:237:1037
+GTGATAGATTGTCTTGTTGTTCTGTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:237:1037
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 4 40 40 26 35 40 38 40 6 40 40 0 3 26 32 27 14 11 26 11
+@CSHL_3_FC0420AGLLKK:2:1:1601:1525
+AAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAA
++CSHL_3_FC0420AGLLKK:2:1:1601:1525
+40 40 40 40 40 40 40 40 40 40 40 40 35 40 40 12 40 40 30 30 40 40 40 12 36 23 17 24 18 22 25 15 10 34 14
+@CSHL_3_FC0420AGLLKK:2:1:1805:1464
+GATGCGTTCGAGATGGGTGCGCTGTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:1805:1464
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 16 23 28 40 21 40 9 37 13 20 21 7 11 14 14 6 23 10
+@CSHL_3_FC0420AGLLKK:2:1:1713:528
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
++CSHL_3_FC0420AGLLKK:2:1:1713:528
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 32 40 12 38 15 22 20 17 14 12 10 7 22 11
+@CSHL_3_FC0420AGLLKK:2:1:126:1087
+GAGATATTCGAATGCATCATCAGATGGCACCATCA
++CSHL_3_FC0420AGLLKK:2:1:126:1087
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 25 40 40 40 40 40 40 40 31 40 40 11 10 23 40 13 12 17 37 17 22
+@CSHL_3_FC0420AGLLKK:2:1:1488:1323
+GTTTTTTCCCCTAATCTGAGTCTGTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:1488:1323
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 39 22 31 40 40 12 29 22 0 7 12 8 18 7 3 18 9
+@CSHL_3_FC0420AGLLKK:2:1:913:199
+GTTCAGTGTTGGTGCACTGTGTTNTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:913:199
+40 40 39 40 40 40 40 40 40 40 40 40 4 40 40 24 34 20 33 21 36 32 40 -5 40 13 21 21 26 17 18 25 14 25 21
+@CSHL_3_FC0420AGLLKK:2:1:1236:1157
+AAAAAAAAAAAAAAAACAAAAAAAAAAAAAACAAA
++CSHL_3_FC0420AGLLKK:2:1:1236:1157
+40 40 40 40 40 40 40 40 40 40 40 40 40 35 40 40 40 40 40 33 40 37 40 40 40 18 16 20 23 22 31 26 10 22 19
+@CSHL_3_FC0420AGLLKK:2:1:928:765
+GTTTTCAGTTCGAGGTTCGTGCTNTAGGCATTATC
++CSHL_3_FC0420AGLLKK:2:1:928:765
+40 40 40 40 40 40 40 40 40 40 40 40 40 25 27 40 37 35 27 40 40 17 40 -5 36 11 19 15 19 16 11 12 12 23 11
+@CSHL_3_FC0420AGLLKK:2:1:727:1020
+GTAATATAGTTGATAAGAATCTGCAGAGAGAATCA
++CSHL_3_FC0420AGLLKK:2:1:727:1020
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 30 40 40 24 18 38 33 26 16 23 22 16 18
+@CSHL_3_FC0420AGLLKK:2:1:758:1799
+GTAGAGACCCCCTAATAGAGTCTGTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:758:1799
+40 40 40 40 40 40 40 40 35 40 39 40 40 27 20 40 17 34 15 40 40 40 40 15 28 17 4 12 10 10 18 14 3 14 11
+@CSHL_3_FC0420AGLLKK:2:1:1818:550
+AAAAAAAAAAAAAAAACAAAAACAAAAAAAACAAA
++CSHL_3_FC0420AGLLKK:2:1:1818:550
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 36 32 40 33 40 40 38 37 40 28 29 27 22 13 20 19 17 17 13 33 18
+@CSHL_3_FC0420AGLLKK:2:1:1764:391
+CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
++CSHL_3_FC0420AGLLKK:2:1:1764:391
+40 40 40 40 40 40 40 40 40 40 40 33 40 40 40 40 40 24 40 40 40 40 40 12 40 24 14 9 22 15 29 18 11 40 22

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv2.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv2.out Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,60 @@
+@CSHL_3_FC0420AGLLKK:2:1:233:1674
+GTTAGAGGGAATACACCCACTCTGTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:233:1674
+hhhhhhhhhhhhhhhhhh`hhhhPTYIUehhP]Z^
+@CSHL_3_FC0420AGLLKK:2:1:136:448
+GTTCTCAGGACCCCTTCAGTAGTNGGCACCATCAA
++CSHL_3_FC0420AGLLKK:2:1:136:448
+hhhhhhhhhhhhhhhhhhhhhhh;MQ\hhHQ[HMJ
+@CSHL_3_FC0420AGLLKK:2:1:237:1037
+GTGATAGATTGTCTTGTTGTTCTGTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:237:1037
+hhhhhhhhhhhhhhhDhhZchfhFhh@CZ`[NKZK
+@CSHL_3_FC0420AGLLKK:2:1:1601:1525
+AAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAA
++CSHL_3_FC0420AGLLKK:2:1:1601:1525
+hhhhhhhhhhhhchhLhh^^hhhLdWQXRVYOJbN
+@CSHL_3_FC0420AGLLKK:2:1:1805:1464
+GATGCGTTCGAGATGGGTGCGCTGTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:1805:1464
+hhhhhhhhhhhhhhhhhPW\hUhIeMTUGKNNFWJ
+@CSHL_3_FC0420AGLLKK:2:1:1713:528
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
++CSHL_3_FC0420AGLLKK:2:1:1713:528
+hhhhhhhhhhhhhhhhhhhhh`hLfOVTQNLJGVK
+@CSHL_3_FC0420AGLLKK:2:1:126:1087
+GAGATATTCGAATGCATCATCAGATGGCACCATCA
++CSHL_3_FC0420AGLLKK:2:1:126:1087
+hhhhhhhhhhhhhhYhhhhhhh_hhKJWhMLQeQV
+@CSHL_3_FC0420AGLLKK:2:1:1488:1323
+GTTTTTTCCCCTAATCTGAGTCTGTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:1488:1323
+hhhhhhhhhhhhhhhhhhgV_hhL]V@GLHRGCRI
+@CSHL_3_FC0420AGLLKK:2:1:913:199
+GTTCAGTGTTGGTGCACTGTGTTNTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:913:199
+hhghhhhhhhhhDhhXbTaUd`h;hMUUZQRYNYU
+@CSHL_3_FC0420AGLLKK:2:1:1236:1157
+AAAAAAAAAAAAAAAACAAAAAAAAAAAAAACAAA
++CSHL_3_FC0420AGLLKK:2:1:1236:1157
+hhhhhhhhhhhhhchhhhhahehhhRPTWV_ZJVS
+@CSHL_3_FC0420AGLLKK:2:1:928:765
+GTTTTCAGTTCGAGGTTCGTGCTNTAGGCATTATC
++CSHL_3_FC0420AGLLKK:2:1:928:765
+hhhhhhhhhhhhhY[hec[hhQh;dKSOSPKLLWK
+@CSHL_3_FC0420AGLLKK:2:1:727:1020
+GTAATATAGTTGATAAGAATCTGCAGAGAGAATCA
++CSHL_3_FC0420AGLLKK:2:1:727:1020
+hhhhhhhhhhhhhhhhhhhhhh^hhXRfaZPWVPR
+@CSHL_3_FC0420AGLLKK:2:1:758:1799
+GTAGAGACCCCCTAATAGAGTCTGTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:758:1799
+hhhhhhhhchghh[ThQbOhhhhO\QDLJJRNCNK
+@CSHL_3_FC0420AGLLKK:2:1:1818:550
+AAAAAAAAAAAAAAAACAAAAACAAAAAAAACAAA
++CSHL_3_FC0420AGLLKK:2:1:1818:550
+hhhhhhhhhhhhhhd`hahhfeh\][VMTSQQMaR
+@CSHL_3_FC0420AGLLKK:2:1:1764:391
+CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
++CSHL_3_FC0420AGLLKK:2:1:1764:391
+hhhhhhhhhhhahhhhhXhhhhhLhXNIVO]RKhV

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv2n.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_conv2n.out Thu Aug 14 04:52:17 2014 -0400

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_filter1.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_filter1.fastq Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,36 @@
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GTACGCATGACCGAACCCCCCNCCCCCCAATTGGTT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaaaaaaaaabaaaaaaaa]]`
+@CSHL_3_FC042AGLLWW:1:2:7:33
+CAATGCCTCCAATTGGTTAATCCCCCTATATATACT
++CSHL_3_FC042AGLLWW:1:2:7:33
+aaaaaaaaaW^U_XaWaa\WMEP^KEZXRPEEEGaa
+@CSHL_3_FC042AGLLWW:1:2:7:169
+GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCCC
++CSHL_3_FC042AGLLWW:1:2:7:169
+a_M^a\Uaaa_M_aaaZZZZZZUZUZaaV\ZUGUUR
+@CSHL_3_FC042AGLLWW:1:2:7:1436
+AATTATTTATTAAATTTTAATAATATGGGAGACACT
++CSHL_3_FC042AGLLWW:1:2:7:1436
+a^aaaaaaaaaaaaaaa_U`aaaaa_S_aaaaaVV[
+@CSHL_3_FC042AGLLWW:1:2:7:292
+GGAGAAATACACACAATTGGTTAATCCCCCTATATA
++CSHL_3_FC042AGLLWW:1:2:7:292
+babaaaaaaaUMaaaaaaaaaaa\XEUUEP_]UERE
+@CSHL_3_FC042AGLLWW:1:2:7:1819
+AATTCAAACCACCCCAACCCACACACAGAGATACAA
++CSHL_3_FC042AGLLWW:1:2:7:1819
+a\\QVVVLaaLOEXUWUUEKUULEMUEUUKULIQMU
+@CSHL_3_FC042AGLLWW:1:2:7:1875
+GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCCC
++CSHL_3_FC042AGLLWW:1:2:7:1875
+aaaaaaaaaXUXXEXaaaaa`_ZaaaaaaaaaXEXU
+@CSHL_3_FC042AGLLWW:1:2:8:624
+ACTGCAATTGGTTAATCCCCCTATATAGCGCTGTGG
++CSHL_3_FC042AGLLWW:1:2:8:624
+aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
+@CSHL_3_FC042AGLLWW:1:2:8:250
+TGCCGCGCACACTGATGCAATTGGTTAATCCCCCTA
++CSHL_3_FC042AGLLWW:1:2:8:250
+aaaaaaaa^aaaaaabbb[KXPEU[RXZ^JUKRKXE

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_filter1a.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_filter1a.out Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,4 @@
+@CSHL_3_FC042AGLLWW:1:2:8:624
+ACTGCAATTGGTTAATCCCCCTATATAGCGCTGTGG
++CSHL_3_FC042AGLLWW:1:2:8:624
+aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_filter1b.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_qual_filter1b.out Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,24 @@
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GTACGCATGACCGAACCCCCCNCCCCCCAATTGGTT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaaaaaaaaabaaaaaaaa]]`
+@CSHL_3_FC042AGLLWW:1:2:7:169
+GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCCC
++CSHL_3_FC042AGLLWW:1:2:7:169
+a_M^a\Uaaa_M_aaaZZZZZZUZUZaaV\ZUGUUR
+@CSHL_3_FC042AGLLWW:1:2:7:1436
+AATTATTTATTAAATTTTAATAATATGGGAGACACT
++CSHL_3_FC042AGLLWW:1:2:7:1436
+a^aaaaaaaaaaaaaaa_U`aaaaa_S_aaaaaVV[
+@CSHL_3_FC042AGLLWW:1:2:7:292
+GGAGAAATACACACAATTGGTTAATCCCCCTATATA
++CSHL_3_FC042AGLLWW:1:2:7:292
+babaaaaaaaUMaaaaaaaaaaa\XEUUEP_]UERE
+@CSHL_3_FC042AGLLWW:1:2:7:1875
+GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCCC
++CSHL_3_FC042AGLLWW:1:2:7:1875
+aaaaaaaaaXUXXEXaaaaa`_ZaaaaaaaaaXEXU
+@CSHL_3_FC042AGLLWW:1:2:8:624
+ACTGCAATTGGTTAATCCCCCTATATAGCGCTGTGG
++CSHL_3_FC042AGLLWW:1:2:8:624
+aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_stats1.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_stats1.fastq Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,36 @@
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GTACGCATGACCGAACCCCCCNCCCCCCAATTGGTT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaaabbXEZabaaaaaaaa]]`
+@CSHL_3_FC042AGLLWW:1:2:7:33
+CAATGCCTCCAATTGGTTAATCCCCCTATATATACT
++CSHL_3_FC042AGLLWW:1:2:7:33
+Waaa^aZaaW^U_XaWaa\WMEP^KEZXRPEEEGaa
+@CSHL_3_FC042AGLLWW:1:2:7:169
+GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCCC
++CSHL_3_FC042AGLLWW:1:2:7:169
+a_M^a\Uaaa_M_aaaaaaaaaaaaaaaV\ZUGUUR
+@CSHL_3_FC042AGLLWW:1:2:7:1436
+AATTATTTATTAAATTTTAATAATATGGGAGACACT
++CSHL_3_FC042AGLLWW:1:2:7:1436
+a^aaaaaaaaaaaaaaa_U`aaaaa_S_aaaaaVV[
+@CSHL_3_FC042AGLLWW:1:2:7:292
+GGAGAAATACACACAATTGGTTAATCCCCCTATATA
++CSHL_3_FC042AGLLWW:1:2:7:292
+babaaaaaaaUMaaaaaaaaaaa\XEUUEP_]UERE
+@CSHL_3_FC042AGLLWW:1:2:7:1819
+AATTCAAACCACCCCAACCCACACACAGAGATACAA
++CSHL_3_FC042AGLLWW:1:2:7:1819
+a\\QVVVLaaLOEXUWUUEKUULEMUEUUKULIQMU
+@CSHL_3_FC042AGLLWW:1:2:7:1875
+GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCCC
++CSHL_3_FC042AGLLWW:1:2:7:1875
+aaaaaaaaaXUXXEXaaaaa`_ZaaaaaaaaaXEXU
+@CSHL_3_FC042AGLLWW:1:2:8:624
+ACTGCAATTGGTTAATCCCCCTATATAGCGCTGTGG
++CSHL_3_FC042AGLLWW:1:2:8:624
+aa[S^`X`aa_]]OOXMU^_[MU_aaaaaaaaaaaa
+@CSHL_3_FC042AGLLWW:1:2:8:250
+TGCCGCGCACACTGATGCAATTGGTTAATCCCCCTA
++CSHL_3_FC042AGLLWW:1:2:8:250
+aaaaaaaa^aaaaaabbb[KXPEU[RXZ^JUKRKXE

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_stats1.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_stats1.out Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,37 @@
+column count min max sum mean Q1 med Q3 IQR lW rW A_Count C_Count G_Count T_Count N_Count
+1 9 23 34 288 32.00 33 33 33 0 33 33 3 1 4 1 0
+2 9 28 33 287 31.89 31 33 33 2 28 33 3 3 2 1 0
+3 9 13 34 268 29.78 28 33 33 5 21 34 5 1 0 3 0
+4 9 17 33 261 29.00 30 33 33 3 26 33 1 2 3 3 0
+5 9 22 33 269 29.89 30 33 33 3 26 33 3 3 3 0 0
+6 9 22 33 277 30.78 30 33 33 3 26 33 5 3 0 1 0
+7 9 21 33 258 28.67 24 33 33 9 21 33 4 1 3 1 0
+8 9 12 33 263 29.22 32 33 33 1 31 33 2 1 1 5 0
+9 9 29 33 290 32.22 33 33 33 0 33 33 3 3 2 1 0
+10 9 23 33 277 30.78 32 33 33 1 31 33 1 4 2 2 0
+11 9 12 33 245 27.22 21 31 33 12 12 33 5 2 1 1 0
+12 9 13 33 214 23.78 15 24 33 18 13 33 2 4 2 1 0
+13 9 5 33 249 27.67 29 31 33 4 23 33 2 1 1 5 0
+14 9 5 33 233 25.89 24 33 33 9 11 33 3 3 2 1 0
+15 9 15 33 251 27.89 24 33 33 9 15 33 5 1 1 2 0
+16 9 23 34 269 29.89 24 33 33 9 23 34 3 1 2 3 0
+17 9 13 34 266 29.56 33 33 33 0 33 33 2 3 1 3 0
+18 9 21 34 272 30.22 31 33 33 2 28 34 0 5 1 3 0
+19 9 5 34 244 27.11 27 30 33 6 18 34 4 4 1 0 0
+20 9 11 34 241 26.78 23 32 33 10 11 34 3 4 2 0 0
+21 9 13 33 240 26.67 24 27 33 9 13 33 1 4 0 4 0
+22 9 5 33 190 21.11 13 21 33 20 5 33 1 4 0 3 1
+23 9 5 33 205 22.78 16 26 33 17 5 33 4 4 1 0 0
+24 9 5 33 247 27.44 28 31 33 5 21 33 1 5 1 2 0
+25 9 11 34 241 26.78 24 33 33 9 11 34 3 4 0 2 0
+26 9 5 33 212 23.56 18 31 33 15 5 33 0 6 0 3 0
+27 9 5 33 227 25.22 21 26 33 12 5 33 3 4 1 1 0
+28 9 21 33 255 28.33 24 31 33 9 21 33 2 4 3 0 0
+29 9 5 33 228 25.33 21 30 33 12 5 33 2 4 1 2 0
+30 9 10 33 213 23.67 16 28 33 17 10 33 3 4 2 0 0
+31 9 5 33 236 26.22 21 31 33 12 5 33 1 4 1 3 0
+32 9 5 33 210 23.33 12 29 33 21 5 33 3 3 0 3 0
+33 9 5 33 183 20.33 9 21 33 24 5 33 1 4 2 2 0
+34 9 5 33 150 16.67 7 17 22 15 5 33 3 4 1 1 0
+35 9 13 33 217 24.11 21 24 29 8 13 33 1 4 1 3 0
+36 9 5 33 195 21.67 18 21 32 14 5 33 3 2 1 3 0

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_to_fasta1.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_to_fasta1.fastq Thu Aug 14 04:52:17 2014 -0400

[

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_to_fasta1a.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_to_fasta1a.out Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,16 @@
+>CSHL_3_FC042AGLLWW:1:2:7:33
+CAATGCCTCCAATTGGTTAATCCCCCTATATATACT
+>CSHL_3_FC042AGLLWW:1:2:7:169
+GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCCC
+>CSHL_3_FC042AGLLWW:1:2:7:1436
+AATTATTTATTAAATTTTAATAATATGGGAGACACT
+>CSHL_3_FC042AGLLWW:1:2:7:292
+GGAGAAATACACACAATTGGTTAATCCCCCTATATA
+>CSHL_3_FC042AGLLWW:1:2:7:1819
+AATTCAAACCACCCCAACCCACACACAGAGATACAA
+>CSHL_3_FC042AGLLWW:1:2:7:1875
+GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCCC
+>CSHL_3_FC042AGLLWW:1:2:8:624
+ACTGCAATTGGTTAATCCCCCTATATAGCGCTGTGG
+>CSHL_3_FC042AGLLWW:1:2:8:250
+TGCCGCGCACACTGATGCAATTGGTTAATCCCCCTA

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastq_to_fasta1b.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastq_to_fasta1b.out Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,18 @@
+>1
+GTACGCATGACCGAACCCCCCNCCCCCCAATTGGTT
+>2
+CAATGCCTCCAATTGGTTAATCCCCCTATATATACT
+>3
+GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCCC
+>4
+AATTATTTATTAAATTTTAATAATATGGGAGACACT
+>5
+GGAGAAATACACACAATTGGTTAATCCCCCTATATA
+>6
+AATTCAAACCACCCCAACCCACACACAGAGATACAA
+>7
+GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCCC
+>8
+ACTGCAATTGGTTAATCCCCCTATATAGCGCTGTGG
+>9
+TGCCGCGCACACTGATGCAATTGGTTAATCCCCCTA

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_artifacts1.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_artifacts1.fasta Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,24 @@
+>CSHL_3_FC0420AGLLKK:2:1:233:1674
+GTTAGAGGGAATACACCCACTCTGTAGGCACCATC
+>CSHL_3_FC0420AGLLKK:2:1:237:1037
+GTGATAGATTGTCTTGTTGTTCTGTAGGCACCATC
+>CSHL_3_FC0420AGLLKK:2:1:1601:1525
+AAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAA
+>CSHL_3_FC0420AGLLKK:2:1:1805:1464
+GATGCGTTCGAGATGGGTGCGCTGTAGGCACCATC
+>CSHL_3_FC0420AGLLKK:2:1:1713:528
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+>CSHL_3_FC0420AGLLKK:2:1:126:1087
+GAGATATTCGAATGCATCATCAGATGGCACCATCA
+>CSHL_3_FC0420AGLLKK:2:1:1488:1323
+GTTTTTTCCCCTAATCTGAGTCTGTAGGCACCATC
+>CSHL_3_FC0420AGLLKK:2:1:1236:1157
+AAAAAAAAAAAAAAAACAAAAAAAAAAAAAACAAA
+>CSHL_3_FC0420AGLLKK:2:1:727:1020
+GTAATATAGTTGATAAGAATCTGCAGAGAGAATCA
+>CSHL_3_FC0420AGLLKK:2:1:758:1799
+GTAGAGACCCCCTAATAGAGTCTGTAGGCACCATC
+>CSHL_3_FC0420AGLLKK:2:1:1818:550
+AAAAAAAAAAAAAAAACAAAAACAAAAAAAACAAA
+>CSHL_3_FC0420AGLLKK:2:1:1764:391
+CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_artifacts1.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_artifacts1.out Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,14 @@
+>CSHL_3_FC0420AGLLKK:2:1:233:1674
+GTTAGAGGGAATACACCCACTCTGTAGGCACCATC
+>CSHL_3_FC0420AGLLKK:2:1:237:1037
+GTGATAGATTGTCTTGTTGTTCTGTAGGCACCATC
+>CSHL_3_FC0420AGLLKK:2:1:1805:1464
+GATGCGTTCGAGATGGGTGCGCTGTAGGCACCATC
+>CSHL_3_FC0420AGLLKK:2:1:126:1087
+GAGATATTCGAATGCATCATCAGATGGCACCATCA
+>CSHL_3_FC0420AGLLKK:2:1:1488:1323
+GTTTTTTCCCCTAATCTGAGTCTGTAGGCACCATC
+>CSHL_3_FC0420AGLLKK:2:1:727:1020
+GTAATATAGTTGATAAGAATCTGCAGAGAGAATCA
+>CSHL_3_FC0420AGLLKK:2:1:758:1799
+GTAGAGACCCCCTAATAGAGTCTGTAGGCACCATC

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_artifacts2.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_artifacts2.fastq Thu Aug 14 04:52:17 2014 -0400

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_artifacts2.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_artifacts2.out Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,40 @@
+@CSHL_3_FC0420AGLLKK:2:1:233:1674
+GTTAGAGGGAATACACCCACTCTGTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:233:1674
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 32 40 40 40 40 16 20 25 9 21 37 40 40 16 29 26 30
+@CSHL_3_FC0420AGLLKK:2:1:136:448
+GTTCTCAGGACCCCTTCAGTAGTNGGCACCATCAA
++CSHL_3_FC0420AGLLKK:2:1:136:448
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 -5 13 17 28 40 40 8 17 27 8 13 10
+@CSHL_3_FC0420AGLLKK:2:1:237:1037
+GTGATAGATTGTCTTGTTGTTCTGTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:237:1037
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 4 40 40 26 35 40 38 40 6 40 40 0 3 26 32 27 14 11 26 11
+@CSHL_3_FC0420AGLLKK:2:1:1805:1464
+GATGCGTTCGAGATGGGTGCGCTGTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:1805:1464
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 16 23 28 40 21 40 9 37 13 20 21 7 11 14 14 6 23 10
+@CSHL_3_FC0420AGLLKK:2:1:126:1087
+GAGATATTCGAATGCATCATCAGATGGCACCATCA
++CSHL_3_FC0420AGLLKK:2:1:126:1087
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 25 40 40 40 40 40 40 40 31 40 40 11 10 23 40 13 12 17 37 17 22
+@CSHL_3_FC0420AGLLKK:2:1:1488:1323
+GTTTTTTCCCCTAATCTGAGTCTGTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:1488:1323
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 39 22 31 40 40 12 29 22 0 7 12 8 18 7 3 18 9
+@CSHL_3_FC0420AGLLKK:2:1:913:199
+GTTCAGTGTTGGTGCACTGTGTTNTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:913:199
+40 40 39 40 40 40 40 40 40 40 40 40 4 40 40 24 34 20 33 21 36 32 40 -5 40 13 21 21 26 17 18 25 14 25 21
+@CSHL_3_FC0420AGLLKK:2:1:928:765
+GTTTTCAGTTCGAGGTTCGTGCTNTAGGCATTATC
++CSHL_3_FC0420AGLLKK:2:1:928:765
+40 40 40 40 40 40 40 40 40 40 40 40 40 25 27 40 37 35 27 40 40 17 40 -5 36 11 19 15 19 16 11 12 12 23 11
+@CSHL_3_FC0420AGLLKK:2:1:727:1020
+GTAATATAGTTGATAAGAATCTGCAGAGAGAATCA
++CSHL_3_FC0420AGLLKK:2:1:727:1020
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 30 40 40 24 18 38 33 26 16 23 22 16 18
+@CSHL_3_FC0420AGLLKK:2:1:758:1799
+GTAGAGACCCCCTAATAGAGTCTGTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:758:1799
+40 40 40 40 40 40 40 40 35 40 39 40 40 27 20 40 17 34 15 40 40 40 40 15 28 17 4 12 10 10 18 14 3 14 11

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_barcode_splitter1.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_barcode_splitter1.fastq Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,168 @@
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GATCTAGTAGTAGTAGA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GATCTAGTAGTAGTAGA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GATCTAGTAGTAGTAGA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GATCTAGTAGTAGTAGA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GATCTAGTAGTAGTAGA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GGTCTAGTAGTAGTAGA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GGTCTTCTCTATGTACA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GGTCTGAGTATACACAT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GGTATTCTCTATGTACA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GGTATTCTCTATGTACA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GGTATTCTCTATGTACA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GGTACGAGTATACACAT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GGTACTCTCTATGTACA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GGTACGAGTATACACAT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+ATCGTTCTCTATGTACA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+ATCGTGAGTATACACAT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+ATCGTTCTCTATGTACA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+ATCGTGAGTATACACAT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+ATCTTTCTCTATGTACA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+ATCTTGAGTATACACAT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+ATCTTGAGTATACACAT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+ATCTTTCTCTATGTACA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+ATCTCGAGTATACACAT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+ATCTCGAGTATACACAT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+ATCTCTCTCTATGTACA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+ATCTCGAGTATACACAT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GGAATGAGTATACACAT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GGAATTCTCTATGTACA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GGAATGAGTATACACAT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GGAATTCTCTATGTACA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GGAATGAGTATACACAT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GGAATTCTCTATGTACA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GGAATGAGTATACACAT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GGAATTCTCTATGTACA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GGAATGAGTATACACAT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+TAGTTGAGTATACACAT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+TAGTTGAGTATACACAT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+TAGTTTCTCTATGTACA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+TAGTTTCTCTATGTACA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+TAGTTGAGTATACACAT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+TAGTTTCTCTATGTACA
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
+@CSHL_3_FC042AGLLWW:1:2:7:203
+TGTCTGAGTATACACAT
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaa
\ No newline at end of file

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_barcode_splitter1.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_barcode_splitter1.out Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,24 @@
+<html><body><table border=1>
+<tr><td>
+Barcode</td><td>Count</td><td>Location
+</td></tr>
+<tr><td>
+BC1</td><td>11</td><td><a href="http://tango.cshl.edu/barcode_splits/2009-01-19_1719__fastx_barcode_splitter1_fastq__BC1.txt">http://tango.cshl.edu/barcode_splits/2009-01-19_1719__fastx_barcode_splitter1_fastq__BC1.txt</a>
+</td></tr>
+<tr><td>
+BC2</td><td>12</td><td><a href="http://tango.cshl.edu/barcode_splits/2009-01-19_1719__fastx_barcode_splitter1_fastq__BC2.txt">http://tango.cshl.edu/barcode_splits/2009-01-19_1719__fastx_barcode_splitter1_fastq__BC2.txt</a>
+</td></tr>
+<tr><td>
+BC3</td><td>9</td><td><a href="http://tango.cshl.edu/barcode_splits/2009-01-19_1719__fastx_barcode_splitter1_fastq__BC3.txt">http://tango.cshl.edu/barcode_splits/2009-01-19_1719__fastx_barcode_splitter1_fastq__BC3.txt</a>
+</td></tr>
+<tr><td>
+BC4</td><td>1</td><td><a href="http://tango.cshl.edu/barcode_splits/2009-01-19_1719__fastx_barcode_splitter1_fastq__BC4.txt">http://tango.cshl.edu/barcode_splits/2009-01-19_1719__fastx_barcode_splitter1_fastq__BC4.txt</a>
+</td></tr>
+<tr><td>
+unmatched</td><td>9</td><td><a href="http://tango.cshl.edu/barcode_splits/2009-01-19_1719__fastx_barcode_splitter1_fastq__unmatched.txt">http://tango.cshl.edu/barcode_splits/2009-01-19_1719__fastx_barcode_splitter1_fastq__unmatched.txt</a>
+</td></tr>
+<tr><td>
+total</td><td>42
+</td></tr>
+<p><b>Copy these files to your local computer, as they will be soon deleted.</b>
+</table></body></html>

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_barcode_splitter1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_barcode_splitter1.txt Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,4 @@
+BC1 GATCT
+BC2 ATCGT
+BC3 GTGAT
+BC4 TGTCT
\ No newline at end of file

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_clipper1.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_clipper1.fastq Thu Aug 14 04:52:17 2014 -0400

[

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_clipper1a.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_clipper1a.out Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,20 @@
+@CSHL_3_FC042AGLLWW:1:2:7:203
+GTACGCATGACCGAACCCCCCNCCCCC
++CSHL_3_FC042AGLLWW:1:2:7:203
+aab^V^aU]`aa^aZaaabbXEZabaa
+@CSHL_3_FC042AGLLWW:1:2:7:169
+GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCC
++CSHL_3_FC042AGLLWW:1:2:7:169
+a_M^a\Uaaa_M_aaaaaaaaaaaaaaaV\ZUGUU
+@CSHL_3_FC042AGLLWW:1:2:7:1819
+AATTCAAACCACCCCAACCCACACACAGAGATA
++CSHL_3_FC042AGLLWW:1:2:7:1819
+a\\QVVVLaaLOEXUWUUEKUULEMUEUUKULI
+@CSHL_3_FC042AGLLWW:1:2:7:1875
+GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCC
++CSHL_3_FC042AGLLWW:1:2:7:1875
+aaaaaaaaaXUXXEXaaaaa`_ZaaaaaaaaaXEX
+@CSHL_3_FC042AGLLWW:1:2:8:250
+TGCCGCGCACACTGATG
++CSHL_3_FC042AGLLWW:1:2:8:250
+aaaaaaaa^aaaaaabb

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_rev_comp1.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_rev_comp1.fasta Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,4 @@
+>CSHL__2_FC042NGABCD:8:1:120:202
+ACGATAGATCGGAAGAGCTAGTATGCCGTTTTCTGC
+>CSHL__2_FC042NGABCD:8:1:103:1185
+ATCACGATAGATCGGCAGAGCTCGTTTACCGTCTTC

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_rev_comp2.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_rev_comp2.fastq Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,8 @@
+@CSHL__2_FC042NGABCD:8:1:120:202
+ACGATAGATCGGAAGAGCTAGTATGCCGTTTTCTGC
++CSHL__2_FC042NGABCD:8:1:120:202
+40 40 40 40 20 40 40 40 40 6 40 40 28 40 40 25 40 20 40 -1 30 40 14 27 40 8 1 3 7 -1 11 10 -1 21 10 8
+@CSHL__2_FC042NGABCD:8:1:103:1185
+ATCACGATAGATCGGCAGAGCTCGTTTACCGTCTTC
++CSHL__2_FC042NGABCD:8:1:103:1185
+40 40 40 40 40 35 33 31 40 40 40 32 30 22 40 -0 9 22 17 14 8 36 15 34 22 12 23 3 10 -0 8 2 4 25 30 2

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_reverse_complement1.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_reverse_complement1.out Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,4 @@
+>CSHL__2_FC042NGABCD:8:1:120:202
+GCAGAAAACGGCATACTAGCTCTTCCGATCTATCGT
+>CSHL__2_FC042NGABCD:8:1:103:1185
+GAAGACGGTAAACGAGCTCTGCCGATCTATCGTGAT

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_reverse_complement2.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_reverse_complement2.out Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,8 @@
+@CSHL__2_FC042NGABCD:8:1:120:202
+GCAGAAAACGGCATACTAGCTCTTCCGATCTATCGT
++CSHL__2_FC042NGABCD:8:1:120:202
+8 10 21 -1 10 11 -1 7 3 1 8 40 27 14 40 30 -1 40 20 40 25 40 40 28 40 40 6 40 40 40 40 20 40 40 40 40
+@CSHL__2_FC042NGABCD:8:1:103:1185
+GAAGACGGTAAACGAGCTCTGCCGATCTATCGTGAT
++CSHL__2_FC042NGABCD:8:1:103:1185
+2 30 25 4 2 8 0 10 3 23 12 22 34 15 36 8 14 17 22 9 0 40 22 30 32 40 40 40 31 33 35 40 40 40 40 40

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_trimmer1.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_trimmer1.fasta Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,4 @@
+>CSHL__2_FC042NGABCD:8:1:120:202
+ACGATAGATCGGAAGAGCTAGTATGCCGTTTTCTGC
+>CSHL__2_FC042NGABCD:8:1:103:1185
+ATCACGATAGATCGGCAGAGCTCGTTTACCGTCTTC

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_trimmer1.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_trimmer1.out Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,4 @@
+>CSHL__2_FC042NGABCD:8:1:120:202
+TAGATCGGAAGAGCTAGTATGCCGTTTTCTGC
+>CSHL__2_FC042NGABCD:8:1:103:1185
+CGATAGATCGGCAGAGCTCGTTTACCGTCTTC

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_trimmer2.fastq
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_trimmer2.fastq Thu Aug 14 04:52:17 2014 -0400

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/test-data/fastx_trimmer2.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/test-data/fastx_trimmer2.out Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,8 @@
+@CSHL__2_FC042NGABCD:8:1:120:202
+ACGATAGATCGGAAGAGCTAGTATGCC
++CSHL__2_FC042NGABCD:8:1:120:202
+40 40 40 40 20 40 40 40 40 6 40 40 28 40 40 25 40 20 40 -1 30 40 14 27 40 8 1
+@CSHL__2_FC042NGABCD:8:1:103:1185
+ATCACGATAGATCGGCAGAGCTCGTTT
++CSHL__2_FC042NGABCD:8:1:103:1185
+40 40 40 40 40 35 33 31 40 40 40 32 30 22 40 0 9 22 17 14 8 36 15 34 22 12 23

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tool-data/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tool-data/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,11 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+EXTRA_DIST = fastx_clipper_sequences.txt

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tool-data/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tool-data/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,317 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+subdir = galaxy/tool-data\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+SOURCES =\n+DIST_SOURCES =\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARATOR@\n+RANLIB = @RANLIB@\n+SET_MAKE = @SET_MAKE@\n+SHELL = @SHELL@\n+STRIP = @STRIP@\n+VERSION = @VERSION@\n+abs_builddir = @abs_builddir@\n+abs_srcdir = @abs_srcdir@\n+abs_top_builddir = @abs_top_builddir@\n+abs_top_srcdir = @abs_top_srcdir@\n+ac_ct_CC = @ac_ct_CC@\n+ac_ct_CXX = @ac_ct_CXX@\n+am__include = @am__include@\n+am__leading_dot = @am__leading_dot@\n+am__quote = @am__quote@\n+am__tar = @am__tar@\n+am__untar = @am__untar@\n+bindir = @bindir@\n+build = @build@\n+build_alias = @build_alias@\n+build_cpu = @build_cpu@\n+build_os = @build_os@\n+build_vendor = @build_vendor@\n+builddir = @builddir@\n+canonical_host_type = @canonical_host_type@\n+datadir = @datadir@\n+datarootdir = @datarootdir@\n+docdir = @docdir@\n+dvidir = @dvidir@\n+exec_prefix = @exec_prefix@\n+host = @host@\n+host_alias = @host_alias@\n+host_cpu = @host_cpu@\n+host'..b'\\\n+\t *config.status*) \\\n+\t cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \\\n+\t *) \\\n+\t echo \' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)\'; \\\n+\t cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \\\n+\tesac;\n+\n+$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)\n+\tcd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh\n+\n+$(top_srcdir)/configure: $(am__configure_deps)\n+\tcd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh\n+$(ACLOCAL_M4): $(am__aclocal_m4_deps)\n+\tcd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh\n+tags: TAGS\n+TAGS:\n+\n+ctags: CTAGS\n+CTAGS:\n+\n+\n+distdir: $(DISTFILES)\n+\t@srcdirstrip=`echo "$(srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\ttopsrcdirstrip=`echo "$(top_srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\tlist=\'$(DISTFILES)\'; \\\n+\t dist_files=`for file in $$list; do echo $$file; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-am\n+all-am: Makefile\n+installdirs:\n+install: install-am\n+install-exec: install-exec-am\n+install-data: install-data-am\n+uninstall: uninstall-am\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-am\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-am\n+\n+clean-am: clean-generic mostlyclean-am\n+\n+distclean: distclean-am\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-generic\n+\n+dvi: dvi-am\n+\n+dvi-am:\n+\n+html: html-am\n+\n+info: info-am\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-am\n+\n+install-exec-am:\n+\n+install-html: install-html-am\n+\n+install-info: install-info-am\n+\n+install-man:\n+\n+install-pdf: install-pdf-am\n+\n+install-ps: install-ps-am\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-am\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-am\n+\n+mostlyclean-am: mostlyclean-generic\n+\n+pdf: pdf-am\n+\n+pdf-am:\n+\n+ps: ps-am\n+\n+ps-am:\n+\n+uninstall-am:\n+\n+.MAKE: install-am install-strip\n+\n+.PHONY: all all-am check check-am clean clean-generic distclean \\\n+\tdistclean-generic distdir dvi dvi-am html html-am info info-am \\\n+\tinstall install-am install-data install-data-am install-dvi \\\n+\tinstall-dvi-am install-exec install-exec-am install-html \\\n+\tinstall-html-am install-info install-info-am install-man \\\n+\tinstall-pdf install-pdf-am install-ps install-ps-am \\\n+\tinstall-strip installcheck installcheck-am installdirs \\\n+\tmaintainer-clean maintainer-clean-generic mostlyclean \\\n+\tmostlyclean-generic pdf pdf-am ps ps-am uninstall uninstall-am\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tool-data/fastx_clipper_sequences.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tool-data/fastx_clipper_sequences.txt Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,13 @@
+#
+# Adapter/Linker sequences for FASTX-Clipper tool.
+#
+# Format:
+# Adapter Sequence <TAB> Descriptive name
+#
+# Example:
+# AAATTTGATAAGATA Our-Adapter
+#
+# Some adapters can be found here:
+# http://seqanswers.com/forums/showthread.php?t=198
+
+TGTAGGCC Dummy-Adapter (don't use me)

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/Makefile.am Thu Aug 14 04:52:17 2014 -0400

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,475 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+subdir = galaxy/tools\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+SOURCES =\n+DIST_SOURCES =\n+RECURSIVE_TARGETS = all-recursive check-recursive dvi-recursive \\\n+\thtml-recursive info-recursive install-data-recursive \\\n+\tinstall-dvi-recursive install-exec-recursive \\\n+\tinstall-html-recursive install-info-recursive \\\n+\tinstall-pdf-recursive install-ps-recursive install-recursive \\\n+\tinstallcheck-recursive installdirs-recursive pdf-recursive \\\n+\tps-recursive uninstall-recursive\n+RECURSIVE_CLEAN_TARGETS = mostlyclean-recursive clean-recursive\t\\\n+ distclean-recursive maintainer-clean-recursive\n+ETAGS = etags\n+CTAGS = ctags\n+DIST_SUBDIRS = $(SUBDIRS)\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARATOR@\n+RANLIB = @RANLIB@\n+SET_MAKE = @SET_MAKE@\n+SHELL = @SHELL@\n+STRIP = @STRIP@\n+VERSION = @VERSION@\n+abs_builddir = @abs_builddir@\n+abs_srcdir = @abs_srcdir@\n+abs_top_builddir = @abs_top_builddir@\n+abs_top_srcdir = @abs_top_srcdir@\n+ac_ct_CC = @ac_ct_CC@\n+ac_c'..b'ile; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+\tlist=\'$(DIST_SUBDIRS)\'; for subdir in $$list; do \\\n+\t if test "$$subdir" = .; then :; else \\\n+\t test -d "$(distdir)/$$subdir" \\\n+\t || $(MKDIR_P) "$(distdir)/$$subdir" \\\n+\t || exit 1; \\\n+\t distdir=`$(am__cd) $(distdir) && pwd`; \\\n+\t top_distdir=`$(am__cd) $(top_distdir) && pwd`; \\\n+\t (cd $$subdir && \\\n+\t $(MAKE) $(AM_MAKEFLAGS) \\\n+\t top_distdir="$$top_distdir" \\\n+\t distdir="$$distdir/$$subdir" \\\n+\t\tam__remove_distdir=: \\\n+\t\tam__skip_length_check=: \\\n+\t distdir) \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-recursive\n+all-am: Makefile\n+installdirs: installdirs-recursive\n+installdirs-am:\n+install: install-recursive\n+install-exec: install-exec-recursive\n+install-data: install-data-recursive\n+uninstall: uninstall-recursive\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-recursive\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-recursive\n+\n+clean-am: clean-generic mostlyclean-am\n+\n+distclean: distclean-recursive\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-generic distclean-tags\n+\n+dvi: dvi-recursive\n+\n+dvi-am:\n+\n+html: html-recursive\n+\n+info: info-recursive\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-recursive\n+\n+install-exec-am:\n+\n+install-html: install-html-recursive\n+\n+install-info: install-info-recursive\n+\n+install-man:\n+\n+install-pdf: install-pdf-recursive\n+\n+install-ps: install-ps-recursive\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-recursive\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-recursive\n+\n+mostlyclean-am: mostlyclean-generic\n+\n+pdf: pdf-recursive\n+\n+pdf-am:\n+\n+ps: ps-recursive\n+\n+ps-am:\n+\n+uninstall-am:\n+\n+.MAKE: $(RECURSIVE_CLEAN_TARGETS) $(RECURSIVE_TARGETS) install-am \\\n+\tinstall-strip\n+\n+.PHONY: $(RECURSIVE_CLEAN_TARGETS) $(RECURSIVE_TARGETS) CTAGS GTAGS \\\n+\tall all-am check check-am clean clean-generic ctags \\\n+\tctags-recursive distclean distclean-generic distclean-tags \\\n+\tdistdir dvi dvi-am html html-am info info-am install \\\n+\tinstall-am install-data install-data-am install-dvi \\\n+\tinstall-dvi-am install-exec install-exec-am install-html \\\n+\tinstall-html-am install-info install-info-am install-man \\\n+\tinstall-pdf install-pdf-am install-ps install-ps-am \\\n+\tinstall-strip installcheck installcheck-am installdirs \\\n+\tinstalldirs-am maintainer-clean maintainer-clean-generic \\\n+\tmostlyclean mostlyclean-generic pdf pdf-am ps ps-am tags \\\n+\ttags-recursive uninstall uninstall-am\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,23 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+EXTRA_DIST = fastq_quality_converter.xml \
+ fastq_quality_filter.xml \
+ fastx_quality_statistics.xml \
+ fastq_to_fasta.xml \
+ fastx_artifacts_filter.xml \
+ fastx_clipper.xml \
+ fastx_reverse_complement.xml \
+ fastx_trimmer.xml \
+ fastx_barcode_splitter.xml \
+ fastx_nucleotides_distribution.xml \
+ fastq_quality_boxplot.xml \
+ fasta_clipping_histogram.xml \
+ fastx_collapser.xml

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,330 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+subdir = galaxy/tools/fastx_toolkit\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+SOURCES =\n+DIST_SOURCES =\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARATOR@\n+RANLIB = @RANLIB@\n+SET_MAKE = @SET_MAKE@\n+SHELL = @SHELL@\n+STRIP = @STRIP@\n+VERSION = @VERSION@\n+abs_builddir = @abs_builddir@\n+abs_srcdir = @abs_srcdir@\n+abs_top_builddir = @abs_top_builddir@\n+abs_top_srcdir = @abs_top_srcdir@\n+ac_ct_CC = @ac_ct_CC@\n+ac_ct_CXX = @ac_ct_CXX@\n+am__include = @am__include@\n+am__leading_dot = @am__leading_dot@\n+am__quote = @am__quote@\n+am__tar = @am__tar@\n+am__untar = @am__untar@\n+bindir = @bindir@\n+build = @build@\n+build_alias = @build_alias@\n+build_cpu = @build_cpu@\n+build_os = @build_os@\n+build_vendor = @build_vendor@\n+builddir = @builddir@\n+canonical_host_type = @canonical_host_type@\n+datadir = @datadir@\n+datarootdir = @datarootdir@\n+docdir = @docdir@\n+dvidir = @dvidir@\n+exec_prefix = @exec_prefix@\n+host = @host@\n+host_alias = @host_alias@\n+host_cpu = @host_'..b'\\\n+\t *config.status*) \\\n+\t cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \\\n+\t *) \\\n+\t echo \' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)\'; \\\n+\t cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \\\n+\tesac;\n+\n+$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)\n+\tcd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh\n+\n+$(top_srcdir)/configure: $(am__configure_deps)\n+\tcd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh\n+$(ACLOCAL_M4): $(am__aclocal_m4_deps)\n+\tcd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh\n+tags: TAGS\n+TAGS:\n+\n+ctags: CTAGS\n+CTAGS:\n+\n+\n+distdir: $(DISTFILES)\n+\t@srcdirstrip=`echo "$(srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\ttopsrcdirstrip=`echo "$(top_srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\tlist=\'$(DISTFILES)\'; \\\n+\t dist_files=`for file in $$list; do echo $$file; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-am\n+all-am: Makefile\n+installdirs:\n+install: install-am\n+install-exec: install-exec-am\n+install-data: install-data-am\n+uninstall: uninstall-am\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-am\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-am\n+\n+clean-am: clean-generic mostlyclean-am\n+\n+distclean: distclean-am\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-generic\n+\n+dvi: dvi-am\n+\n+dvi-am:\n+\n+html: html-am\n+\n+info: info-am\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-am\n+\n+install-exec-am:\n+\n+install-html: install-html-am\n+\n+install-info: install-info-am\n+\n+install-man:\n+\n+install-pdf: install-pdf-am\n+\n+install-ps: install-ps-am\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-am\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-am\n+\n+mostlyclean-am: mostlyclean-generic\n+\n+pdf: pdf-am\n+\n+pdf-am:\n+\n+ps: ps-am\n+\n+ps-am:\n+\n+uninstall-am:\n+\n+.MAKE: install-am install-strip\n+\n+.PHONY: all all-am check check-am clean clean-generic distclean \\\n+\tdistclean-generic distdir dvi dvi-am html html-am info info-am \\\n+\tinstall install-am install-data install-data-am install-dvi \\\n+\tinstall-dvi-am install-exec install-exec-am install-html \\\n+\tinstall-html-am install-info install-info-am install-man \\\n+\tinstall-pdf install-pdf-am install-ps install-ps-am \\\n+\tinstall-strip installcheck installcheck-am installdirs \\\n+\tmaintainer-clean maintainer-clean-generic mostlyclean \\\n+\tmostlyclean-generic pdf pdf-am ps ps-am uninstall uninstall-am\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fasta_clipping_histogram.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fasta_clipping_histogram.xml Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,38 @@
+<tool id="cshl_fasta_clipping_histogram" name="Length Distribution">
+ <description>chart</description>
+ <command>fasta_clipping_histogram.pl $input $outfile</command>
+
+ <inputs>
+ <param format="fasta" name="input" type="data" label="Library to analyze" />
+ </inputs>
+
+ <outputs>
+ <data format="png" name="outfile" metadata_source="input" />
+ </outputs>
+<help>
+
+**What it does**
+
+This tool creates a histogram image of sequence lengths distribution in a given fasta data set file.
+
+**TIP:** Use this tool after clipping your library (with **FASTX Clipper tool**), to visualize the clipping results.
+
+-----
+
+**Output Examples**
+
+
+In the following library, most sequences are 24-mers to 27-mers.
+This could indicate an abundance of endo-siRNAs (depending of course of what you've tried to sequence in the first place).
+
+.. image:: ./static/fastx_icons/fasta_clipping_histogram_1.png
+
+
+In the following library, most sequences are 19,22 or 23-mers.
+This could indicate an abundance of miRNAs (depending of course of what you've tried to sequence in the first place).
+
+.. image:: ./static/fastx_icons/fasta_clipping_histogram_2.png
+
+</help>
+</tool>
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastq_quality_boxplot.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastq_quality_boxplot.xml Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,47 @@
+<tool id="cshl_fastq_quality_boxplot" name="Quality Score">
+ <description>chart</description>
+
+ <command>fastq_quality_boxplot_graph.sh -t '$input.name' -i $input -o $output</command>
+
+ <inputs>
+ <param format="txt" name="input" type="data" label="Statistics report file (output of 'FASTQ Statistics' tool)" />
+ </inputs>
+
+ <outputs>
+ <data format="png" name="output" metadata_source="input" />
+ </outputs>
+<help>
+
+**What it does**
+
+Creates a boxplot graph for the quality scores in the library.
+
+.. class:: infomark
+
+**TIP:** Use the **FASTQ Statistics** tool to generate the report file needed for this tool.
+
+-----
+
+**Output Examples**
+
+* Black horizontal lines are medians
+* Rectangular red boxes show the Inter-quartile Range (IQR) (top value is Q3, bottom value is Q1)
+* Whiskers show outlier at max. 1.5*IQR
+
+
+An excellent quality library (median quality is 40 for almost all 36 cycles):
+
+.. image:: ./static/fastx_icons/fastq_quality_boxplot_1.png
+
+
+A relatively good quality library (median quality degrades towards later cycles):
+
+.. image:: ./static/fastx_icons/fastq_quality_boxplot_2.png
+
+A low quality library (median drops quickly):
+
+.. image:: ./static/fastx_icons/fastq_quality_boxplot_3.png
+
+</help>
+</tool>
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastq_quality_converter.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastq_quality_converter.xml Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,82 @@
+<tool id="cshl_fastq_quality_converter" name="Quality format converter">
+ <description>(ASCII-Numeric)</description>
+ <command>zcat -f $input | fastq_quality_converter $QUAL_FORMAT -o $output</command>
+ <inputs>
+ <param format="fastqsolexa" name="input" type="data" label="Library to convert" />
+
+ <param name="QUAL_FORMAT" type="select" label="Desired output format">
+ <option value="-a">ASCII (letters) quality scores</option>
+ <option value="-n">Numeric quality scores</option>
+ </param>
+ </inputs>
+
+ <tests>
+ <test>
+ 
+ <param name="input" value="fastq_qual_conv1.fastq" />
+ <param name="QUAL_FORMAT" value="Numeric quality scores" />
+ <output name="output" file="fastq_qual_conv1.out" />
+ </test>
+ <test>
+ 
+ <param name="input" value="fastq_qual_conv1.fastq" />
+ <param name="QUAL_FORMAT" value="ASCII (letters) quality scores" />
+ <output name="output" file="fastq_qual_conv1a.out" />
+ </test>
+ <test>
+ 
+ <param name="input" value="fastq_qual_conv2.fastq" />
+ <param name="QUAL_FORMAT" value="ASCII (letters) quality scores" />
+ <output name="output" file="fastq_qual_conv2.out" />
+ </test>
+ <test>
+ 
+ <param name="input" value="fastq_qual_conv2.fastq" />
+ <param name="QUAL_FORMAT" value="Numeric quality scores" />
+ <output name="output" file="fastq_qual_conv2n.out" />
+ </test>
+ </tests>
+
+ <outputs>
+ <data format="fastqsolexa" name="output" metadata_source="input" />
+ </outputs>
+<help>
+
+**What it does**
+
+Converts a solexa FASTQ file to/from numeric or ASCII quality format.
+
+.. class:: warningmark
+
+Re-scaling is **not** performed. (e.g. conversion from Phred scale to Solexa scale).
+
+
+-----
+
+FASTQ with Numeric quality scores::
+
+    @CSHL__2_FC042AGWWWXX:8:1:120:202
+    ACGATAGATCGGAAGAGCTAGTATGCCGTTTTCTGC
+    +CSHL__2_FC042AGWWWXX:8:1:120:202
+    40 40 40 40 20 40 40 40 40 6 40 40 28 40 40 25 40 20 40 -1 30 40 14 27 40 8 1 3 7 -1 11 10 -1 21 10 8
+    @CSHL__2_FC042AGWWWXX:8:1:103:1185
+    ATCACGATAGATCGGCAGAGCTCGTTTACCGTCTTC
+    +CSHL__2_FC042AGWWWXX:8:1:103:1185
+    40 40 40 40 40 35 33 31 40 40 40 32 30 22 40 -0 9 22 17 14 8 36 15 34 22 12 23 3 10 -0 8 2 4 25 30 2
+
+
+FASTQ with ASCII quality scores::
+
+    @CSHL__2_FC042AGWWWXX:8:1:120:202
+    ACGATAGATCGGAAGAGCTAGTATGCCGTTTTCTGC
+    +CSHL__2_FC042AGWWWXX:8:1:120:202
+    hhhhThhhhFhh\hhYhTh?^hN[hHACG?KJ?UJH
+    @CSHL__2_FC042AGWWWXX:8:1:103:1185
+    ATCACGATAGATCGGCAGAGCTCGTTTACCGTCTTC
+    +CSHL__2_FC042AGWWWXX:8:1:103:1185
+    hhhhhca_hhh`^Vh@IVQNHdObVLWCJ@HBDY^B
+
+
+</help>
+</tool>
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastq_quality_filter.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastq_quality_filter.xml Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,73 @@
+<tool id="cshl_fastq_quality_filter" name="Quality Filter">
+ <description></description>
+
+ <command>zcat -f '$input' | fastq_quality_filter -q $quality -p $percent -v -o $output</command>
+
+ <inputs>
+ <param format="fastqsolexa" name="input" type="data" label="Library to filter" />
+
+ <param name="quality" size="4" type="integer" value="20">
+ <label>Quality cut-off value</label>
+ </param>
+
+ <param name="percent" size="4" type="integer" value="90">
+ <label>Percent of bases in sequence that must have quality equal to / higher than cut-off value</label>
+ </param>
+ </inputs>
+
+ <tests>
+ <test>
+ 
+ <param name="input" value="fastq_qual_filter1.fastq" />
+ <param name="quality" value="33"/>
+ <param name="percent" value="100"/>
+ <output name="output" file="fastq_qual_filter1a.out" />
+ </test>
+ <test>
+ 
+ <param name="input" value="fastq_qual_filter1.fastq" />
+ <param name="quality" value="20"/>
+ <param name="percent" value="80"/>
+ <output name="output" file="fastq_qual_filter1b.out" />
+ </test>
+ </tests>
+
+ <outputs>
+ <data format="input" name="output" metadata_source="input" />
+ </outputs>
+
+ <help>
+**What it does**
+
+This tool filters reads based on quality scores.
+
+.. class:: infomark
+
+Using **percent = 100** requires all cycles of all reads to be at least the quality cut-off value.
+
+.. class:: infomark
+
+Using **percent = 50** requires the median quality of the cycles (in each read) to be at least the quality cut-off value.
+
+--------
+
+Quality score distribution (of all cycles) is calculated for each read. If it is lower than the quality cut-off value - the read is discarded.
+
+
+**Example**::
+
+    @CSHL_4_FC042AGOOII:1:2:214:584
+    GACAATAAAC
+    +CSHL_4_FC042AGOOII:1:2:214:584
+    30 30 30 30 30 30 30 30 20 10
+
+Using **percent = 50** and **cut-off = 30** - This read will not be discarded (the median quality is higher than 30).
+
+Using **percent = 90** and **cut-off = 30** - This read will be discarded (90% of the cycles do no have quality equal to / higher than 30).
+
+Using **percent = 100** and **cut-off = 20** - This read will be discarded (not all cycles have quality equal to / higher than 20).
+
+
+ </help>
+</tool>
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastq_to_fasta.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastq_to_fasta.xml Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,70 @@
+<tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA">
+ <description>converter</description>
+ <command>gunzip -cf $input | fastq_to_fasta $SKIPN $RENAMESEQ -o $output -v </command>
+
+ <inputs>
+ <param format="fastqsolexa" name="input" type="data" label="FASTQ Library to convert" />
+
+ <param name="SKIPN" type="select" label="Discard sequences with unknown (N) bases ">
+ <option value="">yes</option>
+ <option value="-n">no</option>
+ </param>
+
+ <param name="RENAMESEQ" type="select" label="Rename sequence names in output file (reduces file size)">
+ <option value="-r">yes</option>
+ <option value="">no</option>
+ </param>
+
+ </inputs>
+
+ <tests>
+ <test>
+ 
+ <param name="input" value="fastq_to_fasta1.fastq" />
+ <param name="SKIPN" value=""/>
+ <param name="RENAMESEQ" value=""/>
+ <output name="output" file="fastq_to_fasta1a.out" />
+ </test>
+ <test>
+ 
+ <param name="input" value="fastq_to_fasta1.fastq" />
+ <param name="SKIPN" value="no"/>
+ <param name="RENAMESEQ" value="yes"/>
+ <output name="output" file="fastq_to_fasta1b.out" />
+ </test>
+ </tests>
+
+ <outputs>
+ <data format="fasta" name="output" metadata_source="input" />
+ </outputs>
+
+<help>
+
+**What it does**
+
+This tool converts data from Solexa format to FASTA format (scroll down for format description).
+
+--------
+
+**Example**
+
+The following data in Solexa-FASTQ format::
+
+    @CSHL_4_FC042GAMMII_2_1_517_596
+    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+    +CSHL_4_FC042GAMMII_2_1_517_596
+    40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
+
+Will be converted to FASTA (with 'rename sequence names' = NO)::
+
+    >CSHL_4_FC042GAMMII_2_1_517_596
+    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+
+Will be converted to FASTA (with 'rename sequence names' = YES)::
+
+    >1
+    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+
+</help>
+</tool>
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_artifacts_filter.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_artifacts_filter.xml Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,80 @@
+<tool id="cshl_fastx_artifacts_filter" name="Artifacts Filter">
+ <description></description>
+ <command>zcat -f '$input' | fastx_artifacts_filter -v -o "$output"</command>
+
+ <inputs>
+ <param format="fasta,fastqsolexa" name="input" type="data" label="Library to filter" />
+
+ </inputs>
+
+ <tests>
+ <test>
+ 
+ <param name="input" value="fastx_artifacts1.fasta" />
+ <output name="output" file="fastx_artifacts1.out" />
+ </test>
+ <test>
+ 
+ <param name="input" value="fastx_artifacts2.fastq" />
+ <output name="output" file="fastx_artifacts2.out" />
+ </test>
+ </tests>
+
+ <outputs>
+ <data format="input" name="output" metadata_source="input" />
+ </outputs>
+<help>
+**What it does**
+
+This tool filters sequencing artifacts (reads with all but 3 identical bases).
+
+--------
+
+**The following is an example of sequences which will be filtered out**::
+
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAACACAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
+    AAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAA
+    AAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAA
+    AAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAA
+    AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAA
+
+</help>
+</tool>
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_barcode_splitter.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_barcode_splitter.xml Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,68 @@
+<tool id="cshl_fastx_barcode_splitter" name="Barcode Splitter">
+ <description></description>
+ <command>fastx_barcode_splitter_galaxy_wrapper.sh $BARCODE $input "$input.name" --mismatches $mismatches --partial $partial $EOL > $output </command>
+
+ <inputs>
+ <param format="txt" name="BARCODE" type="data" label="Barcodes to use" />
+ <param format="fasta,fastqsolexa" name="input" type="data" label="Library to split" />
+
+ <param name="EOL" type="select" label="Barcodes found at">
+ <option value="--bol">Start of sequence (5' end)</option>
+ <option value="--eol">End of sequence (3' end)</option>
+ </param>
+
+ <param name="mismatches" type="integer" size="3" value="2" label="Number of allowed mismatches" />
+
+ <param name="partial" type="integer" size="3" value="0" label="Number of allowed barcodes nucleotide deletions" />
+
+ </inputs>
+
+ <tests>
+ <test>
+ 
+ <param name="BARCODE" value="fastx_barcode_splitter1.txt" />
+ <param name="input" value="fastx_barcode_splitter1.fastq" />
+ <param name="EOL" value="Start of sequence (5' end)" />
+ <param name="mismatches" value="2" />
+ <param name="partial" value="0" />
+ <output name="output" file="fastx_barcode_splitter1.out" />
+ </test>
+ </tests>
+
+ <outputs>
+ <data format="html" name="output" />
+ </outputs>
+<help>
+
+**What it does**
+
+This tool splits a solexa library (FASTQ file) or a regular FASTA file to several files, using barcodes as the split criteria.
+
+--------
+
+**Barcode file Format**
+
+Barcode files are simple text files.
+Each line should contain an identifier (descriptive name for the barcode), and the barcode itself (A/C/G/T), separated by a TAB character.
+Example::
+
+    #This line is a comment (starts with a 'number' sign)
+    BC1 GATCT
+    BC2 ATCGT
+    BC3 GTGAT
+    BC4 TGTCT
+
+For each barcode, a new FASTQ file will be created (with the barcode's identifier as part of the file name).
+Sequences matching the barcode will be stored in the appropriate file.
+
+One additional FASTQ file will be created (the 'unmatched' file), where sequences not matching any barcode will be stored.
+
+The output of this tool is an HTML file, displaying the split counts and the file locations.
+
+**Output Example**
+
+.. image:: ./static/fastx_icons/barcode_splitter_output_example.png
+
+</help>
+</tool>
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_clipper.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_clipper.xml Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,109 @@
+<tool id="cshl_fastx_clipper" name="Clip" version="1.0.1" >
+  <description>adapter sequences</description>
+  <command>
+    zcat -f $input | fastx_clipper -s $maxmismatches -l $minlength -a $clip_source.clip_sequence -d $keepdelta -o $output -v $KEEP_N $DISCARD_OPTIONS
+  </command>
+
+  <inputs>
+    <param format="fasta,fastqsolexa" name="input" type="data" label="Library to clip" />
+
+    <param name="maxmismatches" size="4" type="integer" value="2">
+      <label>Maximum number of mismatches allowed (when matching the adapter sequence)</label>
+    </param>
+
+    <param name="minlength" size="4" type="integer" value="15">
+      <label>Minimum sequence length (after clipping, sequences shorter than this length will be discarded)</label>
+    </param>
+
+ <conditional name="clip_source">
+ <param name="clip_source_list" type="select" label="Source">
+ <option value="prebuilt" selected="true">Standard (select from the list below)</option>
+ <option value="user">Enter custom sequence</option>
+ </param>
+
+ <when value="user">
+ <param name="clip_sequence" size="30" label="Enter custom clipping sequence" type="text" value="AATTGGCC" />
+ </when>
+
+ <when value="prebuilt">
+ <param name="clip_sequence" type="select" label="Choose Adapter">
+ <options from_file="fastx_clipper_sequences.txt">
+ <column name="name" index="1"/>
+ <column name="value" index="0"/>
+ </options>
+ </param>
+ </when>
+ </conditional>
+
+ <param name="keepdelta" size="2" type="integer" value="0">
+ <label>enter non-zero value to keep the adapter sequence and x bases that follow it</label>
+ <help>use this for hairpin barcoding. keep at 0 unless you know what you're doing.</help>
+ </param>
+
+ <param name="KEEP_N" type="select" label="Discard sequences with unknown (N) bases">
+ <option value="">Yes</option>
+ <option value="-n">No</option>
+ </param>
+
+ <param name="DISCARD_OPTIONS" type="select" label="Output options">
+ <option value="-c">Output only clipped seqeunces (i.e. sequences which contained the adapter)</option>
+ <option value="-C">Output only non-clipped seqeunces (i.e. sequences which did not contained the adapter)</option>
+ <option value="">Output both clipped and non-clipped sequences</option>
+ </param>
+
+  </inputs>
+
+ <tests>
+ <test>
+ 
+ <param name="input" value="fastx_clipper1.fastq" />
+ <param name="maxmismatches" value="2" />
+ <param name="minlength" value="15" />
+ <param name="clip_source.clip_source_list" value="user" />
+ <param name="clip_source.clip_sequence" value="CAATTGGTTAATCCCCCTATATA" />
+ <param name="keepdelta" value="0" />
+ <param name="KEEP_N" value="-n" />
+ <param name="DISCARD_OPTIONS" value="-c" />
+ <output name="output" file="fastx_clipper1a.out" />
+ </test>
+ </tests>
+
+  <outputs>
+    <data format="input" name="output" metadata_source="input" />
+  </outputs>
+
+<help>
+**What it does**
+
+This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file.
+
+--------
+
+
+**Clipping Illustration:**
+
+.. image:: ./static/fastx_icons/fastx_clipper_illustration.png
+
+
+
+
+
+
+
+
+**Clipping Example:**
+
+.. image:: ./static/fastx_icons/fastx_clipper_example.png
+
+
+
+**In the above example:**
+
+* Sequence no. 1 was discarded since it wasn't clipped (i.e. didn't contain the adapter sequence). (**Output** parameter).
+* Sequence no. 5 was discarded --- it's length (after clipping) was shorter than 15 nt (**Minimum Sequence Length** parameter).
+
+
+
+
+</help>
+</tool>

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_collapser.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_collapser.xml Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,75 @@
+<tool id="cshl_fastx_collapser" name="Collapse">
+ <description>sequences</description>
+ <command>zcat -f '$input' | fastx_collapser -v -o '$output' </command>
+
+ <inputs>
+ <param format="fastqsolexa,fasta" name="input" type="data" label="Library to collapse" />
+ </inputs>
+
+ <tests>
+ <test>
+ <param name="input" value="fasta_collapser1.fasta" />
+ <output name="output" file="fasta_collapser1.out" />
+ </test>
+ </tests>
+
+ <outputs>
+ <data format="fasta" name="output" metadata_source="input" />
+ </outputs>
+  <help>
+
+**What it does**
+
+This tool collapses identical sequences in a FASTA file into a single sequence.
+
+--------
+
+**Example**
+
+Example Input File (Sequence "ATAT" appears multiple times)::
+
+    >CSHL_2_FC0042AGLLOO_1_1_605_414
+    TGCG
+    >CSHL_2_FC0042AGLLOO_1_1_537_759
+    ATAT
+    >CSHL_2_FC0042AGLLOO_1_1_774_520
+    TGGC
+    >CSHL_2_FC0042AGLLOO_1_1_742_502
+    ATAT
+    >CSHL_2_FC0042AGLLOO_1_1_781_514
+    TGAG
+    >CSHL_2_FC0042AGLLOO_1_1_757_487
+    TTCA
+    >CSHL_2_FC0042AGLLOO_1_1_903_769
+    ATAT
+    >CSHL_2_FC0042AGLLOO_1_1_724_499
+    ATAT
+
+Example Output file::
+
+    >1-1
+    TGCG
+    >2-4
+    ATAT
+    >3-1
+    TGGC
+    >4-1
+    TGAG
+    >5-1
+    TTCA
+
+.. class:: infomark
+
+Original Sequence Names / Lane descriptions (e.g. "CSHL_2_FC0042AGLLOO_1_1_742_502") are discarded.
+
+The output seqeunce name is composed of two numbers: the first is the sequence's number, the second is the multiplicity value.
+
+The following output::
+
+    >2-4
+    ATAT
+
+means that the sequence "ATAT" is the second sequence in the file, and it appeared 4 times in the input FASTA file.
+
+</help>
+</tool>

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_nucleotides_distribution.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_nucleotides_distribution.xml Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,66 @@
+<tool id="cshl_fastx_nucleotides_distribution" name="Nucleotides Distribution">
+ <description>chart</description>
+ <command>fastx_nucleotide_distribution_graph.sh -t '$input.name' -i $input -o $output</command>
+
+ <inputs>
+ <param format="txt" name="input" type="data" label="Statistics Text File (output of 'FASTX Statistics' tool)" />
+ </inputs>
+
+ <outputs>
+ <data format="png" name="output" metadata_source="input" />
+ </outputs>
+<help>
+
+**What it does**
+
+Creates a stacked-histogram graph for the nucleotide distribution in the Solexa library.
+
+.. class:: infomark
+
+**TIP:** Use the **FASTQ Statistics** tool to generate the report file needed for this tool.
+
+-----
+
+**Output Examples**
+
+
+
+The following chart clearly shows the barcode used at the 5'-end of the library: **GATCT**
+
+.. image:: ./static/fastx_icons/fastq_nucleotides_distribution_1.png
+
+
+
+
+
+
+
+In the following chart, one can almost 'read' the most abundant sequence by looking at the dominant values: **TGATA TCGTA TTGAT GACTG AA...**
+
+.. image:: ./static/fastx_icons/fastq_nucleotides_distribution_2.png
+
+
+
+
+
+
+
+
+The following chart shows a growing number of unknown (N) nucleotides towards later cycles (which might indicate a sequencing problem):
+
+.. image:: ./static/fastx_icons/fastq_nucleotides_distribution_3.png
+
+
+
+
+
+
+
+
+But most of the time, the chart will look rather random:
+
+.. image:: ./static/fastx_icons/fastq_nucleotides_distribution_4.png
+
+</help>
+</tool>
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_quality_statistics.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_quality_statistics.xml Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,100 @@
+<tool id="cshl_fastx_quality_statistics" name="Quality Statistics">
+ <description></description>
+ <command>zcat -f $input | fastx_quality_stats -o $output</command>
+
+ <inputs>
+ <param format="fasta,fastqsolexa" name="input" type="data" label="Library to analyse" />
+ </inputs>
+
+ <tests>
+ <test>
+ <param name="input" value="fastq_stats1.fastq" />
+ <output name="output" file="fastq_stats1.out" />
+ </test>
+ </tests>
+
+ <outputs>
+ <data format="txt" name="output" metadata_source="input" />
+ </outputs>
+
+<help>
+
+**What it does**
+
+Creates quality statistics report for the given Solexa/FASTQ library.
+
+.. class:: infomark
+
+**TIP:** This statistics report can be used as input for **Quality Score** and **Nucleotides Distribution** tools.
+
+-----
+
+**The output file will contain the following fields:**
+
+* column = column number (1 to 36 for a 36-cycles read solexa file)
+* count   = number of bases found in this column.
+* min     = Lowest quality score value found in this column.
+* max     = Highest quality score value found in this column.
+* sum     = Sum of quality score values for this column.
+* mean    = Mean quality score value for this column.
+* Q1 = 1st quartile quality score.
+* med = Median quality score.
+* Q3 = 3rd quartile quality score.
+* IQR = Inter-Quartile range (Q3-Q1).
+* lW = 'Left-Whisker' value (for boxplotting).
+* rW = 'Right-Whisker' value (for boxplotting).
+* A_Count = Count of 'A' nucleotides found in this column.
+* C_Count = Count of 'C' nucleotides found in this column.
+* G_Count = Count of 'G' nucleotides found in this column.
+* T_Count = Count of 'T' nucleotides found in this column.
+* N_Count = Count of 'N' nucleotides found in this column.
+
+
+
+
+
+
+**Output Example**::
+
+    column count min max sum mean Q1 med Q3 IQR lW rW A_Count C_Count G_Count T_Count N_Count
+    1 6362991 -4 40 250734117 39.41 40 40 40 0 40 40 1396976 1329101 678730 2958184 0
+    2 6362991 -5 40 250531036 39.37 40 40 40 0 40 40 1786786 1055766 1738025 1782414 0
+    3 6362991 -5 40 248722469 39.09 40 40 40 0 40 40 2296384 984875 1443989 1637743 0
+    4 6362991 -5 40 247654797 38.92 40 40 40 0 40 40 1683197 1410855 1722633 1546306 0
+    5 6362991 -4 40 248214827 39.01 40 40 40 0 40 40 2536861 1167423 1248968 1409739 0
+    6 6362991 -5 40 248499903 39.05 40 40 40 0 40 40 1598956 1236081 1568608 1959346 0
+    7 6362991 -4 40 247719760 38.93 40 40 40 0 40 40 1692667 1822140 1496741 1351443 0
+    8 6362991 -5 40 245745205 38.62 40 40 40 0 40 40 2230936 1343260 1529928 1258867 0
+    9 6362991 -5 40 245766735 38.62 40 40 40 0 40 40 1702064 1306257 1336511 2018159 0
+    10 6362991 -5 40 245089706 38.52 40 40 40 0 40 40 1519917 1446370 1450995 1945709 0
+    11 6362991 -5 40 242641359 38.13 40 40 40 0 40 40 1717434 1282975 1387804 1974778 0
+    12 6362991 -5 40 242026113 38.04 40 40 40 0 40 40 1662872 1202041 1519721 1978357 0
+    13 6362991 -5 40 238704245 37.51 40 40 40 0 40 40 1549965 1271411 1973291 1566681 1643
+    14 6362991 -5 40 235622401 37.03 40 40 40 0 40 40 2101301 1141451 1603990 1515774 475
+    15 6362991 -5 40 230766669 36.27 40 40 40 0 40 40 2344003 1058571 1440466 1519865 86
+    16 6362991 -5 40 224466237 35.28 38 40 40 2 35 40 2203515 1026017 1474060 1651582 7817
+    17 6362991 -5 40 219990002 34.57 34 40 40 6 25 40 1522515 1125455 2159183 1555765 73
+    18 6362991 -5 40 214104778 33.65 30 40 40 10 15 40 1479795 2068113 1558400 1249337 7346
+    19 6362991 -5 40 212934712 33.46 30 40 40 10 15 40 1432749 1231352 1769799 1920093 8998
+    20 6362991 -5 40 212787944 33.44 29 40 40 11 13 40 1311657 1411663 2126316 1513282 73
+    21 6362991 -5 40 211369187 33.22 28 40 40 12 10 40 1887985 1846300 1300326 1318380 10000
+    22 6362991 -5 40 213371720 33.53 30 40 40 10 15 40 542299 3446249 516615 1848190 9638
+    23 6362991 -5 40 221975899 34.89 36 40 40 4 30 40 347679 1233267 926621 3855355 69
+    24 6362991 -5 40 194378421 30.55 21 40 40 19 -5 40 433560 674358 3262764 1992242 67
+    25 6362991 -5 40 199773985 31.40 23 40 40 17 -2 40 944760 325595 1322800 3769641 195
+    26 6362991 -5 40 179404759 28.20 17 34 40 23 -5 40 3457922 156013 1494664 1254293 99
+    27 6362991 -5 40 163386668 25.68 13 28 40 27 -5 40 1392177 281250 3867895 821491 178
+    28 6362991 -5 40 156230534 24.55 12 25 40 28 -5 40 907189 981249 4174945 299437 171
+    29 6362991 -5 40 163236046 25.65 13 28 40 27 -5 40 1097171 3418678 1567013 280008 121
+    30 6362991 -5 40 151309826 23.78 12 23 40 28 -5 40 3514775 2036194 566277 245613 132
+    31 6362991 -5 40 141392520 22.22 10 21 40 30 -5 40 1569000 4571357 124732 97721 181
+    32 6362991 -5 40 143436943 22.54 10 21 40 30 -5 40 1453607 4519441 38176 351107 660
+    33 6362991 -5 40 114269843 17.96 6 14 30 24 -5 40 3311001 2161254 155505 734297 934
+    34 6362991 -5 40 140638447 22.10 10 20 40 30 -5 40 1501615 1637357 18113 3205237 669
+    35 6362991 -5 40 138910532 21.83 10 20 40 30 -5 40 1532519 3495057 23229 1311834 352
+    36 6362991 -5 40 117158566 18.41 7 15 30 23 -5 40 4074444 1402980 63287 822035 245
+
+
+</help>
+</tool>
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_reverse_complement.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_reverse_complement.xml Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,52 @@
+<tool id="cshl_fastx_reverse_complement" name="Reverse-Complement">
+ <description>sequences</description>
+ <command>zcat -f '$input' | fastx_reverse_complement -v -o $output</command>
+ <inputs>
+ <param format="fasta,fastqsolexa" name="input" type="data" label="Library to reverse-complement" />
+ </inputs>
+
+ <tests>
+ <test>
+ 
+ <param name="input" value="fastx_rev_comp1.fasta" />
+ <output name="output" file="fastx_reverse_complement1.out" />
+ </test>
+ <test>
+ 
+ <param name="input" value="fastx_rev_comp2.fastq" />
+ <output name="output" file="fastx_reverse_complement2.out" />
+ </test>
+ </tests>
+
+
+ <outputs>
+ <data format="input" name="output" metadata_source="input" />
+ </outputs>
+
+<help>
+**What it does**
+
+This tool reverse-complements each sequence in a library.
+If the library is a FASTQ, the quality-scores are also reversed.
+
+--------
+
+**Example**
+
+Input FASTQ file::
+
+    @CSHL_1_FC42AGWWWXX:8:1:3:740
+    TGTCTGTAGCCTCNTCCTTGTAATTCAAAGNNGGTA
+    +CSHL_1_FC42AGWWWXX:8:1:3:740
+    33 33 33 34 33 33 33 33 33 33 33 33 27 5 27 33 33 33 33 33 33 27 21 27 33 32 31 29 26 24 5 5 15 17 27 26
+
+
+Output FASTQ file::
+
+    @CSHL_1_FC42AGWWWXX:8:1:3:740
+    TACCNNCTTTGAATTACAAGGANGAGGCTACAGACA
+    +CSHL_1_FC42AGWWWXX:8:1:3:740
+    26 27 17 15 5 5 24 26 29 31 32 33 27 21 27 33 33 33 33 33 33 27 5 27 33 33 33 33 33 33 33 33 34 33 33 33
+
+</help>
+</tool>

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_trimmer.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit/fastx_trimmer.xml Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,70 @@
+<tool id="cshl_fastx_trimmer" name="Trim">
+ <description>sequences</description>
+ <command>zcat -f '$input' | fastx_trimmer -v -f $first -l $last -o $output</command>
+
+ <inputs>
+ <param format="fasta,fastqsolexa" name="input" type="data" label="Library to clip" />
+
+ <param name="first" size="4" type="integer" value="1">
+ <label>First base to keep</label>
+ </param>
+
+ <param name="last" size="4" type="integer" value="21">
+ <label>Last base to keep</label>
+ </param>
+ </inputs>
+
+ <tests>
+ <test>
+ 
+ <param name="input" value="fastx_trimmer1.fasta" />
+ <param name="first" value="5"/>
+ <param name="last" value="36"/>
+ <output name="output" file="fastx_trimmer1.out" />
+ </test>
+ <test>
+ 
+ <param name="input" value="fastx_trimmer2.fastq" />
+ <param name="first" value="1"/>
+ <param name="last" value="27"/>
+ <output name="output" file="fastx_trimmer2.out" />
+ </test>
+ </tests>
+
+ <outputs>
+ <data format="input" name="output" metadata_source="input" />
+ </outputs>
+ <help>
+**What it does**
+
+This tool trims (cut bases from) sequences in a FASTA/Q file.
+
+--------
+
+**Example**
+
+Input Fasta file (with 36 bases in each sequences)::
+
+    >1-1
+    TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC
+    >2-1
+    CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA
+
+
+Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base)::
+
+    >1-1
+    TATGGTCAGAAACCATATGCA
+    >2-1
+    CAGCGAGGCTTTAATGCCATT
+
+Trimming with First=6 and Last=10, will generate a FASTA file with 5 bases (bases 6,7,8,9,10) in each sequences::
+
+    >1-1
+    TCAGA
+    >2-1
+    AGGCT
+
+</help>
+</tool>
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/Makefile.am Thu Aug 14 04:52:17 2014 -0400

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,330 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+subdir = galaxy/tools/fastx_toolkit_with_gzip_and_output_label\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+SOURCES =\n+DIST_SOURCES =\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARATOR@\n+RANLIB = @RANLIB@\n+SET_MAKE = @SET_MAKE@\n+SHELL = @SHELL@\n+STRIP = @STRIP@\n+VERSION = @VERSION@\n+abs_builddir = @abs_builddir@\n+abs_srcdir = @abs_srcdir@\n+abs_top_builddir = @abs_top_builddir@\n+abs_top_srcdir = @abs_top_srcdir@\n+ac_ct_CC = @ac_ct_CC@\n+ac_ct_CXX = @ac_ct_CXX@\n+am__include = @am__include@\n+am__leading_dot = @am__leading_dot@\n+am__quote = @am__quote@\n+am__tar = @am__tar@\n+am__untar = @am__untar@\n+bindir = @bindir@\n+build = @build@\n+build_alias = @build_alias@\n+build_cpu = @build_cpu@\n+build_os = @build_os@\n+build_vendor = @build_vendor@\n+builddir = @builddir@\n+canonical_host_type = @canonical_host_type@\n+datadir = @datadir@\n+datarootdir = @datarootdir@\n+docdir = @docdir@\n+dvidir = @dvidir@\n+exec_prefix = @exec_prefix@\n+host = @host@\n+host_alias = @hos'..b'\\\n+\t *config.status*) \\\n+\t cd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh;; \\\n+\t *) \\\n+\t echo \' cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe)\'; \\\n+\t cd $(top_builddir) && $(SHELL) ./config.status $(subdir)/$@ $(am__depfiles_maybe);; \\\n+\tesac;\n+\n+$(top_builddir)/config.status: $(top_srcdir)/configure $(CONFIG_STATUS_DEPENDENCIES)\n+\tcd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh\n+\n+$(top_srcdir)/configure: $(am__configure_deps)\n+\tcd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh\n+$(ACLOCAL_M4): $(am__aclocal_m4_deps)\n+\tcd $(top_builddir) && $(MAKE) $(AM_MAKEFLAGS) am--refresh\n+tags: TAGS\n+TAGS:\n+\n+ctags: CTAGS\n+CTAGS:\n+\n+\n+distdir: $(DISTFILES)\n+\t@srcdirstrip=`echo "$(srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\ttopsrcdirstrip=`echo "$(top_srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\tlist=\'$(DISTFILES)\'; \\\n+\t dist_files=`for file in $$list; do echo $$file; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-am\n+all-am: Makefile\n+installdirs:\n+install: install-am\n+install-exec: install-exec-am\n+install-data: install-data-am\n+uninstall: uninstall-am\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-am\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-am\n+\n+clean-am: clean-generic mostlyclean-am\n+\n+distclean: distclean-am\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-generic\n+\n+dvi: dvi-am\n+\n+dvi-am:\n+\n+html: html-am\n+\n+info: info-am\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-am\n+\n+install-exec-am:\n+\n+install-html: install-html-am\n+\n+install-info: install-info-am\n+\n+install-man:\n+\n+install-pdf: install-pdf-am\n+\n+install-ps: install-ps-am\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-am\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-am\n+\n+mostlyclean-am: mostlyclean-generic\n+\n+pdf: pdf-am\n+\n+pdf-am:\n+\n+ps: ps-am\n+\n+ps-am:\n+\n+uninstall-am:\n+\n+.MAKE: install-am install-strip\n+\n+.PHONY: all all-am check check-am clean clean-generic distclean \\\n+\tdistclean-generic distdir dvi dvi-am html html-am info info-am \\\n+\tinstall install-am install-data install-data-am install-dvi \\\n+\tinstall-dvi-am install-exec install-exec-am install-html \\\n+\tinstall-html-am install-info install-info-am install-man \\\n+\tinstall-pdf install-pdf-am install-ps install-ps-am \\\n+\tinstall-strip installcheck installcheck-am installdirs \\\n+\tmaintainer-clean maintainer-clean-generic mostlyclean \\\n+\tmostlyclean-generic pdf pdf-am ps ps-am uninstall uninstall-am\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastq_quality_boxplot.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastq_quality_boxplot.xml Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,47 @@
+<tool id="cshl_fastq_quality_boxplot" name="Quality Score">
+ <description>chart</description>
+
+ <command>fastq_quality_boxplot_graph.sh -t '$input.tag' -i $input -o $output</command>
+
+ <inputs>
+ <param format="txt" name="input" type="data" label="Statistics report file (output of 'FASTQ Statistics' tool)" />
+ </inputs>
+
+ <outputs>
+ <data format="png" name="output" label="$input.tag Quality Scores chart" metadata_source="input" />
+ </outputs>
+<help>
+
+**What it does**
+
+Creates a boxplot graph for the quality scores in the library.
+
+.. class:: infomark
+
+**TIP:** Use the **FASTQ Statistics** tool to generate the report file needed for this tool.
+
+-----
+
+**Output Examples**
+
+* Black horizontal lines are medians
+* Rectangular red boxes show the Inter-quartile Range (IQR) (top value is Q3, bottom value is Q1)
+* Whiskers show outlier at max. 1.5*IQR
+
+
+An excellent quality library (median quality is 40 for almost all 36 cycles):
+
+.. image:: ../static/fastx_icons/fastq_quality_boxplot_1.png
+
+
+A relatively good quality library (median quality degrades towards later cycles):
+
+.. image:: ../static/fastx_icons/fastq_quality_boxplot_2.png
+
+A low quality library (median drops quickly):
+
+.. image:: ../static/fastx_icons/fastq_quality_boxplot_3.png
+
+</help>
+</tool>
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastq_quality_filter.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastq_quality_filter.xml Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,80 @@
+<tool id="cshl_fastq_quality_filter" name="Quality Filter">
+ <description></description>
+
+ <command>zcat -f '$input' | fastq_quality_filter $GZIPOUT -q $quality -p $percent -v -o $output</command>
+
+ <inputs>
+ <param format="fastqsolexa" name="input" type="data" label="Library to filter" />
+
+ <param name="quality" size="4" type="integer" value="20">
+ <label>Quality cut-off value</label>
+ </param>
+
+ <param name="percent" size="4" type="integer" value="90">
+ <label>Percent of bases in sequence that must have quality equal to / higher than cut-off value</label>
+ </param>
+
+ <param name="GZIPOUT" type="select" label="Compress output file (using GZIP) ">
+ <option value="-z">yes</option>
+ <option value="">no</option>
+ </param>
+ </inputs>
+
+ <tests>
+ <test>
+ 
+ <param name="input" value="fastq_qual_filter1.fastq" />
+ <param name="quality" value="33"/>
+ <param name="percent" value="100"/>
+ <param name="GZIPOUT" value=""/>
+ <output name="output" file="fastq_qual_filter1a.out" />
+ </test>
+ <test>
+ 
+ <param name="input" value="fastq_qual_filter1.fastq" />
+ <param name="quality" value="20"/>
+ <param name="percent" value="80"/>
+ <param name="GZIPOUT" value=""/>
+ <output name="output" file="fastq_qual_filter1b.out" />
+ </test>
+ </tests>
+
+ <outputs>
+ <data format="input" name="output" label="$input.tag quality-filtered" metadata_source="input" />
+ </outputs>
+
+ <help>
+**What it does**
+
+This tool filters reads based on quality scores.
+
+.. class:: infomark
+
+Using **percent = 100** requires all cycles of all reads to be at least the quality cut-off value.
+
+.. class:: infomark
+
+Using **percent = 50** requires the median quality of the cycles (in each read) to be at least the quality cut-off value.
+
+--------
+
+Quality score distribution (of all cycles) is calculated for each read. If it is lower than the quality cut-off value - the read is discarded.
+
+
+**Example**::
+
+    @CSHL_4_FC042AGOOII:1:2:214:584
+    GACAATAAAC
+    +CSHL_4_FC042AGOOII:1:2:214:584
+    30 30 30 30 30 30 30 30 20 10
+
+Using **percent = 50** and **cut-off = 30** - This read will not be discarded (the median quality is higher than 30).
+
+Using **percent = 90** and **cut-off = 30** - This read will be discarded (90% of the cycles do no have quality equal to / higher than 30).
+
+Using **percent = 100** and **cut-off = 20** - This read will be discarded (not all cycles have quality equal to / higher than 20).
+
+
+ </help>
+</tool>
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastq_to_fasta.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastq_to_fasta.xml Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,77 @@
+<tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA">
+ <description>converter</description>
+ <command>gunzip -cf $input | fastq_to_fasta $GZIPOUT $SKIPN $RENAMESEQ -o $output -v </command>
+
+ <inputs>
+ <param format="fastqsolexa" name="input" type="data" label="FASTQ Library to convert" />
+
+ <param name="SKIPN" type="select" label="Discard sequences with unknown (N) bases ">
+ <option value="">yes</option>
+ <option value="-n">no</option>
+ </param>
+
+ <param name="GZIPOUT" type="select" label="Compress output file (using GZIP) ">
+ <option value="-z">yes</option>
+ <option value="">no</option>
+ </param>
+
+ <param name="RENAMESEQ" type="select" label="Rename sequence names in output file (reduces file size)">
+ <option value="-r">yes</option>
+ <option value="">no</option>
+ </param>
+
+ </inputs>
+
+ <tests>
+ <test>
+ 
+ <param name="input" value="fastq_to_fasta1.fastq" />
+ <param name="SKIPN" value=""/>
+ <param name="GZIPOUT" value=""/>
+ <param name="RENAMESEQ" value=""/>
+ <output name="output" file="fastq_to_fasta1a.out" />
+ </test>
+ <test>
+ 
+ <param name="input" value="fastq_to_fasta1.fastq" />
+ <param name="SKIPN" value="no"/>
+ <param name="GZIPOUT" value=""/>
+ <param name="RENAMESEQ" value="yes"/>
+ <output name="output" file="fastq_to_fasta1b.out" />
+ </test>
+ </tests>
+
+ <outputs>
+ <data format="fasta" name="output" metadata_source="input" label="$input.tag FASTA" />
+ </outputs>
+
+<help>
+
+**What it does**
+
+This tool converts data from Solexa format to FASTA format (scroll down for format description).
+
+--------
+
+**Example**
+
+The following data in Solexa-FASTQ format::
+
+    @CSHL_4_FC042GAMMII_2_1_517_596
+    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+    +CSHL_4_FC042GAMMII_2_1_517_596
+    40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
+
+Will be converted to FASTA (with 'rename sequence names' = NO)::
+
+    >CSHL_4_FC042GAMMII_2_1_517_596
+    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+
+Will be converted to FASTA (with 'rename sequence names' = YES)::
+
+    >1
+    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+
+</help>
+</tool>
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastx_clipper.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastx_clipper.xml Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,116 @@
+<tool id="cshl_fastx_clipper" name="Clip" version="1.0.1" >
+  <description>adapter sequences</description>
+  <command>
+    zcat -f $input | fastx_clipper $GZIPOUT -s $maxmismatches -l $minlength -a $clip_source.clip_sequence -d $keepdelta -o $output -v $KEEP_N $DISCARD_OPTIONS
+  </command>
+
+  <inputs>
+    <param format="fasta,fastqsolexa" name="input" type="data" label="Library to clip" />
+
+    <param name="maxmismatches" size="4" type="integer" value="2">
+      <label>Maximum number of mismatches allowed (when matching the adapter sequence)</label>
+    </param>
+
+    <param name="minlength" size="4" type="integer" value="15">
+      <label>Minimum sequence length (after clipping, sequences shorter than this length will be discarded)</label>
+    </param>
+
+ <conditional name="clip_source">
+ <param name="clip_source_list" type="select" label="Source">
+ <option value="prebuilt" selected="true">Standard (select from the list below)</option>
+ <option value="user">Enter custom sequence</option>
+ </param>
+
+ <when value="user">
+ <param name="clip_sequence" size="30" label="Enter custom clipping sequence" type="text" value="AATTGGCC" />
+ </when>
+
+ <when value="prebuilt">
+ <param name="clip_sequence" type="select" label="Choose Adapter">
+ <options from_file="fastx_clipper_sequences.txt">
+ <column name="name" index="1"/>
+ <column name="value" index="0"/>
+ </options>
+ </param>
+ </when>
+ </conditional>
+
+ <param name="keepdelta" size="2" type="integer" value="0">
+ <label>enter non-zero value to keep the adapter sequence and x bases that follow it</label>
+ <help>use this for hairpin barcoding. keep at 0 unless you know what you're doing.</help>
+ </param>
+
+ <param name="KEEP_N" type="select" label="Discard sequences with unknown (N) bases">
+ <option value="">Yes</option>
+ <option value="-n">No</option>
+ </param>
+
+ <param name="DISCARD_OPTIONS" type="select" label="Output options">
+ <option value="-c">Output only clipped seqeunces (i.e. sequences which contained the adapter)</option>
+ <option value="-C">Output only non-clipped seqeunces (i.e. sequences which did not contained the adapter)</option>
+ <option value="">Output both clipped and non-clipped sequences</option>
+ </param>
+
+    <param name="GZIPOUT" type="select" label="Compress output file (using GZIP) ">
+       <option value="-z">yes</option>
+       <option value="">no</option>
+    </param>
+
+
+  </inputs>
+
+ <tests>
+ <test>
+ 
+ <param name="input" value="fastx_clipper1.fastq" />
+ <param name="maxmismatches" value="2" />
+ <param name="minlength" value="15" />
+ <param name="clip_source.clip_source_list" value="user" />
+ <param name="clip_source.clip_sequence" value="CAATTGGTTAATCCCCCTATATA" />
+ <param name="keepdelta" value="0" />
+ <param name="KEEP_N" value="-n" />
+ <param name="DISCARD_OPTIONS" value="-c" />
+ <param name="GZIPOUT" value=""/>
+ <output name="output" file="fastx_clipper1a.out" />
+ </test>
+ </tests>
+
+  <outputs>
+    <data format="input" name="output" label="$input.tag clipped" metadata_source="input" />
+  </outputs>
+
+<help>
+**What it does**
+
+This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file.
+
+--------
+
+
+**Clipping Illustration:**
+
+.. image:: ../static/fastx_icons/fastx_clipper_illustration.png
+
+
+
+
+
+
+
+
+**Clipping Example:**
+
+.. image:: ../static/fastx_icons/fastx_clipper_example.png
+
+
+
+**In the above example:**
+
+* Sequence no. 1 was discarded since it wasn't clipped (i.e. didn't contain the adapter sequence). (**Output** parameter).
+* Sequence no. 5 was discarded --- it's length (after clipping) was shorter than 15 nt (**Minimum Sequence Length** parameter).
+
+
+
+
+</help>
+</tool>

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastx_collapser.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastx_collapser.xml Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,83 @@
+<tool id="cshl_fastx_collapser" name="Collapse">
+ <description>sequences</description>
+ <command>zcat -f '$input' | fastx_collapser -v -o '$output' </command>
+
+ <inputs>
+ <param format="fastqsolexa,fasta" name="input" type="data" label="Library to collapse" />
+
+ 
+ </inputs>
+
+ <tests>
+ <test>
+ <param name="input" value="fasta_collapser1.fasta" />
+ <param name="GZIPOUT" value=""/>
+ <output name="output" file="fasta_collapser1.out" />
+ </test>
+ </tests>
+
+ <outputs>
+ <data format="fasta" name="output" metadata_source="input" label="$input.tag collapsed" />
+ </outputs>
+  <help>
+
+**What it does**
+
+This tool collapses identical sequences in a FASTA file into a single sequence.
+
+--------
+
+**Example**
+
+Example Input File (Sequence "ATAT" appears multiple times)::
+
+    >CSHL_2_FC0042AGLLOO_1_1_605_414
+    TGCG
+    >CSHL_2_FC0042AGLLOO_1_1_537_759
+    ATAT
+    >CSHL_2_FC0042AGLLOO_1_1_774_520
+    TGGC
+    >CSHL_2_FC0042AGLLOO_1_1_742_502
+    ATAT
+    >CSHL_2_FC0042AGLLOO_1_1_781_514
+    TGAG
+    >CSHL_2_FC0042AGLLOO_1_1_757_487
+    TTCA
+    >CSHL_2_FC0042AGLLOO_1_1_903_769
+    ATAT
+    >CSHL_2_FC0042AGLLOO_1_1_724_499
+    ATAT
+
+Example Output file::
+
+    >1-1
+    TGCG
+    >2-4
+    ATAT
+    >3-1
+    TGGC
+    >4-1
+    TGAG
+    >5-1
+    TTCA
+
+.. class:: infomark
+
+Original Sequence Names / Lane descriptions (e.g. "CSHL_2_FC0042AGLLOO_1_1_742_502") are discarded.
+
+The output seqeunce name is composed of two numbers: the first is the sequence's number, the second is the multiplicity value.
+
+The following output::
+
+    >2-4
+    ATAT
+
+means that the sequence "ATAT" is the second sequence in the file, and it appeared 4 times in the input FASTA file.
+
+</help>
+</tool>

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastx_trimmer.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/galaxy/tools/fastx_toolkit_with_gzip_and_output_label/fastx_trimmer.xml Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,77 @@
+<tool id="cshl_fastx_trimmer" name="Trim">
+ <description>sequences</description>
+ <command>zcat -f '$input' | fastx_trimmer $GZIPOUT -v -f $first -l $last -o $output</command>
+
+ <inputs>
+ <param format="fasta,fastqsolexa" name="input" type="data" label="Library to clip" />
+
+ <param name="first" size="4" type="integer" value="1">
+ <label>First base to keep</label>
+ </param>
+
+ <param name="last" size="4" type="integer" value="21">
+ <label>Last base to keep</label>
+ </param>
+
+ <param name="GZIPOUT" type="select" label="Compress output file (using GZIP) ">
+ <option value="-z">yes</option>
+ <option value="">no</option>
+ </param>
+ </inputs>
+
+ <tests>
+ <test>
+ 
+ <param name="input" value="fastx_trimmer1.fasta" />
+ <param name="first" value="5"/>
+ <param name="last" value="36"/>
+ <param name="GZIPOUT" value=""/>
+ <output name="output" file="fastx_trimmer1.out" />
+ </test>
+ <test>
+ 
+ <param name="input" value="fastx_trimmer2.fastq" />
+ <param name="first" value="1"/>
+ <param name="last" value="27"/>
+ <param name="GZIPOUT" value=""/>
+ <output name="output" file="fastx_trimmer2.out" />
+ </test>
+ </tests>
+
+ <outputs>
+ <data format="input" name="output" label="$input.tag trimmed" metadata_source="input" />
+ </outputs>
+ <help>
+**What it does**
+
+This tool trims (cut bases from) sequences in a FASTA/Q file.
+
+--------
+
+**Example**
+
+Input Fasta file (with 36 bases in each sequences)::
+
+    >1-1
+    TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC
+    >2-1
+    CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA
+
+
+Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base)::
+
+    >1-1
+    TATGGTCAGAAACCATATGCA
+    >2-1
+    CAGCGAGGCTTTAATGCCATT
+
+Trimming with First=6 and Last=10, will generate a FASTA file with 5 bases (bases 6,7,8,9,10) in each sequences::
+
+    >1-1
+    TCAGA
+    >2-1
+    AGGCT
+
+</help>
+</tool>
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/install_galaxy_files.sh
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/install_galaxy_files.sh Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,123 @@
+#!/bin/sh
+
+#
+# Arguments check and suage information
+#
+SRC="."
+DEST="$1"
+if [ -z "$DEST" ]; then
+cat<<EOF
+
+FASTX-toolkit Galaxy Installation script.
+
+This script copies the FASTX-Toolkit files into the specified Galaxy directory.
+
+Usage: $0 [GALAXY-DIRECTORY]
+
+ GALAXY-DIRECTORY - root directory of the Galaxy server.
+
+EOF
+ exit
+fi
+
+
+echo
+echo "FASTX-toolkit Galaxy Installation script."
+echo
+
+#
+# Sanity checks for the specified galaxy directory
+#
+echo -n "Checking Galaxy destination directory..."
+[ -d "$DEST" ] ||
+    { echo "Error: directory '$DEST' does not exist!" ; exit 1 ; }
+
+[ -r "$DEST/tool_conf.xml" ] ||
+    { echo "Error: file '$DEST/tool_conf.xml' does not exist! (is '$DEST' the root of the Galaxy server?)" ; exit 1 ; }
+
+for subdir in tools tool-data test-data static; do
+ [ -d "$DEST/$subdir" ] ||
+ { echo "Error: sub-directory '$DEST/$subdir' does not exist! (is '$DEST' the root of the Galaxy server?)" ; exit 1 ; }
+done
+echo "ok"
+
+#
+# Sanity checks for the FASTX-toolkit files
+#
+echo -n "Checking FASTX-toolkit source directory..."
+[ -r "$SRC/galaxy/fastx_toolkit_conf.xml" ] ||
+    { echo "Error: file '$SRC/galaxy/fastx_toolkit_conf.xml' does not exist! (is '$SRC' the root of FASTX-toolkit ?)" ; exit 1 ; }
+
+for subdir in tools tools/fastx_toolkit tool-data test-data static static/fastx_icons; do
+ [ -d "$SRC/galaxy/$subdir" ] ||
+ { echo "Error: sub-directory '$SRC/galaxy/$subdir' does not exist! (is '$SRC' the root of FASTX-toolkit?)" ; exit 1 ; }
+done
+echo "ok"
+
+
+#
+# Copy FASTX-Toolkit files into Galaxy server
+#
+echo -n "Creating static/fastx_icons directory..."
+mkdir -p "$DEST/static/fastx_icons" || exit 1 ;
+echo "OK"
+
+echo -n "Copying static/fastx_icons..."
+cp $SRC/galaxy/static/fastx_icons/*.png "$DEST/static/fastx_icons" || exit 1 ;
+echo "OK"
+
+echo -n "Copying test-data files..."
+cp $SRC/galaxy/test-data/fast* "$DEST/test-data" || exit 1 ;
+echo "OK"
+
+echo -n "Copying tool-data files..."
+cp $SRC/galaxy/tool-data/fastx_clipper_sequences.txt "$DEST/tool-data/" || exit 1;
+echo "OK"
+
+echo -n "Creaing tools/fastx_toolkit directory..."
+mkdir -p "$DEST/tools/fastx_toolkit" || exit 1;
+echo "OK"
+
+#
+# Be extra careful when copying the XML files -
+# Ask the user for confirmation if the XML files already exists
+# (so that if they were changed, they will not be blindly overwriten)
+echo "==="
+echo "=== NOTE:"
+echo "==="
+echo "If the FASTX-toolkit XML files already exist on your galaxy server,"
+echo "You will be prompted to confirm overwriting them."
+echo "If you have made any changes to the XML files, DO NOT overwrite your files."
+echo
+echo -n "Copying FASTX-toolkit XML tool configuration..."
+cp -i $SRC/galaxy/tools/fastx_toolkit/*.xml "$DEST/tools/fastx_toolkit"
+echo "ok"
+
+
+
+#
+# Instruct the user what to do next
+#
+cat<<EOF
+FASTX-toolkit files copied to your galaxy server directory.
+
+Additionally, you'll need to make the following manual configurations:
+
+1. Add the content of
+ $SRC/galaxy/fastx_toolkit_conf.xml
+   to
+ $DEST/tool_conf.xml
+
+2. Update the adapters file:
+
+ $DEST/tool-data/fastx_clipper_sequences.txt
+
+   And add valid adapters/linkers.
+
+3. Edit "fastx_barcode_splitter_galaxy_wrapper.sh", change
+   The two variables BASEPATH and PUBLICURL to valid path/URL.
+   See README for detailed explanation (under the
+   "Special configuration for Barcode-Splitter" section).
+
+EOF
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/m4/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/m4/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,20 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+# Install m4 macros in this directory
+m4datadir = $(datadir)/aclocal
+
+# List your m4 macros here
+m4macros =
+
+# The following is boilerplate
+m4data_DATA = $(m4macros)
+EXTRA_DIST = $(m4data_DATA)
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/m4/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/m4/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,357 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+subdir = m4\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+SOURCES =\n+DIST_SOURCES =\n+am__vpath_adj_setup = srcdirstrip=`echo "$(srcdir)" | sed \'s|.|.|g\'`;\n+am__vpath_adj = case $$p in \\\n+ $(srcdir)/*) f=`echo "$$p" | sed "s|^$$srcdirstrip/||"`;; \\\n+ *) f=$$p;; \\\n+ esac;\n+am__strip_dir = `echo $$p | sed -e \'s|^.*/||\'`;\n+am__installdirs = "$(DESTDIR)$(m4datadir)"\n+m4dataDATA_INSTALL = $(INSTALL_DATA)\n+DATA = $(m4data_DATA)\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARATOR@\n+RANLIB = @RANLIB@\n+SET_MAKE = @SET_MAKE@\n+SHELL = @SHELL@\n+STRIP = @STRIP@\n+VERSION = @VERSION@\n+abs_builddir = @abs_builddir@\n+abs_srcdir = @abs_srcdir@\n+abs_top_builddir = @abs_top_builddir@\n+abs_top_srcdir = @abs_top_srcdir@\n+ac_ct_CC = @ac_ct_CC@\n+ac_ct_CXX = @ac_ct_CXX@\n+am__include = @am__include@\n+am__leading_dot = @am__leading_dot@\n+am__quote = @am__quote@\n+am__tar = @am__tar@\n+am__untar = @am__untar@\n+bindir = @bindir@\n+build = @build@\n+build_alias = @build_alias'..b'r p in $$list; do \\\n+\t if test -f "$$p"; then d=; else d="$(srcdir)/"; fi; \\\n+\t f=$(am__strip_dir) \\\n+\t echo " $(m4dataDATA_INSTALL) \'$$d$$p\' \'$(DESTDIR)$(m4datadir)/$$f\'"; \\\n+\t $(m4dataDATA_INSTALL) "$$d$$p" "$(DESTDIR)$(m4datadir)/$$f"; \\\n+\tdone\n+\n+uninstall-m4dataDATA:\n+\t@$(NORMAL_UNINSTALL)\n+\t@list=\'$(m4data_DATA)\'; for p in $$list; do \\\n+\t f=$(am__strip_dir) \\\n+\t echo " rm -f \'$(DESTDIR)$(m4datadir)/$$f\'"; \\\n+\t rm -f "$(DESTDIR)$(m4datadir)/$$f"; \\\n+\tdone\n+tags: TAGS\n+TAGS:\n+\n+ctags: CTAGS\n+CTAGS:\n+\n+\n+distdir: $(DISTFILES)\n+\t@srcdirstrip=`echo "$(srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\ttopsrcdirstrip=`echo "$(top_srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\tlist=\'$(DISTFILES)\'; \\\n+\t dist_files=`for file in $$list; do echo $$file; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-am\n+all-am: Makefile $(DATA)\n+installdirs:\n+\tfor dir in "$(DESTDIR)$(m4datadir)"; do \\\n+\t test -z "$$dir" || $(MKDIR_P) "$$dir"; \\\n+\tdone\n+install: install-am\n+install-exec: install-exec-am\n+install-data: install-data-am\n+uninstall: uninstall-am\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-am\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-am\n+\n+clean-am: clean-generic mostlyclean-am\n+\n+distclean: distclean-am\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-generic\n+\n+dvi: dvi-am\n+\n+dvi-am:\n+\n+html: html-am\n+\n+info: info-am\n+\n+info-am:\n+\n+install-data-am: install-m4dataDATA\n+\n+install-dvi: install-dvi-am\n+\n+install-exec-am:\n+\n+install-html: install-html-am\n+\n+install-info: install-info-am\n+\n+install-man:\n+\n+install-pdf: install-pdf-am\n+\n+install-ps: install-ps-am\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-am\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-am\n+\n+mostlyclean-am: mostlyclean-generic\n+\n+pdf: pdf-am\n+\n+pdf-am:\n+\n+ps: ps-am\n+\n+ps-am:\n+\n+uninstall-am: uninstall-m4dataDATA\n+\n+.MAKE: install-am install-strip\n+\n+.PHONY: all all-am check check-am clean clean-generic distclean \\\n+\tdistclean-generic distdir dvi dvi-am html html-am info info-am \\\n+\tinstall install-am install-data install-data-am install-dvi \\\n+\tinstall-dvi-am install-exec install-exec-am install-html \\\n+\tinstall-html-am install-info install-info-am \\\n+\tinstall-m4dataDATA install-man install-pdf install-pdf-am \\\n+\tinstall-ps install-ps-am install-strip installcheck \\\n+\tinstallcheck-am installdirs maintainer-clean \\\n+\tmaintainer-clean-generic mostlyclean mostlyclean-generic pdf \\\n+\tpdf-am ps ps-am uninstall uninstall-am uninstall-m4dataDATA\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/reconf
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/reconf Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,21 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+#!/bin/sh
+rm -f config.cache
+echo "- aclocal."
+aclocal -I m4
+echo "- autoconf."
+autoconf
+echo "- autoheader."
+autoheader
+echo "- automake."
+automake -a
+exit

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/scripts/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/scripts/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,21 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+bin_SCRIPTS = fastx_barcode_splitter.pl \
+       fastx_barcode_splitter_galaxy_wrapper.sh \
+       fastx_nucleotide_distribution_graph.sh \
+       fastq_quality_boxplot_graph.sh \
+       fasta_clipping_histogram.pl
+
+EXTRA_DIST = fastx_barcode_splitter.pl \
+       fastx_barcode_splitter_galaxy_wrapper.sh \
+       fastx_nucleotide_distribution_graph.sh \
+       fastq_quality_boxplot_graph.sh \
+       fasta_clipping_histogram.pl

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/scripts/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/scripts/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,355 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+subdir = scripts\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+am__installdirs = "$(DESTDIR)$(bindir)"\n+binSCRIPT_INSTALL = $(INSTALL_SCRIPT)\n+SCRIPTS = $(bin_SCRIPTS)\n+SOURCES =\n+DIST_SOURCES =\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARATOR@\n+RANLIB = @RANLIB@\n+SET_MAKE = @SET_MAKE@\n+SHELL = @SHELL@\n+STRIP = @STRIP@\n+VERSION = @VERSION@\n+abs_builddir = @abs_builddir@\n+abs_srcdir = @abs_srcdir@\n+abs_top_builddir = @abs_top_builddir@\n+abs_top_srcdir = @abs_top_srcdir@\n+ac_ct_CC = @ac_ct_CC@\n+ac_ct_CXX = @ac_ct_CXX@\n+am__include = @am__include@\n+am__leading_dot = @am__leading_dot@\n+am__quote = @am__quote@\n+am__tar = @am__tar@\n+am__untar = @am__untar@\n+bindir = @bindir@\n+build = @build@\n+build_alias = @build_alias@\n+build_cpu = @build_cpu@\n+build_os = @build_os@\n+build_vendor = @build_vendor@\n+builddir = @builddir@\n+canonical_host_type = @canonical_host_type@\n+datadir = @datadir@\n+datarootdir = @datarootdir@\n+docdir = @docdir@\n+dvidir = @dvidir@\n'..b'$d$$p; then \\\n+\t f=`echo "$$p" | sed \'s|^.*/||;$(transform)\'`; \\\n+\t echo " $(binSCRIPT_INSTALL) \'$$d$$p\' \'$(DESTDIR)$(bindir)/$$f\'"; \\\n+\t $(binSCRIPT_INSTALL) "$$d$$p" "$(DESTDIR)$(bindir)/$$f"; \\\n+\t else :; fi; \\\n+\tdone\n+\n+uninstall-binSCRIPTS:\n+\t@$(NORMAL_UNINSTALL)\n+\t@list=\'$(bin_SCRIPTS)\'; for p in $$list; do \\\n+\t f=`echo "$$p" | sed \'s|^.*/||;$(transform)\'`; \\\n+\t echo " rm -f \'$(DESTDIR)$(bindir)/$$f\'"; \\\n+\t rm -f "$(DESTDIR)$(bindir)/$$f"; \\\n+\tdone\n+tags: TAGS\n+TAGS:\n+\n+ctags: CTAGS\n+CTAGS:\n+\n+\n+distdir: $(DISTFILES)\n+\t@srcdirstrip=`echo "$(srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\ttopsrcdirstrip=`echo "$(top_srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\tlist=\'$(DISTFILES)\'; \\\n+\t dist_files=`for file in $$list; do echo $$file; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-am\n+all-am: Makefile $(SCRIPTS)\n+installdirs:\n+\tfor dir in "$(DESTDIR)$(bindir)"; do \\\n+\t test -z "$$dir" || $(MKDIR_P) "$$dir"; \\\n+\tdone\n+install: install-am\n+install-exec: install-exec-am\n+install-data: install-data-am\n+uninstall: uninstall-am\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-am\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-am\n+\n+clean-am: clean-generic mostlyclean-am\n+\n+distclean: distclean-am\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-generic\n+\n+dvi: dvi-am\n+\n+dvi-am:\n+\n+html: html-am\n+\n+info: info-am\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-am\n+\n+install-exec-am: install-binSCRIPTS\n+\n+install-html: install-html-am\n+\n+install-info: install-info-am\n+\n+install-man:\n+\n+install-pdf: install-pdf-am\n+\n+install-ps: install-ps-am\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-am\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-am\n+\n+mostlyclean-am: mostlyclean-generic\n+\n+pdf: pdf-am\n+\n+pdf-am:\n+\n+ps: ps-am\n+\n+ps-am:\n+\n+uninstall-am: uninstall-binSCRIPTS\n+\n+.MAKE: install-am install-strip\n+\n+.PHONY: all all-am check check-am clean clean-generic distclean \\\n+\tdistclean-generic distdir dvi dvi-am html html-am info info-am \\\n+\tinstall install-am install-binSCRIPTS install-data \\\n+\tinstall-data-am install-dvi install-dvi-am install-exec \\\n+\tinstall-exec-am install-html install-html-am install-info \\\n+\tinstall-info-am install-man install-pdf install-pdf-am \\\n+\tinstall-ps install-ps-am install-strip installcheck \\\n+\tinstallcheck-am installdirs maintainer-clean \\\n+\tmaintainer-clean-generic mostlyclean mostlyclean-generic pdf \\\n+\tpdf-am ps ps-am uninstall uninstall-am uninstall-binSCRIPTS\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/scripts/fasta_clipping_histogram.pl
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/scripts/fasta_clipping_histogram.pl Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,104 @@
+#!/usr/bin/perl
+
+#    FASTX-toolkit - FASTA/FASTQ preprocessing tools.
+#    Copyright (C) 2009  A. Gordon (gordon@cshl.edu)
+#
+#   This program is free software: you can redistribute it and/or modify
+#   it under the terms of the GNU Affero General Public License as
+#   published by the Free Software Foundation, either version 3 of the
+#   License, or (at your option) any later version.
+#
+#   This program is distributed in the hope that it will be useful,
+#   but WITHOUT ANY WARRANTY; without even the implied warranty of
+#   MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+#   GNU Affero General Public License for more details.
+#
+#    You should have received a copy of the GNU Affero General Public License
+#    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+
+use strict;
+use warnings;
+use GD::Graph::bars;
+use Data::Dumper;
+use PerlIO::gzip;
+
+if (scalar @ARGV==0) {
+ print<<END;
+
+Create a Linker Clipping Information Histogram
+
+usage: $0 INPUT_FILE.FA OUTPUT_FILE.PNG
+
+ INPUT_FILE.FA   = input file (in FASTA format, can be GZIPped)
+ OUTPUT_FILE.PNG = histogram image
+
+END
+ exit 0;
+}
+
+#
+# Read parameters
+#
+open(IN, "<:gzip(autopop)", "$ARGV[0]") or die "Cannot open input file $ARGV[0]\n";
+open(OUT, ">$ARGV[1]") or die "Cannot create output file $ARGV[1]\n";
+binmode OUT;
+
+my %histogram ;
+
+while (my $name = <IN>) {
+ my $sequence = <IN> ;
+ chomp $sequence;
+
+ my $sequence_length = length($sequence);
+
+ my $count;
+
+ if ( index($name, "-")==-1 ) {
+ #Assume this file is not collapsed, just count each seqeunce as 1
+ $count = 1 ;
+ } else  {
+ #Assume file is collapsed (that is - sequence-ID has two numbers with a separating dash)
+ (undef, $count) = $name =~ /^\>(\d+)\-(\d+)$/ ;
+
+ # If the match failed, treat this fasta as not collapsed;
+ $count = 1 if not defined $count ;
+ }
+
+ $histogram{$sequence_length} += $count ;
+}
+
+#Textual Output
+if (0) {
+ print "Length\tCount\n";
+ foreach my $length_key ( sort { $a <=> $b } keys %histogram ) {
+ print $length_key,"\t", $histogram{$length_key},"\n";
+ }
+ exit 0;
+}
+
+## Build the data as required by GD::Graph::bars.
+## Data list has two items (each item is itself a list)
+##   1. a list of x-axis labels (these are the keys from the histogram)
+##   2. a list of values
+my @data = (
+ [ sort { $a <=> $b } keys %histogram ],
+ [ map { $histogram{$_} } sort { $a <=> $b } keys %histogram ] ) ;
+
+my $graph = new GD::Graph::bars (1000,800);
+
+$graph->set(
+ x_label => 'Length',
+ y_label => 'Amount',
+ title => 'Sequences lengths Distribution (after clipping)',
+ bar_spacing => 10,
+ transparent => 0,
+ t_margin => 10,
+ y_tick_number => 20,
+ y_long_ticks => 1,
+ )  or die $graph->error;
+
+$graph->plot(\@data) or die $graph->error;
+print OUT $graph->gd->png;
+
+close IN;
+close OUT;

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/scripts/fastq_quality_boxplot_graph.sh
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/scripts/fastq_quality_boxplot_graph.sh Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,94 @@
+#!/bin/sh
+
+#    FASTX-toolkit - FASTA/FASTQ preprocessing tools.
+#    Copyright (C) 2009  A. Gordon (gordon@cshl.edu)
+#
+#   This program is free software: you can redistribute it and/or modify
+#   it under the terms of the GNU Affero General Public License as
+#   published by the Free Software Foundation, either version 3 of the
+#   License, or (at your option) any later version.
+#
+#   This program is distributed in the hope that it will be useful,
+#   but WITHOUT ANY WARRANTY; without even the implied warranty of
+#   MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+#   GNU Affero General Public License for more details.
+#
+#    You should have received a copy of the GNU Affero General Public License
+#    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+
+function usage()
+{
+ echo "Solexa-Quality BoxPlot plotter"
+ echo "Generates a solexa quality score box-plot graph "
+ echo
+ echo "Usage: $0 [-i INPUT.TXT] [-t TITLE] [-p] [-o OUTPUT]"
+ echo
+ echo "  [-p]           - Generate PostScript (.PS) file. Default is PNG image."
+ echo "  [-i INPUT.TXT] - Input file. Should be the output of \"solexa_quality_statistics\" program."
+ echo "  [-o OUTPUT]    - Output file name. default is STDOUT."
+ echo "  [-t TITLE]     - Title (usually the solexa file name) - will be plotted on the graph."
+ echo
+ exit
+}
+
+#
+# Input Data columns: #pos cnt min max sum        mean Q1 med Q3 IQR lW rW A_Count C_Count G_Count T_Count N_Count
+#  As produced by "solexa_quality_statistics" program
+
+TITLE="" # default title is empty
+FILENAME=""
+OUTPUTTERM="set term png size 2048,768" # default output terminal is "PNG"
+OUTPUTFILE="/dev/stdout"    # Default output file is simply "stdout"
+while getopts ":t:i:o:ph" Option
+ do
+ case $Option in
+ # w ) CMD=$OPTARG; FILENAME="PIMSLogList.txt"; TARGET="logfiles"; ;;
+ t ) TITLE="for $OPTARG" ;;
+ i ) FILENAME=$OPTARG ;;
+ o ) OUTPUTFILE="$OPTARG" ;;
+ p ) OUTPUTTERM="set term postscript enhanced color \"Helvetica\" 8" ;;
+ h ) usage ;;
+ * ) echo "unrecognized argument. use '-h' for usage information."; exit -1 ;;
+ esac
+done
+shift $(($OPTIND - 1))
+
+
+if [ "$FILENAME" == "" ]; then
+ usage
+fi
+
+if [ ! -r "$FILENAME" ]; then
+ echo "Error: can't open input file ($1)." >&2
+ exit 1
+fi
+
+#Read number of cycles from the stats file (each line is a cycle, minus the header line)
+#But for the graph, I want xrange to reach (num_cycles+1), so I don't subtract 1 now.
+NUM_CYCLES=$(cat "$FILENAME" | wc -l)
+
+GNUPLOTCMD="
+$OUTPUTTERM
+set boxwidth 0.8
+set size 1,1
+set key Left inside
+set xlabel \"read position\"
+set ylabel \"Quality Score (Solexa Scale: 40=Highest, -15=Lowest)\"
+set title  \"Quality Scores $TITLE\"
+#set auto x
+set bars 4.0
+set xrange [ 0: $NUM_CYCLES ]
+set yrange [-15:45]
+set y2range [-15:45]
+set xtics 1
+set x2tics 1
+set ytics 2
+set y2tics 2
+set tics out
+set grid ytics
+set style fill empty
+plot '$FILENAME' using 1:7:11:12:9 with candlesticks lt 1  lw 1 title 'Quartiles' whiskerbars, \
+      ''         using 1:8:8:8:8 with candlesticks lt -1 lw 2 title 'Medians'
+"
+
+echo "$GNUPLOTCMD" | gnuplot > "$OUTPUTFILE"

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/scripts/fastx_barcode_splitter.pl
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/scripts/fastx_barcode_splitter.pl Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,472 @@\n+#!/usr/bin/perl\n+\n+# FASTX-toolkit - FASTA/FASTQ preprocessing tools.\n+# Copyright (C) 2009 A. Gordon (gordon@cshl.edu)\n+#\n+# This program is free software: you can redistribute it and/or modify\n+# it under the terms of the GNU Affero General Public License as\n+# published by the Free Software Foundation, either version 3 of the\n+# License, or (at your option) any later version.\n+#\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY; without even the implied warranty of\n+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\n+# GNU Affero General Public License for more details.\n+#\n+# You should have received a copy of the GNU Affero General Public License\n+# along with this program. If not, see <http://www.gnu.org/licenses/>.\n+\n+use strict;\n+use warnings;\n+use IO::Handle;\n+use Data::Dumper;\n+use Getopt::Long;\n+use Carp;\n+\n+##\n+## This program splits a FASTQ/FASTA file into several smaller files,\n+## Based on barcode matching.\n+##\n+## run with "--help" for usage information\n+##\n+## Assaf Gordon <gordon@cshl.edu> , 11sep2008\n+\n+# Forward declarations\n+sub load_barcode_file ($);\n+sub parse_command_line ;\n+sub match_sequences ;\n+sub mismatch_count($$) ;\n+sub print_results;\n+sub open_and_detect_input_format;\n+sub read_record;\n+sub write_record($);\n+sub usage();\n+\n+# Global flags and arguments, \n+# Set by command line argumens\n+my $barcode_file ;\n+my $barcodes_at_eol = 0 ;\n+my $barcodes_at_bol = 0 ;\n+my $exact_match = 0 ;\n+my $allow_partial_overlap = 0;\n+my $allowed_mismatches = 1;\n+my $newfile_suffix = \'\';\n+my $newfile_prefix ;\n+my $quiet = 0 ;\n+my $debug = 0 ;\n+my $fastq_format = 1;\n+\n+# Global variables \n+# Populated by \'create_output_files\'\n+my %filenames;\n+my %files;\n+my %counts = ( \'unmatched\' => 0 );\n+my $barcodes_length;\n+my @barcodes;\n+my $input_file_io;\n+\n+\n+# The Four lines per record in FASTQ format.\n+# (when using FASTA format, only the first two are used)\n+my $seq_name;\n+my $seq_bases;\n+my $seq_name2;\n+my $seq_qualities;\n+\n+\n+#\n+# Start of Program\n+#\n+parse_command_line ;\n+\n+load_barcode_file ( $barcode_file ) ;\n+\n+open_and_detect_input_format;\n+\n+match_sequences ;\n+\n+print_results unless $quiet;\n+\n+#\n+# End of program\n+#\n+\n+\n+\n+\n+\n+\n+\n+\n+sub parse_command_line {\n+\tmy $help;\n+\n+\tusage() if (scalar @ARGV==0);\n+\n+\tmy $result = GetOptions ( "bcfile=s" => \\$barcode_file,\n+\t\t\t\t "eol" => \\$barcodes_at_eol,\n+\t\t\t\t "bol" => \\$barcodes_at_bol,\n+\t\t\t\t "exact" => \\$exact_match,\n+\t\t\t\t "prefix=s" => \\$newfile_prefix,\n+\t\t\t\t "suffix=s" => \\$newfile_suffix,\n+\t\t\t\t "quiet" => \\$quiet, \n+\t\t\t\t "partial=i" => \\$allow_partial_overlap,\n+\t\t\t\t "debug" => \\$debug,\n+\t\t\t\t "mismatches=i" => \\$allowed_mismatches,\n+\t\t\t\t "help" => \\$help\n+\t\t\t\t ) ;\n+\t\n+\tusage() if ($help);\n+\n+\tdie "Error: barcode file not specified (use \'--bcfile [FILENAME]\')\\n" unless defined $barcode_file;\n+\tdie "Error: prefix path/filename not specified (use \'--prefix [PATH]\')\\n" unless defined $newfile_prefix;\n+\n+\tif ($barcodes_at_bol == $barcodes_at_eol) {\n+\t\tdie "Error: can\'t specify both --eol & --bol\\n" if $barcodes_at_eol;\n+\t\tdie "Error: must specify either --eol or --bol\\n" ;\n+\t}\n+\n+\tdie "Error: invalid for value partial matches (valid values are 0 or greater)\\n" if $allow_partial_overlap<0;\n+\n+\t$allowed_mismatches = 0 if $exact_match;\n+\n+\tdie "Error: invalid value for mismatches (valid values are 0 or more)\\n" if ($allowed_mismatches<0);\n+\n+\tdie "Error: partial overlap value ($allow_partial_overlap) bigger than " . \n+\t\t"max. allowed mismatches ($allowed_mismatches)\\n" if ($allow_partial_overlap > $allowed_mismatches);\n+\n+\n+\texit unless $result;\n+}\n+\n+\n+\n+#\n+# Read the barcode file\n+#\n+sub load_barcode_file ($) {\n+\tmy $filename = shift or croak "Missing barcode file name";\n+\n+\topen BCFILE,"<$filename" or die "Error: failed to open barcode file ($filename)\\n";\n+\twhile (<BCFILE>) {\n+\t\tnext if m/^#/;\n+\t\tchomp;\n+\t\tmy ($ident, $barcode) = split ;\n+\n+\t\t$barcode = uc($'..b'arcodes file name. (see explanation below.)\n+--prefix PREFIX\t- File prefix. will be added to the output files. Can be used\n+\t\t to specify output directories.\n+--suffix SUFFIX\t- File suffix (optional). Can be used to specify file\n+\t\t extensions.\n+--bol\t\t- Try to match barcodes at the BEGINNING of sequences.\n+\t\t (What biologists would call the 5\' end, and programmers\n+\t\t would call index 0.)\n+--eol\t\t- Try to match barcodes at the END of sequences.\n+\t\t (What biologists would call the 3\' end, and programmers\n+\t\t would call the end of the string.)\n+\t\t NOTE: one of --bol, --eol must be specified, but not both.\n+--mismatches N\t- Max. number of mismatches allowed. default is 1.\n+--exact\t\t- Same as \'--mismatches 0\'. If both --exact and --mismatches \n+\t\t are specified, \'--exact\' takes precedence.\n+--partial N\t- Allow partial overlap of barcodes. (see explanation below.)\n+\t\t (Default is not partial matching)\n+--quiet\t\t- Don\'t print counts and summary at the end of the run.\n+\t\t (Default is to print.)\n+--debug\t\t- Print lots of useless debug information to STDERR.\n+--help\t\t- This helpful help screen.\n+\n+Example (Assuming \'s_2_100.txt\' is a FASTQ file, \'mybarcodes.txt\' is \n+the barcodes file):\n+\n+ \\$ cat s_2_100.txt | $0 --bcfile mybarcodes.txt --bol --mismatches 2 \\\\\n+ \t--prefix /tmp/bla_ --suffix ".txt"\n+\n+Barcode file format\n+-------------------\n+Barcode files are simple text files. Each line should contain an identifier \n+(descriptive name for the barcode), and the barcode itself (A/C/G/T), \n+separated by a TAB character. Example:\n+\n+ #This line is a comment (starts with a \'number\' sign)\n+ BC1 GATCT\n+ BC2 ATCGT\n+ BC3 GTGAT\n+ BC4 TGTCT\n+\n+For each barcode, a new FASTQ file will be created (with the barcode\'s \n+identifier as part of the file name). Sequences matching the barcode \n+will be stored in the appropriate file.\n+\n+Running the above example (assuming "mybarcodes.txt" contains the above \n+barcodes), will create the following files:\n+\t/tmp/bla_BC1.txt\n+\t/tmp/bla_BC2.txt\n+\t/tmp/bla_BC3.txt\n+\t/tmp/bla_BC4.txt\n+\t/tmp/bla_unmatched.txt\n+The \'unmatched\' file will contain all sequences that didn\'t match any barcode.\n+\n+Barcode matching\n+----------------\n+\n+** Without partial matching:\n+\n+Count mismatches between the FASTA/Q sequences and the barcodes.\n+The barcode which matched with the lowest mismatches count (providing the\n+count is small or equal to \'--mismatches N\') \'gets\' the sequences.\n+\n+Example (using the above barcodes):\n+Input Sequence:\n+ GATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG\n+\n+Matching with \'--bol --mismatches 1\':\n+ GATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG\n+ GATCT (1 mismatch, BC1)\n+ ATCGT (4 mismatches, BC2)\n+ GTGAT (3 mismatches, BC3)\n+ TGTCT (3 mismatches, BC4)\n+\n+This sequence will be classified as \'BC1\' (it has the lowest mismatch count).\n+If \'--exact\' or \'--mismatches 0\' were specified, this sequence would be \n+classified as \'unmatched\' (because, although BC1 had the lowest mismatch count,\n+it is above the maximum allowed mismatches).\n+\n+Matching with \'--eol\' (end of line) does the same, but from the other side\n+of the sequence.\n+\n+** With partial matching (very similar to indels):\n+\n+Same as above, with the following addition: barcodes are also checked for\n+partial overlap (number of allowed non-overlapping bases is \'--partial N\').\n+\n+Example:\n+Input sequence is ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG\n+(Same as above, but note the missing \'G\' at the beginning.)\n+\n+Matching (without partial overlapping) against BC1 yields 4 mismatches:\n+ ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG\n+ GATCT (4 mismatches)\n+\n+Partial overlapping would also try the following match:\n+ -ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG\n+ GATCT (1 mismatch)\n+\n+Note: scoring counts a missing base as a mismatch, so the final\n+mismatch count is 2 (1 \'real\' mismatch, 1 \'missing base\' mismatch).\n+If running with \'--mismatches 2\' (meaning allowing upto 2 mismatches) - this \n+seqeunce will be classified as BC1.\n+\n+EOF\n+\n+exit 1;\n+}\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/scripts/fastx_barcode_splitter_galaxy_wrapper.sh
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/scripts/fastx_barcode_splitter_galaxy_wrapper.sh Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,76 @@
+#!/bin/sh
+
+#    FASTX-toolkit - FASTA/FASTQ preprocessing tools.
+#    Copyright (C) 2009  A. Gordon (gordon@cshl.edu)
+#
+#   This program is free software: you can redistribute it and/or modify
+#   it under the terms of the GNU Affero General Public License as
+#   published by the Free Software Foundation, either version 3 of the
+#   License, or (at your option) any later version.
+#
+#   This program is distributed in the hope that it will be useful,
+#   but WITHOUT ANY WARRANTY; without even the implied warranty of
+#   MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+#   GNU Affero General Public License for more details.
+#
+#    You should have received a copy of the GNU Affero General Public License
+#    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+
+#
+#This is a shell script wrapper for 'fastx_barcode_splitter.pl'
+#
+# 1. Output files are saved at a predefined location
+#    (Which was made publicly accessible using apache)
+#
+# 2. 'fastx_barcode_splitter.pl' outputs a textual table.
+#    This script turns it into pretty HTML with working URL
+#    (so lazy users can just click on the URLs and get thier files)
+
+BASEPATH="/media/sdb1/galaxy/barcode_splits/"
+PUBLICURL="http://tango.cshl.edu/barcode_splits/"
+
+BARCODE_FILE="$1"
+FASTQ_FILE="$2"
+LIBNAME="$3"
+shift 3
+# The rest of the parameters are passed to the split program
+
+if [ "$LIBNAME" == "" ]; then
+ echo "Usage: $0 [BARCODE FILE] [FASTQ FILE] [LIBRARY_NAME]" >&2
+ exit 1
+fi
+
+#Sanitize library name, make sure we can create a file with this name
+LIBNAME=${LIBNAME//\.gz/}
+LIBNAME=${LIBNAME//\.txt/}
+LIBNAME=${LIBNAME//[^[:alnum:]]/_}
+
+if [ ! -r "$FASTQ_FILE" ]; then
+ echo "Error: Input file ($FASTQ_FILE) not found!" >&2
+ exit 1
+fi
+if [ ! -r "$BARCODE_FILE" ]; then
+ echo "Error: barcode file ($BARCODE_FILE) not found!" >&2
+ exit 1
+fi
+
+PREFIX="$BASEPATH"`date "+%Y-%m-%d_%H%M__"`"${LIBNAME}__"
+SUFFIX=".txt"
+
+RESULTS=`zcat -f "$FASTQ_FILE" | fastx_barcode_splitter.pl --bcfile "$BARCODE_FILE" --prefix "$PREFIX" --suffix "$SUFFIX" "$@"`
+if [ $? != 0 ]; then
+ echo "error"
+fi
+
+#
+# Convert the textual tab-separated table into simple HTML table,
+# with the local path replaces with a valid URL
+echo "<html><body><table border=1>"
+echo "$RESULTS" | sed "s|$BASEPATH|$PUBLICURL|" | sed '
+i<tr><td>
+s|\t|</td><td>|g
+s|http.*|<a href="&">&<\/a>|
+a<\/td><\/tr>
+'
+echo "<p><b>Copy these files to your local computer, as they will be soon deleted.</b>"
+echo "</table></body></html>"

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/scripts/fastx_nucleotide_distribution_graph.sh
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/scripts/fastx_nucleotide_distribution_graph.sh Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,90 @@
+#!/bin/sh
+
+#    FASTX-toolkit - FASTA/FASTQ preprocessing tools.
+#    Copyright (C) 2009  A. Gordon (gordon@cshl.edu)
+#
+#   This program is free software: you can redistribute it and/or modify
+#   it under the terms of the GNU Affero General Public License as
+#   published by the Free Software Foundation, either version 3 of the
+#   License, or (at your option) any later version.
+#
+#   This program is distributed in the hope that it will be useful,
+#   but WITHOUT ANY WARRANTY; without even the implied warranty of
+#   MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+#   GNU Affero General Public License for more details.
+#
+#    You should have received a copy of the GNU Affero General Public License
+#    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+
+usage()
+{
+ echo "FASTA/Q Nucleotide Distribution Plotter"
+ echo
+ echo "Usage: $0 [-i INPUT.TXT] [-t TITLE] [-p] [-o OUTPUT]"
+ echo
+ echo "  [-p]           - Generate PostScript (.PS) file. Default is PNG image."
+ echo "  [-i INPUT.TXT] - Input file. Should be the output of \"fastx_quality_statistics\" program."
+ echo "  [-o OUTPUT]    - Output file name. default is STDOUT."
+ echo "  [-t TITLE]     - Title - will be plotted on the graph."
+ echo
+ exit
+}
+
+#
+# Input Data columns: #pos cnt min max sum        mean Q1 med Q3 IQR lW rW A_Count C_Count G_Count T_Count N_Count
+#  As produced by "fastq_quality_statistics" program
+
+TITLE="" # default title is empty
+FILENAME=""
+OUTPUTTERM="set term png size 1048,768" # default output terminal is "PNG"
+OUTPUTFILE="/dev/stdout"    # Default output file is simply "stdout"
+while getopts ":t:i:o:ph" Option
+ do
+ case $Option in
+ t ) TITLE="for $OPTARG" ;;
+ i ) FILENAME=$OPTARG ;;
+ o ) OUTPUTFILE="$OPTARG" ;;
+ p ) OUTPUTTERM="set term postscript enhanced color \"Helvetica\" 8" ;;
+ h ) usage ;;
+ * ) echo "unrecognized argument. use '-h' for usage information."; exit -1 ;;
+ esac
+done
+shift $(($OPTIND - 1))
+
+
+if [ -z "$FILENAME" ]; then
+ usage
+fi
+
+if [ ! -r "$FILENAME" ]; then
+ echo "Error: can't open input file ($1)." >&2
+ exit 1
+fi
+
+GNUPLOTCMD="
+$OUTPUTTERM
+set boxwidth 0.75 absolute
+set size 1,1
+set style fill solid 1.00 border -1
+set xlabel \"read position\"
+set title \"Nucleotides distribution $TITLE\"
+set ylabel \"% of total (per read position)\"
+#set grid noxtics nomxtics ytics nomytics noztics nomztics \
+# nox2tics nomx2tics noy2tics nomy2tics nocbtics nomcbtics
+#set grid layerdefault   linetype 0 linewidth 1.000,  linetype 0 linewidth 1.000
+set key outside right top vertical Left reverse enhanced autotitles columnhead nobox
+set key invert samplen 4 spacing 1 width 0 height 0
+set style histogram rowstacked
+set style data histograms
+set noytics
+set xtics 1
+set yrange [ 0.00000 : 100.000 ] noreverse nowriteback
+
+plot '$FILENAME' using (100.*column(13)/column(18)):xtic(1) title \"A\" lt rgb \"#5050ff\", \
+       '' using (100.*column(14)/column(18)) title \"C\" lt rgb \"#e00000\", \
+       '' using (100.*column(15)/column(18)) title \"G\" lt rgb \"#00c000\", \
+       '' using (100.*column(16)/column(18)) title \"T\" lt rgb \"#e6e600\", \
+       '' using (100.*column(17)/column(18)) title \"N\" lt rgb \"pink\"
+"
+
+echo "$GNUPLOTCMD" | gnuplot > "$OUTPUTFILE"

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,23 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+SUBDIRS = libfastx \
+ fastx_clipper \
+ fastx_trimmer \
+ fastx_quality_stats \
+ fastq_quality_converter \
+ fastq_to_fasta \
+ fastq_quality_filter \
+ fastx_artifacts_filter \
+ fastx_reverse_complement \
+ fastx_collapser \
+ seqalign_test
+
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,486 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+subdir = src\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+SOURCES =\n+DIST_SOURCES =\n+RECURSIVE_TARGETS = all-recursive check-recursive dvi-recursive \\\n+\thtml-recursive info-recursive install-data-recursive \\\n+\tinstall-dvi-recursive install-exec-recursive \\\n+\tinstall-html-recursive install-info-recursive \\\n+\tinstall-pdf-recursive install-ps-recursive install-recursive \\\n+\tinstallcheck-recursive installdirs-recursive pdf-recursive \\\n+\tps-recursive uninstall-recursive\n+RECURSIVE_CLEAN_TARGETS = mostlyclean-recursive clean-recursive\t\\\n+ distclean-recursive maintainer-clean-recursive\n+ETAGS = etags\n+CTAGS = ctags\n+DIST_SUBDIRS = $(SUBDIRS)\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARATOR@\n+RANLIB = @RANLIB@\n+SET_MAKE = @SET_MAKE@\n+SHELL = @SHELL@\n+STRIP = @STRIP@\n+VERSION = @VERSION@\n+abs_builddir = @abs_builddir@\n+abs_srcdir = @abs_srcdir@\n+abs_top_builddir = @abs_top_builddir@\n+abs_top_srcdir = @abs_top_srcdir@\n+ac_ct_CC = @ac_ct_CC@\n+ac_ct_CXX = @'..b'ile; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+\tlist=\'$(DIST_SUBDIRS)\'; for subdir in $$list; do \\\n+\t if test "$$subdir" = .; then :; else \\\n+\t test -d "$(distdir)/$$subdir" \\\n+\t || $(MKDIR_P) "$(distdir)/$$subdir" \\\n+\t || exit 1; \\\n+\t distdir=`$(am__cd) $(distdir) && pwd`; \\\n+\t top_distdir=`$(am__cd) $(top_distdir) && pwd`; \\\n+\t (cd $$subdir && \\\n+\t $(MAKE) $(AM_MAKEFLAGS) \\\n+\t top_distdir="$$top_distdir" \\\n+\t distdir="$$distdir/$$subdir" \\\n+\t\tam__remove_distdir=: \\\n+\t\tam__skip_length_check=: \\\n+\t distdir) \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-recursive\n+all-am: Makefile\n+installdirs: installdirs-recursive\n+installdirs-am:\n+install: install-recursive\n+install-exec: install-exec-recursive\n+install-data: install-data-recursive\n+uninstall: uninstall-recursive\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-recursive\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-recursive\n+\n+clean-am: clean-generic mostlyclean-am\n+\n+distclean: distclean-recursive\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-generic distclean-tags\n+\n+dvi: dvi-recursive\n+\n+dvi-am:\n+\n+html: html-recursive\n+\n+info: info-recursive\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-recursive\n+\n+install-exec-am:\n+\n+install-html: install-html-recursive\n+\n+install-info: install-info-recursive\n+\n+install-man:\n+\n+install-pdf: install-pdf-recursive\n+\n+install-ps: install-ps-recursive\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-recursive\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-recursive\n+\n+mostlyclean-am: mostlyclean-generic\n+\n+pdf: pdf-recursive\n+\n+pdf-am:\n+\n+ps: ps-recursive\n+\n+ps-am:\n+\n+uninstall-am:\n+\n+.MAKE: $(RECURSIVE_CLEAN_TARGETS) $(RECURSIVE_TARGETS) install-am \\\n+\tinstall-strip\n+\n+.PHONY: $(RECURSIVE_CLEAN_TARGETS) $(RECURSIVE_TARGETS) CTAGS GTAGS \\\n+\tall all-am check check-am clean clean-generic ctags \\\n+\tctags-recursive distclean distclean-generic distclean-tags \\\n+\tdistdir dvi dvi-am html html-am info info-am install \\\n+\tinstall-am install-data install-data-am install-dvi \\\n+\tinstall-dvi-am install-exec install-exec-am install-html \\\n+\tinstall-html-am install-info install-info-am install-man \\\n+\tinstall-pdf install-pdf-am install-ps install-ps-am \\\n+\tinstall-strip installcheck installcheck-am installdirs \\\n+\tinstalldirs-am maintainer-clean maintainer-clean-generic \\\n+\tmostlyclean mostlyclean-generic pdf pdf-am ps ps-am tags \\\n+\ttags-recursive uninstall uninstall-am\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastq_quality_converter/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastq_quality_converter/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,21 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+
+bin_PROGRAMS = fastq_quality_converter
+
+AM_CPPFLAGS = \
+ $(CC_WARNINGS) \
+ -I../libfastx
+
+fastq_quality_converter_SOURCES = fastq_quality_converter.c
+
+fastq_quality_converter_LDADD = ../libfastx/libfastx.a
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastq_quality_converter/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastq_quality_converter/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,440 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+bin_PROGRAMS = fastq_quality_converter$(EXEEXT)\n+subdir = src/fastq_quality_converter\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+am__installdirs = "$(DESTDIR)$(bindir)"\n+binPROGRAMS_INSTALL = $(INSTALL_PROGRAM)\n+PROGRAMS = $(bin_PROGRAMS)\n+am_fastq_quality_converter_OBJECTS = \\\n+\tfastq_quality_converter.$(OBJEXT)\n+fastq_quality_converter_OBJECTS = \\\n+\t$(am_fastq_quality_converter_OBJECTS)\n+fastq_quality_converter_DEPENDENCIES = ../libfastx/libfastx.a\n+DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir)\n+depcomp = $(SHELL) $(top_srcdir)/config/depcomp\n+am__depfiles_maybe = depfiles\n+COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \\\n+\t$(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)\n+CCLD = $(CC)\n+LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@\n+SOURCES = $(fastq_quality_converter_SOURCES)\n+DIST_SOURCES = $(fastq_quality_converter_SOURCES)\n+ETAGS = etags\n+CTAGS = ctags\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARA'..b'RGS)$$tags$$unique" \\\n+\t || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \\\n+\t $$tags $$unique\n+\n+GTAGS:\n+\there=`$(am__cd) $(top_builddir) && pwd` \\\n+\t && cd $(top_srcdir) \\\n+\t && gtags -i $(GTAGS_ARGS) $$here\n+\n+distclean-tags:\n+\t-rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags\n+\n+distdir: $(DISTFILES)\n+\t@srcdirstrip=`echo "$(srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\ttopsrcdirstrip=`echo "$(top_srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\tlist=\'$(DISTFILES)\'; \\\n+\t dist_files=`for file in $$list; do echo $$file; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-am\n+all-am: Makefile $(PROGRAMS)\n+installdirs:\n+\tfor dir in "$(DESTDIR)$(bindir)"; do \\\n+\t test -z "$$dir" || $(MKDIR_P) "$$dir"; \\\n+\tdone\n+install: install-am\n+install-exec: install-exec-am\n+install-data: install-data-am\n+uninstall: uninstall-am\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-am\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-am\n+\n+clean-am: clean-binPROGRAMS clean-generic mostlyclean-am\n+\n+distclean: distclean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-compile distclean-generic \\\n+\tdistclean-tags\n+\n+dvi: dvi-am\n+\n+dvi-am:\n+\n+html: html-am\n+\n+info: info-am\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-am\n+\n+install-exec-am: install-binPROGRAMS\n+\n+install-html: install-html-am\n+\n+install-info: install-info-am\n+\n+install-man:\n+\n+install-pdf: install-pdf-am\n+\n+install-ps: install-ps-am\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-am\n+\n+mostlyclean-am: mostlyclean-compile mostlyclean-generic\n+\n+pdf: pdf-am\n+\n+pdf-am:\n+\n+ps: ps-am\n+\n+ps-am:\n+\n+uninstall-am: uninstall-binPROGRAMS\n+\n+.MAKE: install-am install-strip\n+\n+.PHONY: CTAGS GTAGS all all-am check check-am clean clean-binPROGRAMS \\\n+\tclean-generic ctags distclean distclean-compile \\\n+\tdistclean-generic distclean-tags distdir dvi dvi-am html \\\n+\thtml-am info info-am install install-am install-binPROGRAMS \\\n+\tinstall-data install-data-am install-dvi install-dvi-am \\\n+\tinstall-exec install-exec-am install-html install-html-am \\\n+\tinstall-info install-info-am install-man install-pdf \\\n+\tinstall-pdf-am install-ps install-ps-am install-strip \\\n+\tinstallcheck installcheck-am installdirs maintainer-clean \\\n+\tmaintainer-clean-generic mostlyclean mostlyclean-compile \\\n+\tmostlyclean-generic pdf pdf-am ps ps-am tags uninstall \\\n+\tuninstall-am uninstall-binPROGRAMS\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastq_quality_converter/fastq_quality_converter.c
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastq_quality_converter/fastq_quality_converter.c Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,83 @@
+/*
+    FASTX-toolkit - FASTA/FASTQ preprocessing tools.
+    Copyright (C) 2009  A. Gordon (gordon@cshl.edu)
+
+    This program is free software: you can redistribute it and/or modify
+    it under the terms of the GNU Affero General Public License as
+    published by the Free Software Foundation, either version 3 of the
+    License, or (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU Affero General Public License for more details.
+
+    You should have received a copy of the GNU Affero General Public License
+    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+*/
+#include <limits.h>
+#include <stdio.h>
+#include <stdlib.h>
+#include <string.h>
+#include <getopt.h>
+#include <errno.h>
+#include <err.h>
+
+#include <config.h>
+
+#include "fastx.h"
+#include "fastx_args.h"
+
+const char* usage=
+"usage: fastq_quality_converter [-h] [-a] [-n] [-z] [-i INFILE] [-f OUTFILE]\n" \
+"\n" \
+"version " VERSION "\n" \
+"   [-h]         = This helpful help screen.\n" \
+"   [-a]         = Output ASCII quality scores (default).\n" \
+"   [-n]         = Output numeric quality scores.\n" \
+"   [-z]         = Compress output with GZIP.\n" \
+"   [-i INFILE]  = FASTA/Q input file. default is STDIN.\n" \
+"   [-o OUTFILE] = FASTA output file. default is STDOUT.\n" \
+"\n";
+
+FASTX fastx;
+int flag_output_ascii = 1;
+
+int parse_program_args(int __attribute__((unused)) optind, int optc, char __attribute__((unused)) *optarg)
+{
+ switch(optc) {
+ case 'a': //this is the default, nothing to change
+ break;
+
+ case 'n':
+ flag_output_ascii = 0 ;
+ break;
+ default:
+ errx(1, __FILE__ ":%d: Unknown argument (%c)", __LINE__, optc ) ;
+ }
+ return 1;
+}
+
+
+int main(int argc, char* argv[])
+{
+ fastx_parse_cmdline(argc, argv, "an", parse_program_args);
+
+ fastx_init_reader(&fastx, get_input_filename(),
+ FASTQ_ONLY, ALLOW_N, REQUIRE_UPPERCASE);
+
+ fastx_init_writer(&fastx, get_output_filename(),
+ flag_output_ascii ? OUTPUT_FASTQ_ASCII_QUAL : OUTPUT_FASTQ_NUMERIC_QUAL,
+ compress_output_flag());
+
+ while ( fastx_read_next_record(&fastx) ) {
+ fastx_write_record(&fastx);
+ }
+
+ //Print verbose report
+ if ( verbose_flag() ) {
+ fprintf(get_report_file(), "Input: %zu reads.\n", num_input_reads(&fastx) ) ;
+ fprintf(get_report_file(), "Output: %zu reads.\n", num_output_reads(&fastx) ) ;
+ }
+ return 0;
+}

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastq_quality_filter/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastq_quality_filter/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,21 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+
+bin_PROGRAMS = fastq_quality_filter
+
+AM_CPPFLAGS = \
+ $(CC_WARNINGS) \
+ -I../libfastx
+
+fastq_quality_filter_SOURCES = fastq_quality_filter.c
+
+fastq_quality_filter_LDADD = ../libfastx/libfastx.a
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastq_quality_filter/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastq_quality_filter/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,438 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+bin_PROGRAMS = fastq_quality_filter$(EXEEXT)\n+subdir = src/fastq_quality_filter\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+am__installdirs = "$(DESTDIR)$(bindir)"\n+binPROGRAMS_INSTALL = $(INSTALL_PROGRAM)\n+PROGRAMS = $(bin_PROGRAMS)\n+am_fastq_quality_filter_OBJECTS = fastq_quality_filter.$(OBJEXT)\n+fastq_quality_filter_OBJECTS = $(am_fastq_quality_filter_OBJECTS)\n+fastq_quality_filter_DEPENDENCIES = ../libfastx/libfastx.a\n+DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir)\n+depcomp = $(SHELL) $(top_srcdir)/config/depcomp\n+am__depfiles_maybe = depfiles\n+COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \\\n+\t$(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)\n+CCLD = $(CC)\n+LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@\n+SOURCES = $(fastq_quality_filter_SOURCES)\n+DIST_SOURCES = $(fastq_quality_filter_SOURCES)\n+ETAGS = etags\n+CTAGS = ctags\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARATOR@\n+RANLIB = @RANLIB@\n+SET_MAKE = @'..b'RGS)$$tags$$unique" \\\n+\t || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \\\n+\t $$tags $$unique\n+\n+GTAGS:\n+\there=`$(am__cd) $(top_builddir) && pwd` \\\n+\t && cd $(top_srcdir) \\\n+\t && gtags -i $(GTAGS_ARGS) $$here\n+\n+distclean-tags:\n+\t-rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags\n+\n+distdir: $(DISTFILES)\n+\t@srcdirstrip=`echo "$(srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\ttopsrcdirstrip=`echo "$(top_srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\tlist=\'$(DISTFILES)\'; \\\n+\t dist_files=`for file in $$list; do echo $$file; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-am\n+all-am: Makefile $(PROGRAMS)\n+installdirs:\n+\tfor dir in "$(DESTDIR)$(bindir)"; do \\\n+\t test -z "$$dir" || $(MKDIR_P) "$$dir"; \\\n+\tdone\n+install: install-am\n+install-exec: install-exec-am\n+install-data: install-data-am\n+uninstall: uninstall-am\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-am\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-am\n+\n+clean-am: clean-binPROGRAMS clean-generic mostlyclean-am\n+\n+distclean: distclean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-compile distclean-generic \\\n+\tdistclean-tags\n+\n+dvi: dvi-am\n+\n+dvi-am:\n+\n+html: html-am\n+\n+info: info-am\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-am\n+\n+install-exec-am: install-binPROGRAMS\n+\n+install-html: install-html-am\n+\n+install-info: install-info-am\n+\n+install-man:\n+\n+install-pdf: install-pdf-am\n+\n+install-ps: install-ps-am\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-am\n+\n+mostlyclean-am: mostlyclean-compile mostlyclean-generic\n+\n+pdf: pdf-am\n+\n+pdf-am:\n+\n+ps: ps-am\n+\n+ps-am:\n+\n+uninstall-am: uninstall-binPROGRAMS\n+\n+.MAKE: install-am install-strip\n+\n+.PHONY: CTAGS GTAGS all all-am check check-am clean clean-binPROGRAMS \\\n+\tclean-generic ctags distclean distclean-compile \\\n+\tdistclean-generic distclean-tags distdir dvi dvi-am html \\\n+\thtml-am info info-am install install-am install-binPROGRAMS \\\n+\tinstall-data install-data-am install-dvi install-dvi-am \\\n+\tinstall-exec install-exec-am install-html install-html-am \\\n+\tinstall-info install-info-am install-man install-pdf \\\n+\tinstall-pdf-am install-ps install-ps-am install-strip \\\n+\tinstallcheck installcheck-am installdirs maintainer-clean \\\n+\tmaintainer-clean-generic mostlyclean mostlyclean-compile \\\n+\tmostlyclean-generic pdf pdf-am ps ps-am tags uninstall \\\n+\tuninstall-am uninstall-binPROGRAMS\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastq_quality_filter/fastq_quality_filter.c
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastq_quality_filter/fastq_quality_filter.c Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,177 @@
+/*
+    FASTX-toolkit - FASTA/FASTQ preprocessing tools.
+    Copyright (C) 2009  A. Gordon (gordon@cshl.edu)
+
+    This program is free software: you can redistribute it and/or modify
+    it under the terms of the GNU Affero General Public License as
+    published by the Free Software Foundation, either version 3 of the
+    License, or (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU Affero General Public License for more details.
+
+    You should have received a copy of the GNU Affero General Public License
+    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+*/
+#include <limits.h>
+#include <stdio.h>
+#include <stdlib.h>
+#include <string.h>
+#include <getopt.h>
+#include <errno.h>
+#include <err.h>
+
+#include <config.h>
+
+#include "fastx.h"
+#include "fastx_args.h"
+
+#define MAX_ADAPTER_LEN 100
+
+const char* usage=
+"usage: fastq_quality_filter [-h] [-v] [-q N] [-p N] [-z] [-i INFILE] [-o OUTFILE]\n" \
+"\n" \
+"version " VERSION "\n" \
+"   [-h]         = This helpful help screen.\n" \
+"   [-q N]       = Minimum quality score to keep.\n" \
+"   [-p N]       = Minimum percent of bases that must have [-q] quality.\n" \
+"   [-z]         = Compress output with GZIP.\n" \
+"   [-i INFILE]  = FASTA/Q input file. default is STDIN.\n" \
+"   [-o OUTFILE] = FASTA/Q output file. default is STDOUT.\n" \
+"   [-v]         = Verbose - report number of sequences.\n" \
+"                  If [-o] is specified,  report will be printed to STDOUT.\n" \
+"                  If [-o] is not specified (and output goes to STDOUT),\n" \
+"                  report will be printed to STDERR.\n" \
+"\n";
+
+#define DO_NOT_TRIM_LAST_BASE (0)
+
+int min_quality=0;
+int min_percent=0;
+
+FASTX fastx;
+
+int parse_program_args(int __attribute__((unused)) optind, int optc, char* optarg)
+{
+ switch(optc) {
+ case 'q':
+ if (optarg==NULL)
+ errx(1, "[-q] parameter requires an argument value");
+ min_quality = strtoul(optarg,NULL,10);
+ break;
+
+ case 'p':
+ if (optarg==NULL)
+ errx(1, "[-l] parameter requires an argument value");
+ min_percent = strtoul(optarg,NULL,10);
+ if (min_percent<=0 ||  min_percent>100)
+ errx(1,"Invalid percent value (-p %s)", optarg);
+ break;
+ default:
+ errx(1, __FILE__ ":%d: Unknown argument (%c)", __LINE__, optc ) ;
+ }
+ return 1;
+}
+
+int get_index_of_nth_element(int *array, int array_size, int n)
+{
+ int pos;
+
+ //Find the first nono-empty index
+ pos = 0 ;
+ while ( pos < array_size && array[pos]==0 )
+ pos++;
+
+ #if 0
+ fprintf(stderr,"n=%d\n", n);
+ for (i=0; i< array_size; i++) {
+ if (array[i] != 0)
+ fprintf(stderr, "[%d]=%d  ", i + MIN_QUALITY_VALUE, array[i]) ;
+ }
+ fprintf(stderr,"\n");
+ #endif
+
+ if (pos == array_size)
+ errx(1,"bug: got empty array at %s:%d", __FILE__, __LINE__);
+
+ while (n > 0) {
+ if (array[pos] > n)
+ break;
+ n -= array[pos];
+ pos++;
+ while (array[pos]==0 && pos < array_size)
+ pos++;
+ }
+ return pos;
+}
+
+int get_percentile_quality(const FASTX *fastx, int percentile)
+{
+ size_t i;
+ int count=0;
+ int quality_values[QUALITY_VALUES_RANGE];
+
+ memset(quality_values, 0, sizeof(quality_values));
+
+ for (i=0; i< strlen(fastx->nucleotides); i++) {
+ count++;
+ quality_values[ fastx->quality[i] - MIN_QUALITY_VALUE ] ++ ;
+ }
+
+ i = get_index_of_nth_element(quality_values, QUALITY_VALUES_RANGE, (count * (100-percentile) / 100));
+
+ //printf(" n = %d, i = %d, i+MIN_QUAL_VALUE=%d\n",
+ // (count*(100-percentile)/100), i, i+MIN_QUALITY_VALUE) ;
+
+ return i + MIN_QUALITY_VALUE ;
+}
+
+int main(int argc, char* argv[])
+{
+ fastx_parse_cmdline(argc, argv, "q:p:", parse_program_args);
+
+ fastx_init_reader(&fastx, get_input_filename(),
+ FASTQ_ONLY, ALLOW_N, REQUIRE_UPPERCASE);
+
+ fastx_init_writer(&fastx, get_output_filename(), OUTPUT_SAME_AS_INPUT, compress_output_flag());
+
+ while ( fastx_read_next_record(&fastx) ) {
+ #if 0
+ fprintf(stderr, "%s\n", fastx.nucleotides ) ;
+ for (i=0; i<strlen(fastx.nucleotides); i++) {
+ fprintf(stderr,"%d ", fastx.quality[i]);
+ }
+ fprintf(stderr,"\n");
+ #endif
+
+ int value = get_percentile_quality(&fastx, min_percent);
+
+ //fprintf(stderr, "value = %d\n\n", value ) ;
+
+
+ if (value >= min_quality) {
+ fastx_write_record(&fastx);
+ } else {
+ // fprintf(stderr, "%s\n", fastx.nucleotides ) ;
+ // fprintf(stderr, "value = %d\n", value ) ;
+ }
+ }
+
+ //
+ //Print verbose report
+ if ( verbose_flag() ) {
+ fprintf(get_report_file(), "Quality cut-off: %d\n", min_quality);
+ fprintf(get_report_file(), "Minimum percentage: %d\n", min_percent);
+
+ fprintf(get_report_file(), "Input: %zu reads.\n", num_input_reads(&fastx) ) ;
+ fprintf(get_report_file(), "Output: %zu reads.\n", num_output_reads(&fastx) ) ;
+
+ size_t discarded = num_input_reads(&fastx) - num_output_reads(&fastx) ;
+ fprintf(get_report_file(), "discarded %zu (%zu%%) low-quality reads.\n",
+ discarded, (discarded*100)/( num_input_reads(&fastx) ) ) ;
+ }
+
+ return 0;
+}

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastq_to_fasta/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastq_to_fasta/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,21 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+
+bin_PROGRAMS = fastq_to_fasta
+
+AM_CPPFLAGS = \
+ $(CC_WARNINGS) \
+ -I../libfastx
+
+fastq_to_fasta_SOURCES = fastq_to_fasta.c
+
+fastq_to_fasta_LDADD = ../libfastx/libfastx.a
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastq_to_fasta/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastq_to_fasta/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,438 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+bin_PROGRAMS = fastq_to_fasta$(EXEEXT)\n+subdir = src/fastq_to_fasta\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+am__installdirs = "$(DESTDIR)$(bindir)"\n+binPROGRAMS_INSTALL = $(INSTALL_PROGRAM)\n+PROGRAMS = $(bin_PROGRAMS)\n+am_fastq_to_fasta_OBJECTS = fastq_to_fasta.$(OBJEXT)\n+fastq_to_fasta_OBJECTS = $(am_fastq_to_fasta_OBJECTS)\n+fastq_to_fasta_DEPENDENCIES = ../libfastx/libfastx.a\n+DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir)\n+depcomp = $(SHELL) $(top_srcdir)/config/depcomp\n+am__depfiles_maybe = depfiles\n+COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \\\n+\t$(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)\n+CCLD = $(CC)\n+LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@\n+SOURCES = $(fastq_to_fasta_SOURCES)\n+DIST_SOURCES = $(fastq_to_fasta_SOURCES)\n+ETAGS = etags\n+CTAGS = ctags\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARATOR@\n+RANLIB = @RANLIB@\n+SET_MAKE = @SET_MAKE@\n+SHELL = @SHELL@\n+STRIP = @STRIP@\n+VERSION ='..b'RGS)$$tags$$unique" \\\n+\t || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \\\n+\t $$tags $$unique\n+\n+GTAGS:\n+\there=`$(am__cd) $(top_builddir) && pwd` \\\n+\t && cd $(top_srcdir) \\\n+\t && gtags -i $(GTAGS_ARGS) $$here\n+\n+distclean-tags:\n+\t-rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags\n+\n+distdir: $(DISTFILES)\n+\t@srcdirstrip=`echo "$(srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\ttopsrcdirstrip=`echo "$(top_srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\tlist=\'$(DISTFILES)\'; \\\n+\t dist_files=`for file in $$list; do echo $$file; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-am\n+all-am: Makefile $(PROGRAMS)\n+installdirs:\n+\tfor dir in "$(DESTDIR)$(bindir)"; do \\\n+\t test -z "$$dir" || $(MKDIR_P) "$$dir"; \\\n+\tdone\n+install: install-am\n+install-exec: install-exec-am\n+install-data: install-data-am\n+uninstall: uninstall-am\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-am\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-am\n+\n+clean-am: clean-binPROGRAMS clean-generic mostlyclean-am\n+\n+distclean: distclean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-compile distclean-generic \\\n+\tdistclean-tags\n+\n+dvi: dvi-am\n+\n+dvi-am:\n+\n+html: html-am\n+\n+info: info-am\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-am\n+\n+install-exec-am: install-binPROGRAMS\n+\n+install-html: install-html-am\n+\n+install-info: install-info-am\n+\n+install-man:\n+\n+install-pdf: install-pdf-am\n+\n+install-ps: install-ps-am\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-am\n+\n+mostlyclean-am: mostlyclean-compile mostlyclean-generic\n+\n+pdf: pdf-am\n+\n+pdf-am:\n+\n+ps: ps-am\n+\n+ps-am:\n+\n+uninstall-am: uninstall-binPROGRAMS\n+\n+.MAKE: install-am install-strip\n+\n+.PHONY: CTAGS GTAGS all all-am check check-am clean clean-binPROGRAMS \\\n+\tclean-generic ctags distclean distclean-compile \\\n+\tdistclean-generic distclean-tags distdir dvi dvi-am html \\\n+\thtml-am info info-am install install-am install-binPROGRAMS \\\n+\tinstall-data install-data-am install-dvi install-dvi-am \\\n+\tinstall-exec install-exec-am install-html install-html-am \\\n+\tinstall-info install-info-am install-man install-pdf \\\n+\tinstall-pdf-am install-ps install-ps-am install-strip \\\n+\tinstallcheck installcheck-am installdirs maintainer-clean \\\n+\tmaintainer-clean-generic mostlyclean mostlyclean-compile \\\n+\tmostlyclean-generic pdf pdf-am ps ps-am tags uninstall \\\n+\tuninstall-am uninstall-binPROGRAMS\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastq_to_fasta/fastq_to_fasta.c
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastq_to_fasta/fastq_to_fasta.c Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,102 @@
+/*
+    FASTX-toolkit - FASTA/FASTQ preprocessing tools.
+    Copyright (C) 2009  A. Gordon (gordon@cshl.edu)
+
+    This program is free software: you can redistribute it and/or modify
+    it under the terms of the GNU Affero General Public License as
+    published by the Free Software Foundation, either version 3 of the
+    License, or (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU Affero General Public License for more details.
+
+    You should have received a copy of the GNU Affero General Public License
+    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+*/
+#include <limits.h>
+#include <stdio.h>
+#include <stdlib.h>
+#include <string.h>
+#include <getopt.h>
+#include <errno.h>
+#include <err.h>
+
+#include <config.h>
+
+#include "fastx.h"
+#include "fastx_args.h"
+
+const char* usage=
+"usage: fastq_to_fasta [-h] [-r] [-n] [-v] [-z] [-i INFILE] [-o OUTFILE]\n" \
+"\n" \
+"version " VERSION "\n" \
+"   [-h]         = This helpful help screen.\n" \
+"   [-r]         = Rename sequence identifiers to numbers.\n" \
+"   [-n]         = keep sequences with unknown (N) nucleotides.\n" \
+"                  Default is to discard such sequences.\n" \
+"   [-v]         = Verbose - report number of sequences.\n" \
+"                  If [-o] is specified,  report will be printed to STDOUT.\n" \
+"                  If [-o] is not specified (and output goes to STDOUT),\n" \
+"                  report will be printed to STDERR.\n" \
+"   [-z]         = Compress output with GZIP.\n" \
+"   [-i INFILE]  = FASTA/Q input file. default is STDIN.\n" \
+"   [-o OUTFILE] = FASTA output file. default is STDOUT.\n" \
+"\n";
+
+FASTX fastx;
+int flag_rename_seqid = 0;
+int flag_discard_N = 1 ;
+
+int parse_program_args(int __attribute__((unused)) optind, int optc, char __attribute__((unused)) *optarg)
+{
+ switch(optc) {
+ case 'n':
+ flag_discard_N = 0 ;
+ break;
+
+ case 'r':
+ flag_rename_seqid = 1;
+ break;
+ default:
+ errx(1, __FILE__ ":%d: Unknown argument (%c)", __LINE__, optc ) ;
+ }
+ return 1;
+}
+
+
+int main(int argc, char* argv[])
+{
+ fastx_parse_cmdline(argc, argv, "rn", parse_program_args);
+
+ fastx_init_reader(&fastx, get_input_filename(),
+ FASTQ_ONLY, ALLOW_N, REQUIRE_UPPERCASE);
+
+ fastx_init_writer(&fastx, get_output_filename(), OUTPUT_FASTA, compress_output_flag());
+
+ while ( fastx_read_next_record(&fastx) ) {
+ //See if the input sequence contained 'N' nucleotides
+ if ( flag_discard_N  && (strchr(fastx.nucleotides,'N') != NULL))
+ continue;
+
+ if ( flag_rename_seqid )
+ snprintf(fastx.name, sizeof(fastx.name), "%zu", num_output_reads(&fastx)+1) ;
+
+ fastx_write_record(&fastx);
+ }
+
+ //Print verbose report
+ if ( verbose_flag() ) {
+ fprintf(get_report_file(), "Input: %zu reads.\n", num_input_reads(&fastx) ) ;
+ fprintf(get_report_file(), "Output: %zu reads.\n", num_output_reads(&fastx) ) ;
+
+ if ( flag_discard_N ) {
+ size_t discarded = num_input_reads(&fastx) - num_output_reads(&fastx) ;
+ fprintf(get_report_file(), "discarded %zu (%zu%%) low-quality reads.\n",
+ discarded, (discarded*100)/( num_input_reads(&fastx) ) ) ;
+ }
+ }
+
+ return 0;
+}

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_artifacts_filter/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastx_artifacts_filter/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,21 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+
+bin_PROGRAMS = fastx_artifacts_filter
+
+AM_CPPFLAGS = \
+ $(CC_WARNINGS) \
+ -I../libfastx
+
+fastx_artifacts_filter_SOURCES = fastx_artifacts_filter.c
+
+fastx_artifacts_filter_LDADD = ../libfastx/libfastx.a
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_artifacts_filter/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastx_artifacts_filter/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,438 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+bin_PROGRAMS = fastx_artifacts_filter$(EXEEXT)\n+subdir = src/fastx_artifacts_filter\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+am__installdirs = "$(DESTDIR)$(bindir)"\n+binPROGRAMS_INSTALL = $(INSTALL_PROGRAM)\n+PROGRAMS = $(bin_PROGRAMS)\n+am_fastx_artifacts_filter_OBJECTS = fastx_artifacts_filter.$(OBJEXT)\n+fastx_artifacts_filter_OBJECTS = $(am_fastx_artifacts_filter_OBJECTS)\n+fastx_artifacts_filter_DEPENDENCIES = ../libfastx/libfastx.a\n+DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir)\n+depcomp = $(SHELL) $(top_srcdir)/config/depcomp\n+am__depfiles_maybe = depfiles\n+COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \\\n+\t$(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)\n+CCLD = $(CC)\n+LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@\n+SOURCES = $(fastx_artifacts_filter_SOURCES)\n+DIST_SOURCES = $(fastx_artifacts_filter_SOURCES)\n+ETAGS = etags\n+CTAGS = ctags\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARATOR@\n+RANLIB = @RAN'..b'RGS)$$tags$$unique" \\\n+\t || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \\\n+\t $$tags $$unique\n+\n+GTAGS:\n+\there=`$(am__cd) $(top_builddir) && pwd` \\\n+\t && cd $(top_srcdir) \\\n+\t && gtags -i $(GTAGS_ARGS) $$here\n+\n+distclean-tags:\n+\t-rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags\n+\n+distdir: $(DISTFILES)\n+\t@srcdirstrip=`echo "$(srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\ttopsrcdirstrip=`echo "$(top_srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\tlist=\'$(DISTFILES)\'; \\\n+\t dist_files=`for file in $$list; do echo $$file; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-am\n+all-am: Makefile $(PROGRAMS)\n+installdirs:\n+\tfor dir in "$(DESTDIR)$(bindir)"; do \\\n+\t test -z "$$dir" || $(MKDIR_P) "$$dir"; \\\n+\tdone\n+install: install-am\n+install-exec: install-exec-am\n+install-data: install-data-am\n+uninstall: uninstall-am\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-am\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-am\n+\n+clean-am: clean-binPROGRAMS clean-generic mostlyclean-am\n+\n+distclean: distclean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-compile distclean-generic \\\n+\tdistclean-tags\n+\n+dvi: dvi-am\n+\n+dvi-am:\n+\n+html: html-am\n+\n+info: info-am\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-am\n+\n+install-exec-am: install-binPROGRAMS\n+\n+install-html: install-html-am\n+\n+install-info: install-info-am\n+\n+install-man:\n+\n+install-pdf: install-pdf-am\n+\n+install-ps: install-ps-am\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-am\n+\n+mostlyclean-am: mostlyclean-compile mostlyclean-generic\n+\n+pdf: pdf-am\n+\n+pdf-am:\n+\n+ps: ps-am\n+\n+ps-am:\n+\n+uninstall-am: uninstall-binPROGRAMS\n+\n+.MAKE: install-am install-strip\n+\n+.PHONY: CTAGS GTAGS all all-am check check-am clean clean-binPROGRAMS \\\n+\tclean-generic ctags distclean distclean-compile \\\n+\tdistclean-generic distclean-tags distdir dvi dvi-am html \\\n+\thtml-am info info-am install install-am install-binPROGRAMS \\\n+\tinstall-data install-data-am install-dvi install-dvi-am \\\n+\tinstall-exec install-exec-am install-html install-html-am \\\n+\tinstall-info install-info-am install-man install-pdf \\\n+\tinstall-pdf-am install-ps install-ps-am install-strip \\\n+\tinstallcheck installcheck-am installdirs maintainer-clean \\\n+\tmaintainer-clean-generic mostlyclean mostlyclean-compile \\\n+\tmostlyclean-generic pdf pdf-am ps ps-am tags uninstall \\\n+\tuninstall-am uninstall-binPROGRAMS\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_artifacts_filter/fastx_artifacts_filter.c
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastx_artifacts_filter/fastx_artifacts_filter.c Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,143 @@
+/*
+    FASTX-toolkit - FASTA/FASTQ preprocessing tools.
+    Copyright (C) 2009  A. Gordon (gordon@cshl.edu)
+
+    This program is free software: you can redistribute it and/or modify
+    it under the terms of the GNU Affero General Public License as
+    published by the Free Software Foundation, either version 3 of the
+    License, or (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU Affero General Public License for more details.
+
+    You should have received a copy of the GNU Affero General Public License
+    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+*/
+#include <limits.h>
+#include <stdio.h>
+#include <stdlib.h>
+#include <string.h>
+#include <getopt.h>
+#include <errno.h>
+#include <err.h>
+
+#include <config.h>
+
+#include "fastx.h"
+#include "fastx_args.h"
+
+#define MAX_ADAPTER_LEN 100
+
+const char* usage=
+"usage: fastx_artifacts_filter [-h] [-v] [-z] [-i INFILE] [-o OUTFILE]\n" \
+"\n" \
+"version " VERSION "\n" \
+"   [-h]         = This helpful help screen.\n" \
+"   [-i INFILE]  = FASTA/Q input file. default is STDIN.\n" \
+"   [-o OUTFILE] = FASTA/Q output file. default is STDOUT.\n" \
+"   [-z]         = Compress output with GZIP.\n" \
+"   [-v]         = Verbose - report number of processed reads.\n" \
+"                  If [-o] is specified,  report will be printed to STDOUT.\n" \
+"                  If [-o] is not specified (and output goes to STDOUT),\n" \
+"                  report will be printed to STDERR.\n" \
+"\n";
+
+#define DO_NOT_TRIM_LAST_BASE (0)
+
+FASTX fastx;
+
+int parse_commandline(int argc, char* argv[])
+{
+ return fastx_parse_cmdline(argc, argv, "", NULL);
+}
+
+int artifact_sequence(const FASTX *fastx)
+{
+ int n_count=0;
+ int a_count=0;
+ int c_count=0;
+ int t_count=0;
+ int g_count=0;
+ int total_count=0;
+
+ int max_allowed_different_bases = 3 ;
+
+ int i=0;
+
+ while (1) {
+ if (fastx->nucleotides[i]==0)
+ break;
+
+ total_count++;
+ switch(fastx->nucleotides[i])
+ {
+ case 'A':
+ a_count++;
+ break;
+ case 'C':
+ c_count++;
+ break;
+ case 'G':
+ g_count++;
+ break;
+ case 'T':
+ t_count++;
+ break;
+ case 'N':
+ n_count++;
+ break;
+ default:
+ errx(1, __FILE__":%d: invalid nucleotide value (%c) at position %d",
+ __LINE__, fastx->nucleotides[i], i ) ;
+ }
+ i++;
+ }
+
+ //Rules for artifacts
+
+ if ( a_count>=(total_count-max_allowed_different_bases)
+      ||
+      c_count>=(total_count-max_allowed_different_bases)
+      ||
+      g_count>=(total_count-max_allowed_different_bases)
+      ||
+      t_count>=(total_count-max_allowed_different_bases)
+      )
+      return 1;
+
+
+ return 0;
+}
+
+int main(int argc, char* argv[])
+{
+ parse_commandline(argc, argv);
+
+ fastx_init_reader(&fastx, get_input_filename(),
+ FASTA_OR_FASTQ, ALLOW_N, REQUIRE_UPPERCASE);
+
+ fastx_init_writer(&fastx, get_output_filename(),
+ OUTPUT_SAME_AS_INPUT, compress_output_flag());
+
+ while ( fastx_read_next_record(&fastx) ) {
+
+ if ( artifact_sequence(&fastx)  ) {
+ } else {
+ fastx_write_record(&fastx);
+ }
+ }
+
+ //Print verbose report
+ if ( verbose_flag() ) {
+ fprintf(get_report_file(), "Input: %zu reads.\n", num_input_reads(&fastx) ) ;
+ fprintf(get_report_file(), "Output: %zu reads.\n", num_output_reads(&fastx) ) ;
+
+ size_t discarded = num_input_reads(&fastx) - num_output_reads(&fastx) ;
+ fprintf(get_report_file(), "discarded %zu (%zu%%) artifact reads.\n",
+ discarded, (discarded*100)/( num_input_reads(&fastx) ) ) ;
+ }
+
+ return 0;
+}

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_clipper/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastx_clipper/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,21 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+
+bin_PROGRAMS = fastx_clipper
+
+AM_CPPFLAGS = \
+ $(CC_WARNINGS) \
+ -I../libfastx
+
+fastx_clipper_SOURCES = fastx_clipper.cpp
+
+fastx_clipper_LDADD = ../libfastx/libfastx.a
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_clipper/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastx_clipper/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,439 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+bin_PROGRAMS = fastx_clipper$(EXEEXT)\n+subdir = src/fastx_clipper\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+am__installdirs = "$(DESTDIR)$(bindir)"\n+binPROGRAMS_INSTALL = $(INSTALL_PROGRAM)\n+PROGRAMS = $(bin_PROGRAMS)\n+am_fastx_clipper_OBJECTS = fastx_clipper.$(OBJEXT)\n+fastx_clipper_OBJECTS = $(am_fastx_clipper_OBJECTS)\n+fastx_clipper_DEPENDENCIES = ../libfastx/libfastx.a\n+DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir)\n+depcomp = $(SHELL) $(top_srcdir)/config/depcomp\n+am__depfiles_maybe = depfiles\n+CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \\\n+\t$(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)\n+CXXLD = $(CXX)\n+CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \\\n+\t-o $@\n+SOURCES = $(fastx_clipper_SOURCES)\n+DIST_SOURCES = $(fastx_clipper_SOURCES)\n+ETAGS = etags\n+CTAGS = ctags\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARATOR@\n+RANLIB = @RANLIB@\n+SET_MAKE = @SET_MAKE@\n+SHELL = @SHELL@\n+STRIP = @STRI'..b'RGS)$$tags$$unique" \\\n+\t || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \\\n+\t $$tags $$unique\n+\n+GTAGS:\n+\there=`$(am__cd) $(top_builddir) && pwd` \\\n+\t && cd $(top_srcdir) \\\n+\t && gtags -i $(GTAGS_ARGS) $$here\n+\n+distclean-tags:\n+\t-rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags\n+\n+distdir: $(DISTFILES)\n+\t@srcdirstrip=`echo "$(srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\ttopsrcdirstrip=`echo "$(top_srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\tlist=\'$(DISTFILES)\'; \\\n+\t dist_files=`for file in $$list; do echo $$file; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-am\n+all-am: Makefile $(PROGRAMS)\n+installdirs:\n+\tfor dir in "$(DESTDIR)$(bindir)"; do \\\n+\t test -z "$$dir" || $(MKDIR_P) "$$dir"; \\\n+\tdone\n+install: install-am\n+install-exec: install-exec-am\n+install-data: install-data-am\n+uninstall: uninstall-am\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-am\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-am\n+\n+clean-am: clean-binPROGRAMS clean-generic mostlyclean-am\n+\n+distclean: distclean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-compile distclean-generic \\\n+\tdistclean-tags\n+\n+dvi: dvi-am\n+\n+dvi-am:\n+\n+html: html-am\n+\n+info: info-am\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-am\n+\n+install-exec-am: install-binPROGRAMS\n+\n+install-html: install-html-am\n+\n+install-info: install-info-am\n+\n+install-man:\n+\n+install-pdf: install-pdf-am\n+\n+install-ps: install-ps-am\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-am\n+\n+mostlyclean-am: mostlyclean-compile mostlyclean-generic\n+\n+pdf: pdf-am\n+\n+pdf-am:\n+\n+ps: ps-am\n+\n+ps-am:\n+\n+uninstall-am: uninstall-binPROGRAMS\n+\n+.MAKE: install-am install-strip\n+\n+.PHONY: CTAGS GTAGS all all-am check check-am clean clean-binPROGRAMS \\\n+\tclean-generic ctags distclean distclean-compile \\\n+\tdistclean-generic distclean-tags distdir dvi dvi-am html \\\n+\thtml-am info info-am install install-am install-binPROGRAMS \\\n+\tinstall-data install-data-am install-dvi install-dvi-am \\\n+\tinstall-exec install-exec-am install-html install-html-am \\\n+\tinstall-info install-info-am install-man install-pdf \\\n+\tinstall-pdf-am install-ps install-ps-am install-strip \\\n+\tinstallcheck installcheck-am installdirs maintainer-clean \\\n+\tmaintainer-clean-generic mostlyclean mostlyclean-compile \\\n+\tmostlyclean-generic pdf pdf-am ps ps-am tags uninstall \\\n+\tuninstall-am uninstall-binPROGRAMS\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_clipper/fastx_clipper.cpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastx_clipper/fastx_clipper.cpp Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,333 @@\n+/*\n+ FASTX-toolkit - FASTA/FASTQ preprocessing tools.\n+ Copyright (C) 2009 A. Gordon (gordon@cshl.edu)\n+\n+ This program is free software: you can redistribute it and/or modify\n+ it under the terms of the GNU Affero General Public License as\n+ published by the Free Software Foundation, either version 3 of the\n+ License, or (at your option) any later version.\n+\n+ This program is distributed in the hope that it will be useful,\n+ but WITHOUT ANY WARRANTY; without even the implied warranty of\n+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\n+ GNU Affero General Public License for more details.\n+\n+ You should have received a copy of the GNU Affero General Public License\n+ along with this program. If not, see <http://www.gnu.org/licenses/>.\n+*/\n+#include <cstddef>\n+#include <cstdlib>\n+#include <algorithm>\n+#include <ostream>\n+#include <iostream>\n+#include <string>\n+#include <vector>\n+#include <string.h>\n+\n+#include "sequence_alignment.h"\n+\n+#include <errno.h>\n+#include <err.h>\n+\n+#include <config.h>\n+\n+#include "fastx.h"\n+#include "fastx_args.h"\n+\n+\n+#define MAX_ADAPTER_LEN 100\n+\n+const char* usage=\n+"usage: fastx_clipper [-h] [-a ADAPTER] [-D] [-l N] [-n] [-d N] [-c] [-C] [-o] [-v] [-z] [-i INFILE] [-o OUTFILE]\\n" \\\n+"\\n" \\\n+"version " VERSION "\\n" \\\n+" [-h] = This helpful help screen.\\n" \\\n+" [-a ADAPTER] = ADAPTER string. default is CCTTAAGG (dummy adapter).\\n" \\\n+" [-l N] = discard sequences shorter than N nucleotides. default is 5.\\n" \\\n+" [-d N] = Keep the adapter and N bases after it.\\n" \\\n+" (using \'-d 0\' is the same as not using \'-d\' at all. which is the default).\\n" \\\n+" [-c] = Discard non-clipped sequences (i.e. - keep only sequences which contained the adapter).\\n" \\\n+" [-C] = Discard clipped sequences (i.e. - keep only sequences which did not contained the adapter).\\n" \\\n+" [-k] = Report Adapter-Only sequences.\\n" \\\n+" [-n] = keep sequences with unknown (N) nucleotides. default is to discard such sequences.\\n" \\\n+" [-v] = Verbose - report number of sequences.\\n" \\\n+" If [-o] is specified, report will be printed to STDOUT.\\n" \\\n+" If [-o] is not specified (and output goes to STDOUT),\\n" \\\n+" report will be printed to STDERR.\\n" \\\n+" [-z] = Compress output with GZIP.\\n" \\\n+" [-D]\t = DEBUG output.\\n" \\\n+" [-i INFILE] = FASTA/Q input file. default is STDIN.\\n" \\\n+" [-o OUTFILE] = FASTA/Q output file. default is STDOUT.\\n" \\\n+"\\n";\n+\n+//Default adapter - Dummy sequence\n+char adapter[MAX_ADAPTER_LEN]="CCTTAAGG";\n+unsigned int min_length=5;\n+int discard_unknown_bases=1;\n+int keep_delta=0;\n+int discard_non_clipped=0;\n+int discard_clipped=0;\n+int show_adapter_only=0;\n+int debug = 0 ;\n+\n+\n+//Statistics for verbose report\n+unsigned int count_input=0 ;\n+unsigned int count_discarded_too_short=0; // see [-l N] option\n+unsigned int count_discarded_adapter_at_index_zero=0; //empty sequences (after clipping)\n+unsigned int count_discarded_no_adapter_found=0; // see [-c] option\n+unsigned int count_discarded_adapter_found=0; // see [-C] option\n+unsigned int count_discarded_N=0; // see [-n]\n+\n+FASTX fastx;\n+HalfLocalSequenceAlignment align;\n+\n+int parse_program_args(int __attribute__((unused)) optind, int optc, char* optarg)\n+{\n+\tswitch(optc) {\n+\t\tcase \'k\':\n+\t\t\tshow_adapter_only=1;\n+\t\t\tbreak;\n+\n+\t\tcase \'D\':\n+\t\t\tdebug++;\n+\t\t\tbreak ;\n+\n+\t\tcase \'c\':\n+\t\t\tdiscard_non_clipped = 1;\n+\t\t\tbreak;\n+\n+\t\tcase \'C\':\n+\t\t\tdiscard_clipped = 1 ;\n+\t\t\tbreak ;\n+\t\tcase \'d\':\n+\t\t\tif (optarg==NULL) \n+\t\t\t\terrx(1, "[-d] parameter requires an argument value");\n+\t\t\tkeep_delta = strtoul(optarg,NULL,10);\n+\t\t\tif (keep_delta<0) \n+\t\t\t\terrx(1,"Invalid number bases to keep (-d %s)", optarg);\n+\t\t\tbreak;\n+\t\tcase \'a\':\n+\t\t\tstrncpy(adapter,optarg,sizeof(adapter)-1);\n+\t\t\t//TODO:\n+\t\t\t//if (!valid_sequence_string(adapter)) \n+\t\t\t//\terrx(1,"Invalid adapte'..b'75 ) {\n+\t \t//printf("--2\\n");\n+\t\treturn alignment_results.query_start ;\n+\t}\n+\n+\tif ( alignment_size > 11 \n+\t &&\n+\t (alignment_results.matches * 100 / alignment_size ) >= 80 ) {\n+\t \t//printf("--2\\n");\n+\t\treturn alignment_results.query_start ;\n+\t}\n+\n+\t//\n+\t//Be very lenient regarding alignments at the end of the query sequence\n+\tif ( alignment_results.query_end >= alignment_results.query_size-2\n+\t &&\n+\t alignment_size <= 5 && alignment_results.matches >= 3) {\n+\t\t\t//printf("--3\\n");\n+\t\t\treturn alignment_results.query_start ;\n+\t\t}\n+\n+\treturn -1;\n+}\n+\n+\n+int main(int argc, char* argv[])\n+{\n+\tint i;\n+\tint reads_count;\n+\n+\tparse_commandline(argc, argv);\n+\n+\tfastx_init_reader(&fastx, get_input_filename(), \n+\t\tFASTA_OR_FASTQ, ALLOW_N, REQUIRE_UPPERCASE);\n+\n+\tfastx_init_writer(&fastx, get_output_filename(), OUTPUT_SAME_AS_INPUT, compress_output_flag());\n+\n+\twhile ( fastx_read_next_record(&fastx) ) {\n+\n+\t\treads_count = get_reads_count(&fastx);\n+\t\t\n+\t\t#if 0\n+\t\tstd::string query = std::string(fastx.nucleotides) + std::string( strlen(adapter), \'N\' ); \n+\t\tstd::string target= std::string( strlen(fastx.nucleotides), \'N\' ) + std::string(adapter);\n+\t\t#else\n+\t\tstd::string query = std::string(fastx.nucleotides) ;\n+\t\tstd::string target= std::string(adapter);\n+\t\t#endif\n+\t\t\n+\t\t\n+\t\talign.align( query, target ) ;\n+\n+\t\tif (debug>1) \n+\t\t\talign.print_matrix();\n+\t\tif (debug>0)\n+\t\t\talign.results().print();\n+\t\t\n+\t\tcount_input+= reads_count;\n+\n+\t\t//Find the best match with the adapter\n+\t\ti = adapter_cutoff_index ( align.results() ) ;\n+\t\t\n+\t\tif (i!=-1 && i>0) {\n+\t\t\ti += keep_delta;\n+\t\t\t//Just trim the string after this position\n+\t\t\tfastx.nucleotides[i] = 0 ;\n+\t\t}\n+\n+\t\tif (i==0) { // empty sequence ? (in which the adapter was found at index 0)\n+\t\t\tcount_discarded_adapter_at_index_zero += reads_count;\n+\t\t\t\n+\t\t\tif (show_adapter_only)\n+\t\t\t\tfastx_write_record(&fastx);\n+\t\t\tcontinue;\n+\t\t}\n+\n+\t\tif (strlen(fastx.nucleotides) < min_length) { // too-short sequence ?\n+\t\t\tcount_discarded_too_short += reads_count;\n+\t\t\tcontinue;\n+\t\t}\n+\n+\t\tif ( (i==-1) && discard_non_clipped ) { // adapter not found (i.e. sequence was not clipped) ?\n+\t\t\tcount_discarded_no_adapter_found += reads_count;\n+\t\t\tcontinue ;\n+\t\t}\n+\n+\t\tif ( (i>0) && discard_clipped ) { // adapter found, and user requested to keep only non-clipped sequences \n+\t\t\tcount_discarded_adapter_found += reads_count;\n+\t\t\tcontinue;\n+\t\t}\n+\n+\t\tif ( (discard_unknown_bases && strchr(fastx.nucleotides,\'N\')!=NULL ) ) { // contains unknown bases (after clipping) ?\n+\t\t\tcount_discarded_N += reads_count;\n+\t\t\tcontinue;\n+\t\t}\n+\t\t\n+\t\tif (!show_adapter_only) {\n+\t\t\t//none of the above condition matched, so print this sequence.\n+\t\t\tfastx_write_record(&fastx);\n+\t\t}\n+\t}\n+\n+\t//\n+\t//Print verbose report\n+\tif ( verbose_flag() ) {\n+\t\tfprintf(get_report_file(), "Clipping Adapter: %s\\n", adapter );\n+\t\tfprintf(get_report_file(), "Min. Length: %d\\n", min_length) ;\n+\n+\t\tif (discard_clipped)\n+\t\t\tfprintf(get_report_file(), "Clipped reads - discarded.\\n" ) ;\n+\t\tif (discard_non_clipped)\n+\t\t\tfprintf(get_report_file(), "Non-Clipped reads - discarded.\\n" ) ;\n+\n+\t\t\n+\t\tfprintf(get_report_file(), "Input: %u reads.\\n", count_input ) ;\n+\t\tfprintf(get_report_file(), "Output: %u reads.\\n", \n+\t\t\tcount_input - count_discarded_too_short - count_discarded_no_adapter_found - count_discarded_adapter_found -\n+\t\t\tcount_discarded_N - count_discarded_adapter_at_index_zero ) ;\n+\n+\t\tfprintf(get_report_file(), "discarded %u too-short reads.\\n", count_discarded_too_short ) ;\n+\t\tfprintf(get_report_file(), "discarded %u adapter-only reads.\\n", count_discarded_adapter_at_index_zero );\n+\t\tif (discard_non_clipped)\n+\t\t\tfprintf(get_report_file(), "discarded %u non-clipped reads.\\n", count_discarded_no_adapter_found );\n+\t\tif (discard_clipped)\n+\t\t\tfprintf(get_report_file(), "discarded %u clipped reads.\\n", count_discarded_adapter_found );\n+\t\tif (discard_unknown_bases)\n+\t\t\tfprintf(get_report_file(), "discarded %u N reads.\\n", count_discarded_N );\n+\t}\n+\n+\treturn 0;\n+}\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_collapser/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastx_collapser/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,22 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+
+bin_PROGRAMS = fastx_collapser
+
+AM_CPPFLAGS = \
+ $(CC_WARNINGS) \
+ -I../libfastx
+
+fastx_collapser_SOURCES = fastx_collapser.cpp \
+ std_hash.h
+
+fastx_collapser_LDADD = ../libfastx/libfastx.a
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_collapser/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastx_collapser/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,445 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+bin_PROGRAMS = fastx_collapser$(EXEEXT)\n+subdir = src/fastx_collapser\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+am__installdirs = "$(DESTDIR)$(bindir)"\n+binPROGRAMS_INSTALL = $(INSTALL_PROGRAM)\n+PROGRAMS = $(bin_PROGRAMS)\n+am_fastx_collapser_OBJECTS = fastx_collapser.$(OBJEXT)\n+fastx_collapser_OBJECTS = $(am_fastx_collapser_OBJECTS)\n+fastx_collapser_DEPENDENCIES = ../libfastx/libfastx.a\n+DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir)\n+depcomp = $(SHELL) $(top_srcdir)/config/depcomp\n+am__depfiles_maybe = depfiles\n+CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \\\n+\t$(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)\n+CXXLD = $(CXX)\n+CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \\\n+\t-o $@\n+COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \\\n+\t$(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)\n+CCLD = $(CC)\n+LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@\n+SOURCES = $(fastx_collapser_SOURCES)\n+DIST_SOURCES = $(fastx_collapser_SOURCES)\n+ETAGS = etags\n+CTAGS = ctags\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PAC'..b'RGS)$$tags$$unique" \\\n+\t || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \\\n+\t $$tags $$unique\n+\n+GTAGS:\n+\there=`$(am__cd) $(top_builddir) && pwd` \\\n+\t && cd $(top_srcdir) \\\n+\t && gtags -i $(GTAGS_ARGS) $$here\n+\n+distclean-tags:\n+\t-rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags\n+\n+distdir: $(DISTFILES)\n+\t@srcdirstrip=`echo "$(srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\ttopsrcdirstrip=`echo "$(top_srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\tlist=\'$(DISTFILES)\'; \\\n+\t dist_files=`for file in $$list; do echo $$file; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-am\n+all-am: Makefile $(PROGRAMS)\n+installdirs:\n+\tfor dir in "$(DESTDIR)$(bindir)"; do \\\n+\t test -z "$$dir" || $(MKDIR_P) "$$dir"; \\\n+\tdone\n+install: install-am\n+install-exec: install-exec-am\n+install-data: install-data-am\n+uninstall: uninstall-am\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-am\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-am\n+\n+clean-am: clean-binPROGRAMS clean-generic mostlyclean-am\n+\n+distclean: distclean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-compile distclean-generic \\\n+\tdistclean-tags\n+\n+dvi: dvi-am\n+\n+dvi-am:\n+\n+html: html-am\n+\n+info: info-am\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-am\n+\n+install-exec-am: install-binPROGRAMS\n+\n+install-html: install-html-am\n+\n+install-info: install-info-am\n+\n+install-man:\n+\n+install-pdf: install-pdf-am\n+\n+install-ps: install-ps-am\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-am\n+\n+mostlyclean-am: mostlyclean-compile mostlyclean-generic\n+\n+pdf: pdf-am\n+\n+pdf-am:\n+\n+ps: ps-am\n+\n+ps-am:\n+\n+uninstall-am: uninstall-binPROGRAMS\n+\n+.MAKE: install-am install-strip\n+\n+.PHONY: CTAGS GTAGS all all-am check check-am clean clean-binPROGRAMS \\\n+\tclean-generic ctags distclean distclean-compile \\\n+\tdistclean-generic distclean-tags distdir dvi dvi-am html \\\n+\thtml-am info info-am install install-am install-binPROGRAMS \\\n+\tinstall-data install-data-am install-dvi install-dvi-am \\\n+\tinstall-exec install-exec-am install-html install-html-am \\\n+\tinstall-info install-info-am install-man install-pdf \\\n+\tinstall-pdf-am install-ps install-ps-am install-strip \\\n+\tinstallcheck installcheck-am installdirs maintainer-clean \\\n+\tmaintainer-clean-generic mostlyclean mostlyclean-compile \\\n+\tmostlyclean-generic pdf pdf-am ps ps-am tags uninstall \\\n+\tuninstall-am uninstall-binPROGRAMS\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_collapser/fastx_collapser.cpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastx_collapser/fastx_collapser.cpp Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,116 @@
+/*
+    FASTX-toolkit - FASTA/FASTQ preprocessing tools.
+    Copyright (C) 2009  A. Gordon (gordon@cshl.edu)
+
+    This program is free software: you can redistribute it and/or modify
+    it under the terms of the GNU Affero General Public License as
+    published by the Free Software Foundation, either version 3 of the
+    License, or (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU Affero General Public License for more details.
+
+    You should have received a copy of the GNU Affero General Public License
+    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+*/
+#include <err.h>
+#include <getopt.h>
+#include <string.h>
+#include <algorithm>
+#include <cstdlib>
+#include <ios>
+#include <iostream>
+#include <string>
+#include <ostream>
+#include <fstream>
+#include <map>
+#include <list>
+
+#include <config.h>
+
+#include "fastx.h"
+#include "fastx_args.h"
+
+using namespace std;
+
+const char* usage=
+"usage: fastx_collapser [-h] [-v] [-i INFILE] [-o OUTFILE]\n" \
+"\n" \
+"version " VERSION "\n" \
+"   [-h]         = This helpful help screen.\n" \
+"   [-v]         = verbose: print short summary of input/output counts\n" \
+"   [-i INFILE]  = FASTA/Q input file. default is STDIN.\n" \
+"   [-o OUTFILE] = FASTA/Q output file. default is STDOUT.\n" \
+"\n";
+
+FASTX fastx;
+#include <tr1/unordered_map>
+std::tr1::unordered_map<string,size_t> collapsed_sequences;
+std::list< pair<string,size_t> > sorted_collapsed_sequences ;
+
+struct PrintCollapsedSequence
+{
+ size_t counter;
+ size_t total_reads ;
+
+ ostream &output ;
+ PrintCollapsedSequence( ostream& _output ) :
+ counter(0),
+ total_reads(0),
+ output(_output) {}
+
+ void operator() ( const std::pair<string, int> & sequence )
+ {
+ counter++;
+ total_reads += sequence.second ;
+ output << ">" << counter << "-" << sequence.second << endl << sequence.first << endl ;
+ }
+};
+
+bool sort_by_abundance_count ( const pair<string, size_t> & sequence1, const pair<string, size_t>& sequence2 )
+{
+ return sequence1.second < sequence2.second ;
+}
+
+int main(int argc, char* argv[])
+{
+ ofstream output_file ;
+
+ fastx_parse_cmdline(argc, argv, "", NULL );
+
+ fastx_init_reader(&fastx, get_input_filename(),
+ FASTA_OR_FASTQ, ALLOW_N, REQUIRE_UPPERCASE);
+
+ bool use_stdout = true;
+ if ( strcmp(get_output_filename(), "-")!=0 ) {
+ use_stdout = false;
+ output_file.open(get_output_filename());
+ if (!output_file)
+ errx(1,"Failed to create output file (%s)", get_output_filename() );
+ }
+ ostream& real_output = (use_stdout) ? cout : output_file ;
+
+ while ( fastx_read_next_record(&fastx) ) {
+ collapsed_sequences[string(fastx.nucleotides)]++ ;
+ }
+
+ copy ( collapsed_sequences.begin(), collapsed_sequences.end(),
+ back_inserter(sorted_collapsed_sequences) ) ;
+
+ sorted_collapsed_sequences.sort ( sort_by_abundance_count ) ;
+
+ PrintCollapsedSequence stats =  for_each ( sorted_collapsed_sequences.rbegin(),
+ sorted_collapsed_sequences.rend(), PrintCollapsedSequence(real_output) ) ;
+
+ if (stats.total_reads != num_input_reads(&fastx))
+ errx(1,"Internal error: stats.total_reads (%zu) != num_input_reads(&fastx) (%zu).\n",
+ stats.total_reads, num_input_reads(&fastx) );
+
+ if ( verbose_flag() ) {
+ fprintf(get_report_file(), "Collapsd %zu reads into %zu unique sequences.\n",
+ num_input_reads(&fastx), stats.counter) ;
+ }
+ return 0;
+}

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_collapser/std_hash.h
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastx_collapser/std_hash.h Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,64 @@
+/*
+    FASTX-toolkit - FASTA/FASTQ preprocessing tools.
+    Copyright (C) 2009  A. Gordon (gordon@cshl.edu)
+
+    This program is free software: you can redistribute it and/or modify
+    it under the terms of the GNU Affero General Public License as
+    published by the Free Software Foundation, either version 3 of the
+    License, or (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU Affero General Public License for more details.
+
+    You should have received a copy of the GNU Affero General Public License
+    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+*/
+#ifndef __STD_HASH__
+#define __STD_HASH__
+
+
+/*
+ * Centralized place to load std::hash_map
+ *
+ * GCC needs the following hacks...
+ * Other compilers/systems might require different hacks
+ */
+
+#include <ext/hash_map>
+#include <ext/hash_set>
+
+namespace std
+{
+ using namespace __gnu_cxx;
+
+ struct std_string_hash
+ {
+ size_t operator()( const std::string& x ) const
+ {
+ //printf("std_string_hash: hashing '%s'\n", x.c_str());
+ return hash< const char* >()( x.c_str() );
+ }
+ };
+
+ /*
+ * 'eqstr' and 'hash_map' usage is based on http://www.sgi.com/tech/stl/hash_map.html
+ */
+ struct eqstr
+ {
+ bool operator()(const char* s1, const char* s2) const
+ {
+ return strcmp(s1, s2) == 0;
+ }
+ };
+
+ typedef hash_map< const char*, int, hash< const char* >, eqstr > hash_map_charptr_to_int;
+
+ typedef hash_map< string, int, std_string_hash > hash_map_string_to_int;
+
+ typedef hash_set < string, std_string_hash > hash_set_string ;
+}
+
+#endif
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_quality_stats/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastx_quality_stats/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,21 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+
+bin_PROGRAMS = fastx_quality_stats
+
+AM_CPPFLAGS = \
+ $(CC_WARNINGS) \
+ -I../libfastx
+
+fastx_quality_stats_SOURCES = fastx_quality_stats.c
+
+fastx_quality_stats_LDADD = ../libfastx/libfastx.a
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_quality_stats/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastx_quality_stats/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,438 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+bin_PROGRAMS = fastx_quality_stats$(EXEEXT)\n+subdir = src/fastx_quality_stats\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+am__installdirs = "$(DESTDIR)$(bindir)"\n+binPROGRAMS_INSTALL = $(INSTALL_PROGRAM)\n+PROGRAMS = $(bin_PROGRAMS)\n+am_fastx_quality_stats_OBJECTS = fastx_quality_stats.$(OBJEXT)\n+fastx_quality_stats_OBJECTS = $(am_fastx_quality_stats_OBJECTS)\n+fastx_quality_stats_DEPENDENCIES = ../libfastx/libfastx.a\n+DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir)\n+depcomp = $(SHELL) $(top_srcdir)/config/depcomp\n+am__depfiles_maybe = depfiles\n+COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \\\n+\t$(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)\n+CCLD = $(CC)\n+LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@\n+SOURCES = $(fastx_quality_stats_SOURCES)\n+DIST_SOURCES = $(fastx_quality_stats_SOURCES)\n+ETAGS = etags\n+CTAGS = ctags\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARATOR@\n+RANLIB = @RANLIB@\n+SET_MAKE = @SET_MAKE@'..b'RGS)$$tags$$unique" \\\n+\t || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \\\n+\t $$tags $$unique\n+\n+GTAGS:\n+\there=`$(am__cd) $(top_builddir) && pwd` \\\n+\t && cd $(top_srcdir) \\\n+\t && gtags -i $(GTAGS_ARGS) $$here\n+\n+distclean-tags:\n+\t-rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags\n+\n+distdir: $(DISTFILES)\n+\t@srcdirstrip=`echo "$(srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\ttopsrcdirstrip=`echo "$(top_srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\tlist=\'$(DISTFILES)\'; \\\n+\t dist_files=`for file in $$list; do echo $$file; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-am\n+all-am: Makefile $(PROGRAMS)\n+installdirs:\n+\tfor dir in "$(DESTDIR)$(bindir)"; do \\\n+\t test -z "$$dir" || $(MKDIR_P) "$$dir"; \\\n+\tdone\n+install: install-am\n+install-exec: install-exec-am\n+install-data: install-data-am\n+uninstall: uninstall-am\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-am\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-am\n+\n+clean-am: clean-binPROGRAMS clean-generic mostlyclean-am\n+\n+distclean: distclean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-compile distclean-generic \\\n+\tdistclean-tags\n+\n+dvi: dvi-am\n+\n+dvi-am:\n+\n+html: html-am\n+\n+info: info-am\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-am\n+\n+install-exec-am: install-binPROGRAMS\n+\n+install-html: install-html-am\n+\n+install-info: install-info-am\n+\n+install-man:\n+\n+install-pdf: install-pdf-am\n+\n+install-ps: install-ps-am\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-am\n+\n+mostlyclean-am: mostlyclean-compile mostlyclean-generic\n+\n+pdf: pdf-am\n+\n+pdf-am:\n+\n+ps: ps-am\n+\n+ps-am:\n+\n+uninstall-am: uninstall-binPROGRAMS\n+\n+.MAKE: install-am install-strip\n+\n+.PHONY: CTAGS GTAGS all all-am check check-am clean clean-binPROGRAMS \\\n+\tclean-generic ctags distclean distclean-compile \\\n+\tdistclean-generic distclean-tags distdir dvi dvi-am html \\\n+\thtml-am info info-am install install-am install-binPROGRAMS \\\n+\tinstall-data install-data-am install-dvi install-dvi-am \\\n+\tinstall-exec install-exec-am install-html install-html-am \\\n+\tinstall-info install-info-am install-man install-pdf \\\n+\tinstall-pdf-am install-ps install-ps-am install-strip \\\n+\tinstallcheck installcheck-am installdirs maintainer-clean \\\n+\tmaintainer-clean-generic mostlyclean mostlyclean-compile \\\n+\tmostlyclean-generic pdf pdf-am ps ps-am tags uninstall \\\n+\tuninstall-am uninstall-binPROGRAMS\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_quality_stats/fastx_quality_stats.c
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastx_quality_stats/fastx_quality_stats.c Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,293 @@\n+/*\n+ FASTX-toolkit - FASTA/FASTQ preprocessing tools.\n+ Copyright (C) 2009 A. Gordon (gordon@cshl.edu)\n+\n+ This program is free software: you can redistribute it and/or modify\n+ it under the terms of the GNU Affero General Public License as\n+ published by the Free Software Foundation, either version 3 of the\n+ License, or (at your option) any later version.\n+\n+ This program is distributed in the hope that it will be useful,\n+ but WITHOUT ANY WARRANTY; without even the implied warranty of\n+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\n+ GNU Affero General Public License for more details.\n+\n+ You should have received a copy of the GNU Affero General Public License\n+ along with this program. If not, see <http://www.gnu.org/licenses/>.\n+*/\n+#include <stdio.h>\n+#include <stdlib.h>\n+#include <string.h>\n+#include <getopt.h>\n+#include <errno.h>\n+#include <err.h>\n+\n+#include <config.h>\n+\n+#include "chomp.h"\n+#include "fastx.h"\n+#include "fastx_args.h"\n+\n+#define MAX_SEQUENCE_LENGTH (MAX_SEQ_LINE_LENGTH) // as of Nov. 2008, 110 Cycles is the max... change it as necessary\n+\n+const char* usage=\n+"usage: fastx_quality_stats [-h] [-i INFILE] [-o OUTFILE]\\n" \\\n+"\\n" \\\n+"version " VERSION " \\n" \\\n+" [-h] = This helpful help screen.\\n" \\\n+" [-i INFILE] = FASTQ input file. default is STDIN.\\n" \\\n+" [-o OUTFILE] = TEXT output file. default is STDOUT.\\n" \\\n+"\\n"\\\n+"The output TEXT file will have the following fields (one row per column):\\n" \\\n+"\tcolumn\t= column number (1 to 36 for a 36-cycles read solexa file)\\n" \\\n+"\tcount = number of bases found in this column.\\n" \\\n+"\tmin = Lowest quality score value found in this column.\\n" \\\n+"\tmax = Highest quality score value found in this column.\\n"\t\\\n+"\tsum = Sum of quality score values for this column.\\n" \\\n+"\tmean = Mean quality score value for this column.\\n" \\\n+"\tQ1\t= 1st quartile quality score.\\n" \\\n+"\tmed\t= Median quality score.\\n" \\\n+"\tQ3\t= 3rd quartile quality score.\\n" \\\n+"\tIQR\t= Inter-Quartile range (Q3-Q1).\\n" \\\n+"\tlW\t= \'Left-Whisker\' value (for boxplotting).\\n" \\\n+"\trW\t= \'Right-Whisker\' value (for boxplotting).\\n" \\\n+"\tA_Count\t= Count of \'A\' nucleotides found in this column.\\n" \\\n+"\tC_Count\t= Count of \'C\' nucleotides found in this column.\\n" \\\n+"\tG_Count\t= Count of \'G\' nucleotides found in this column.\\n" \\\n+"\tT_Count\t= Count of \'T\' nucleotides found in this column.\\n" \\\n+"\tN_Count = Count of \'N\' nucleotides found in this column.\\n" \\\n+"\tmax-count = max. number of bases (in all cycles)\\n" \\\n+"\\n";\n+;\n+\n+FILE* outfile;\n+\n+/*\n+\tInformation for each column in the solexa file.\n+\t("Column" here refers to the number of reads in the file, usually 36)\n+*/\n+struct column_data\n+{\n+\tint min;\n+\tint max;\n+\tunsigned long long sum;\n+\tint count;\n+\tint A_count;\n+\tint C_count;\n+\tint G_count;\n+\tint T_count;\n+\tint N_count;\n+\t\n+\t//Instead of keeping a sorted array of all the quality values (which is needed to find the median value),\n+\t//We keep the values in this array. similar to "Couting Sort" array in "Introduction to Algorithms", page 169.\n+\t//Each time we encounter a quality value number (in the range of MIN_QUALITY_VALUE to MAX_QUALITY_VALUE),\n+\t//we increment the count in the corresponding index of this array.\n+\tint bases_values_count[QUALITY_VALUES_RANGE];\n+};\n+\n+int sequences_count;\n+struct column_data columns[MAX_SEQUENCE_LENGTH];\n+FASTX fastx;\n+\n+void init_values()\n+{\n+\tint i,j;\n+\t\n+\tsequences_count=0;\n+\t\n+\tfor (i=0;i<MAX_SEQUENCE_LENGTH;i++) {\n+\t\t\n+\t\tcolumns[i].min = 100 ;\n+\t\tcolumns[i].max = -100;\n+\t\tcolumns[i].sum = 0;\n+\t\tcolumns[i].count = 0;\n+\t\tcolumns[i].A_count = 0;\n+\t\tcolumns[i].C_count = 0;\n+\t\tcolumns[i].G_count = 0;\n+\t\tcolumns[i].T_count = 0;\n+\t\tcolumns[i].N_count = 0;\n+\t\t\n+\t\tfor (j=0;j<QUALITY_VALUES_RANGE;j++)\n+\t\t\tcolumns[i].bases_values_count[j] = 0 ;\n+\t}\t\t\n+}\n+\n+\n+\n+void read_file()\n+{\n+\tsize_t index;\n+\tint quality_value;\n+\tint reads_count ;\n+\n+\twhile ( fastx_read_next_record(&fastx) ) {\n+\n'..b'lapsed FASTA file, each sequence can represent multiple reads\n+\t\t\tcolumns[index].count += reads_count;\n+\t\t\t\n+\t\t\t//update the base counts statistics\n+\t\t\tswitch(fastx.nucleotides[index])\n+\t\t\t{\n+\t\t\t\tcase \'A\': columns[index].A_count+=reads_count; break;\n+\t\t\t\tcase \'C\': columns[index].C_count+=reads_count; break;\n+\t\t\t\tcase \'T\': columns[index].T_count+=reads_count; break;\n+\t\t\t\tcase \'G\': columns[index].G_count+=reads_count; break;\n+\t\t\t\tcase \'N\': columns[index].N_count+=reads_count; break;\n+\n+\t\t\t\t/* This shoudn\'t really happen, as \'fastx_read_next_record\' should catch invalid values */\n+\t\t\t\tdefault: errx(1, "Internal error: invalid base value (%c)!", fastx.nucleotides[index]) ;\n+\t\t\t}\n+\t\t} \n+\n+\t\tsequences_count++;\n+\n+\t\t//DEBUG\n+\t\t//if ( (fileline-1) % 10000==0 ) { fprintf(stderr,"."); fflush(stderr) ; }\n+\t}\n+}\n+\n+int get_nth_value(int base_index, int n)\n+{\n+\tint pos;\n+\t\n+\tif (base_index<0 || base_index>MAX_SEQUENCE_LENGTH) {\n+\t\tfprintf(stderr,"Internal error at get_nth_value, base_index=%d\\n", base_index);\n+\t\texit(1);\n+\t}\n+\tif (n<0 || n>=columns[base_index].count) {\n+\t\tfprintf(stderr,"Internal error at get_nth_value (base_index=%d, n=%d), count_values[%d]=%d\\n",\n+\t\t\tbase_index, n, base_index, columns[base_index].count ) ;\n+\t\texit(1);\n+\t}\n+\t\n+\tif (n==0) \n+\t\treturn columns[base_index].min;\n+\t\n+\t\n+\tpos = 0 ;\n+\twhile (n > 0) {\n+\t\tif (columns[base_index].bases_values_count[pos] > n)\n+\t\t\tbreak;\n+\t\tn -= columns[base_index].bases_values_count[pos];\n+\t\tpos++;\n+\t\twhile (columns[base_index].bases_values_count[pos]==0)\n+\t\t\tpos++;\n+\t}\n+\treturn pos + MIN_QUALITY_VALUE ;\n+}\n+\n+void print_statistics()\n+{\n+\tint i;\n+\tint Q1,Q3,IQR;\n+\tint LeftWisker, RightWisker;\n+\t\n+\t//Fields:\n+\tfprintf(outfile,"column\\t");\n+\tfprintf(outfile,"count\\tmin\\tmax\\tsum\\t");\n+\tfprintf(outfile,"mean\\tQ1\\tmed\\tQ3\\t");\n+\tfprintf(outfile,"IQR\\tlW\\trW\\t");\n+\tfprintf(outfile,"A_Count\\tC_Count\\tG_Count\\tT_Count\\tN_Count\\t");\n+\tfprintf(outfile,"Max_count\\n");\n+\tfor (i=0;i<MAX_SEQUENCE_LENGTH;i++) {\n+\t\tif (columns[i].count==0)\n+\t\t\tbreak;\n+\t\t\n+\t\tQ1 = get_nth_value ( i, columns[i].count / 4 );\n+\t\tQ3 = get_nth_value ( i, columns[i].count * 3 / 4 );\n+\t\tIQR = Q3 - Q1 ;\n+\t\t\n+\t\tif ( (Q1 - IQR*3/2) < columns[i].min )\n+\t\t\tLeftWisker = columns[i].min;\n+\t\telse\n+\t\t\tLeftWisker = (Q1 - IQR*3/2); //TODO - make sure there\'s an observed value at this point\n+\t\t\n+\t\tif ( (Q3 + IQR*3/2) > columns[i].max )\n+\t\t\tRightWisker = columns[i].max;\n+\t\telse\n+\t\t\tRightWisker = (Q3 + IQR*3/2); //TODO - make sure there\'s an observed value at this point\n+\n+\t\t//Column number\n+\t\tfprintf(outfile,"%d\\t", i+1);\n+\t\t\n+\t\tfprintf(outfile,"%d\\t%d\\t%d\\t%lld\\t",\n+\t\t\tcolumns[i].count,\n+\t\t\tcolumns[i].min,\n+\t\t\tcolumns[i].max,\n+\t\t\tcolumns[i].sum);\n+\t\t\n+\t\t\n+\t\tfprintf(outfile,"%3.2f\\t%d\\t%d\\t%d\\t",\n+\t\t\t((double)columns[i].sum)/((double)columns[i].count),\n+\t\t\tQ1,\n+\t\t\tget_nth_value ( i, columns[i].count / 2 ),\n+\t\t\tQ3);\n+\t\t\n+\t\tfprintf(outfile,"%d\\t%d\\t%d\\t",\n+\t\t\tIQR,\n+\t\t\tLeftWisker,\n+\t\t\tRightWisker\n+\t\t\t);\n+\t\t\t\n+\t\tfprintf(outfile,"%d\\t%d\\t%d\\t%d\\t%d\\t",\n+\t\t\tcolumns[i].A_count,\n+\t\t\tcolumns[i].C_count,\n+\t\t\tcolumns[i].G_count,\n+\t\t\tcolumns[i].T_count,\n+\t\t\tcolumns[i].N_count);\n+\n+\n+\t\t//Maximum number of bases (out of all cycles/columns).\n+\t\t//it is always equal to the count of the first column\n+\t\t//(since all reads have a base at the first column, \n+\t\t// but some might not have base at later columns (if they were clipped) )\n+\t\tfprintf(outfile,"%d\\n",\n+\t\t\tcolumns[0].count ) ;\n+\t}\n+}\n+\n+void parse_commandline(int argc, char* argv[])\n+{\n+\tfastx_parse_cmdline(argc, argv, "", NULL);\n+\n+\tfastx_init_reader(&fastx, get_input_filename(), \n+\t\tFASTA_OR_FASTQ, ALLOW_N, REQUIRE_UPPERCASE);\n+\n+\tif (strcmp( get_output_filename(), "-" ) == 0 ) {\n+\t\toutfile = stdout;\n+\t} else {\n+\t\toutfile = fopen(get_output_filename(), "w+");\n+\t\tif (outfile==NULL)\t\n+\t\t\terr(1,"Failed to create output file (%s)", get_output_filename());\n+\t}\n+}\n+\n+\n+int main(int argc, char* argv[])\n+{\n+\tparse_commandline(argc,argv);\n+\tinit_values();\n+\tread_file();\n+\tprint_statistics();\n+\treturn 0;\n+}\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_reverse_complement/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastx_reverse_complement/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,21 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+
+bin_PROGRAMS = fastx_reverse_complement
+
+AM_CPPFLAGS = \
+ $(CC_WARNINGS) \
+ -I../libfastx
+
+fastx_reverse_complement_SOURCES = fastx_reverse_complement.c
+
+fastx_reverse_complement_LDADD = ../libfastx/libfastx.a
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_reverse_complement/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastx_reverse_complement/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,440 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+bin_PROGRAMS = fastx_reverse_complement$(EXEEXT)\n+subdir = src/fastx_reverse_complement\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+am__installdirs = "$(DESTDIR)$(bindir)"\n+binPROGRAMS_INSTALL = $(INSTALL_PROGRAM)\n+PROGRAMS = $(bin_PROGRAMS)\n+am_fastx_reverse_complement_OBJECTS = \\\n+\tfastx_reverse_complement.$(OBJEXT)\n+fastx_reverse_complement_OBJECTS = \\\n+\t$(am_fastx_reverse_complement_OBJECTS)\n+fastx_reverse_complement_DEPENDENCIES = ../libfastx/libfastx.a\n+DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir)\n+depcomp = $(SHELL) $(top_srcdir)/config/depcomp\n+am__depfiles_maybe = depfiles\n+COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \\\n+\t$(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)\n+CCLD = $(CC)\n+LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@\n+SOURCES = $(fastx_reverse_complement_SOURCES)\n+DIST_SOURCES = $(fastx_reverse_complement_SOURCES)\n+ETAGS = etags\n+CTAGS = ctags\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PA'..b'RGS)$$tags$$unique" \\\n+\t || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \\\n+\t $$tags $$unique\n+\n+GTAGS:\n+\there=`$(am__cd) $(top_builddir) && pwd` \\\n+\t && cd $(top_srcdir) \\\n+\t && gtags -i $(GTAGS_ARGS) $$here\n+\n+distclean-tags:\n+\t-rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags\n+\n+distdir: $(DISTFILES)\n+\t@srcdirstrip=`echo "$(srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\ttopsrcdirstrip=`echo "$(top_srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\tlist=\'$(DISTFILES)\'; \\\n+\t dist_files=`for file in $$list; do echo $$file; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-am\n+all-am: Makefile $(PROGRAMS)\n+installdirs:\n+\tfor dir in "$(DESTDIR)$(bindir)"; do \\\n+\t test -z "$$dir" || $(MKDIR_P) "$$dir"; \\\n+\tdone\n+install: install-am\n+install-exec: install-exec-am\n+install-data: install-data-am\n+uninstall: uninstall-am\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-am\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-am\n+\n+clean-am: clean-binPROGRAMS clean-generic mostlyclean-am\n+\n+distclean: distclean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-compile distclean-generic \\\n+\tdistclean-tags\n+\n+dvi: dvi-am\n+\n+dvi-am:\n+\n+html: html-am\n+\n+info: info-am\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-am\n+\n+install-exec-am: install-binPROGRAMS\n+\n+install-html: install-html-am\n+\n+install-info: install-info-am\n+\n+install-man:\n+\n+install-pdf: install-pdf-am\n+\n+install-ps: install-ps-am\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-am\n+\n+mostlyclean-am: mostlyclean-compile mostlyclean-generic\n+\n+pdf: pdf-am\n+\n+pdf-am:\n+\n+ps: ps-am\n+\n+ps-am:\n+\n+uninstall-am: uninstall-binPROGRAMS\n+\n+.MAKE: install-am install-strip\n+\n+.PHONY: CTAGS GTAGS all all-am check check-am clean clean-binPROGRAMS \\\n+\tclean-generic ctags distclean distclean-compile \\\n+\tdistclean-generic distclean-tags distdir dvi dvi-am html \\\n+\thtml-am info info-am install install-am install-binPROGRAMS \\\n+\tinstall-data install-data-am install-dvi install-dvi-am \\\n+\tinstall-exec install-exec-am install-html install-html-am \\\n+\tinstall-info install-info-am install-man install-pdf \\\n+\tinstall-pdf-am install-ps install-ps-am install-strip \\\n+\tinstallcheck installcheck-am installdirs maintainer-clean \\\n+\tmaintainer-clean-generic mostlyclean mostlyclean-compile \\\n+\tmostlyclean-generic pdf pdf-am ps ps-am tags uninstall \\\n+\tuninstall-am uninstall-binPROGRAMS\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_reverse_complement/fastx_reverse_complement.c
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastx_reverse_complement/fastx_reverse_complement.c Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,126 @@
+/*
+    FASTX-toolkit - FASTA/FASTQ preprocessing tools.
+    Copyright (C) 2009  A. Gordon (gordon@cshl.edu)
+
+    This program is free software: you can redistribute it and/or modify
+    it under the terms of the GNU Affero General Public License as
+    published by the Free Software Foundation, either version 3 of the
+    License, or (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU Affero General Public License for more details.
+
+    You should have received a copy of the GNU Affero General Public License
+    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+*/
+#include <limits.h>
+#include <stdio.h>
+#include <stdlib.h>
+#include <string.h>
+#include <getopt.h>
+#include <errno.h>
+#include <err.h>
+
+#include <config.h>
+
+#include "fastx.h"
+#include "fastx_args.h"
+
+const char* usage=
+"usage: fastx_reverse_complement [-h] [-r] [-z] [-v] [-i INFILE] [-o OUTFILE]\n" \
+"\n" \
+"version " VERSION "\n" \
+"   [-h]         = This helpful help screen.\n" \
+"   [-z]         = Compress output with GZIP.\n" \
+"   [-i INFILE]  = FASTA/Q input file. default is STDIN.\n" \
+"   [-o OUTFILE] = FASTA/Q output file. default is STDOUT.\n" \
+"\n";
+
+FASTX fastx;
+
+char reverse_complement_base ( const char input )
+{
+ switch(input)
+ {
+ case 'N':
+ return 'N';
+ case 'n':
+ return 'n';
+ case 'A':
+ return 'T';
+ case 'T':
+ return 'A';
+ case 'G':
+ return 'C';
+ case 'C':
+ return 'G';
+ case 'a':
+ return 't';
+ case 't':
+ return 'a';
+ case 'g':
+ return 'c';
+ case 'c':
+ return 'g';
+ default:
+ errx(1,"Invalid nucleotide value (%c) in reverse_complement_base()", input );
+ }
+
+}
+
+void reverse_complement_fastx(FASTX* pFASTX)
+{
+ int i,j ;
+ int length = strlen(pFASTX->nucleotides);
+
+ char temp_nuc;
+ int  temp_qual;
+
+ for (i=0;i<length;i++)
+ pFASTX->nucleotides[i] = reverse_complement_base ( pFASTX->nucleotides[i] ) ;
+
+ i = 0 ;
+ j = length - 1 ;
+ while ( i < j ) {
+ //Swap the nucleotides
+ temp_nuc = pFASTX->nucleotides[i] ;
+ pFASTX->nucleotides[i] = pFASTX->nucleotides[j] ;
+ pFASTX->nucleotides[j] = temp_nuc;
+
+ //Swap the quality scores
+ if (pFASTX->read_fastq) {
+ temp_qual = pFASTX->quality[i];
+ pFASTX->quality[i] = pFASTX->quality[j];
+ pFASTX->quality[j] = temp_qual ;
+ }
+
+ //Advance to next position
+ i++;
+ j--;
+ }
+}
+
+
+int main(int argc, char* argv[])
+{
+ fastx_parse_cmdline(argc, argv, "", NULL);
+
+ fastx_init_reader(&fastx, get_input_filename(),
+ FASTA_OR_FASTQ, ALLOW_N, REQUIRE_UPPERCASE);
+
+ fastx_init_writer(&fastx, get_output_filename(), OUTPUT_SAME_AS_INPUT, compress_output_flag());
+
+ while ( fastx_read_next_record(&fastx) ) {
+ reverse_complement_fastx(&fastx);
+ fastx_write_record(&fastx);
+ }
+
+ if ( verbose_flag() ) {
+ fprintf(get_report_file(), "Printing Reverse-Complement Sequences.\n" );
+ fprintf(get_report_file(), "Input: %zu reads.\n", num_input_reads(&fastx) ) ;
+ fprintf(get_report_file(), "Output: %zu reads.\n", num_output_reads(&fastx) ) ;
+ }
+ return 0;
+}

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_trimmer/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastx_trimmer/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,21 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+
+bin_PROGRAMS = fastx_trimmer
+
+AM_CPPFLAGS = \
+ $(CC_WARNINGS) \
+ -I../libfastx
+
+fastx_trimmer_SOURCES = fastx_trimmer.c
+
+fastx_trimmer_LDADD = ../libfastx/libfastx.a
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_trimmer/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastx_trimmer/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,438 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+bin_PROGRAMS = fastx_trimmer$(EXEEXT)\n+subdir = src/fastx_trimmer\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+am__installdirs = "$(DESTDIR)$(bindir)"\n+binPROGRAMS_INSTALL = $(INSTALL_PROGRAM)\n+PROGRAMS = $(bin_PROGRAMS)\n+am_fastx_trimmer_OBJECTS = fastx_trimmer.$(OBJEXT)\n+fastx_trimmer_OBJECTS = $(am_fastx_trimmer_OBJECTS)\n+fastx_trimmer_DEPENDENCIES = ../libfastx/libfastx.a\n+DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir)\n+depcomp = $(SHELL) $(top_srcdir)/config/depcomp\n+am__depfiles_maybe = depfiles\n+COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \\\n+\t$(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)\n+CCLD = $(CC)\n+LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@\n+SOURCES = $(fastx_trimmer_SOURCES)\n+DIST_SOURCES = $(fastx_trimmer_SOURCES)\n+ETAGS = etags\n+CTAGS = ctags\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARATOR@\n+RANLIB = @RANLIB@\n+SET_MAKE = @SET_MAKE@\n+SHELL = @SHELL@\n+STRIP = @STRIP@\n+VERSION = @VERSION'..b'RGS)$$tags$$unique" \\\n+\t || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \\\n+\t $$tags $$unique\n+\n+GTAGS:\n+\there=`$(am__cd) $(top_builddir) && pwd` \\\n+\t && cd $(top_srcdir) \\\n+\t && gtags -i $(GTAGS_ARGS) $$here\n+\n+distclean-tags:\n+\t-rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags\n+\n+distdir: $(DISTFILES)\n+\t@srcdirstrip=`echo "$(srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\ttopsrcdirstrip=`echo "$(top_srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\tlist=\'$(DISTFILES)\'; \\\n+\t dist_files=`for file in $$list; do echo $$file; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-am\n+all-am: Makefile $(PROGRAMS)\n+installdirs:\n+\tfor dir in "$(DESTDIR)$(bindir)"; do \\\n+\t test -z "$$dir" || $(MKDIR_P) "$$dir"; \\\n+\tdone\n+install: install-am\n+install-exec: install-exec-am\n+install-data: install-data-am\n+uninstall: uninstall-am\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-am\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-am\n+\n+clean-am: clean-binPROGRAMS clean-generic mostlyclean-am\n+\n+distclean: distclean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-compile distclean-generic \\\n+\tdistclean-tags\n+\n+dvi: dvi-am\n+\n+dvi-am:\n+\n+html: html-am\n+\n+info: info-am\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-am\n+\n+install-exec-am: install-binPROGRAMS\n+\n+install-html: install-html-am\n+\n+install-info: install-info-am\n+\n+install-man:\n+\n+install-pdf: install-pdf-am\n+\n+install-ps: install-ps-am\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-am\n+\n+mostlyclean-am: mostlyclean-compile mostlyclean-generic\n+\n+pdf: pdf-am\n+\n+pdf-am:\n+\n+ps: ps-am\n+\n+ps-am:\n+\n+uninstall-am: uninstall-binPROGRAMS\n+\n+.MAKE: install-am install-strip\n+\n+.PHONY: CTAGS GTAGS all all-am check check-am clean clean-binPROGRAMS \\\n+\tclean-generic ctags distclean distclean-compile \\\n+\tdistclean-generic distclean-tags distdir dvi dvi-am html \\\n+\thtml-am info info-am install install-am install-binPROGRAMS \\\n+\tinstall-data install-data-am install-dvi install-dvi-am \\\n+\tinstall-exec install-exec-am install-html install-html-am \\\n+\tinstall-info install-info-am install-man install-pdf \\\n+\tinstall-pdf-am install-ps install-ps-am install-strip \\\n+\tinstallcheck installcheck-am installdirs maintainer-clean \\\n+\tmaintainer-clean-generic mostlyclean mostlyclean-compile \\\n+\tmostlyclean-generic pdf pdf-am ps ps-am tags uninstall \\\n+\tuninstall-am uninstall-binPROGRAMS\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/fastx_trimmer/fastx_trimmer.c
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/fastx_trimmer/fastx_trimmer.c Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,114 @@
+/*
+    FASTX-toolkit - FASTA/FASTQ preprocessing tools.
+    Copyright (C) 2009  A. Gordon (gordon@cshl.edu)
+
+    This program is free software: you can redistribute it and/or modify
+    it under the terms of the GNU Affero General Public License as
+    published by the Free Software Foundation, either version 3 of the
+    License, or (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU Affero General Public License for more details.
+
+    You should have received a copy of the GNU Affero General Public License
+    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+*/
+#include <limits.h>
+#include <stdio.h>
+#include <stdlib.h>
+#include <string.h>
+#include <getopt.h>
+#include <errno.h>
+#include <err.h>
+
+#include <config.h>
+
+#include "fastx.h"
+#include "fastx_args.h"
+
+#define MAX_ADAPTER_LEN 100
+
+const char* usage=
+"usage: fastx_trimmer [-h] [-f N] [-l N] [-z] [-v] [-i INFILE] [-o OUTFILE]\n" \
+"\n" \
+"version " VERSION "\n" \
+"   [-h]         = This helpful help screen.\n" \
+"   [-f N]       = First base to keep. Default is 1 (=first base).\n" \
+"   [-l N]       = Last base to keep. Default is entire read.\n" \
+"   [-z]         = Compress output with GZIP.\n" \
+"   [-i INFILE]  = FASTA/Q input file. default is STDIN.\n" \
+"   [-o OUTFILE] = FASTA/Q output file. default is STDOUT.\n" \
+"\n";
+
+#define DO_NOT_TRIM_LAST_BASE (0)
+
+int keep_first_base=1;
+int keep_last_base=DO_NOT_TRIM_LAST_BASE;
+
+FASTX fastx;
+
+int parse_program_args(int __attribute__((unused)) optind, int optc, char* optarg)
+{
+ switch(optc) {
+ case 'f':
+ if (optarg==NULL)
+ errx(1, "[-f] parameter requires an argument value");
+ keep_first_base = strtoul(optarg,NULL,10);
+ if (keep_first_base<=0 || keep_first_base>=MAX_SEQ_LINE_LENGTH)
+ errx(1,"Invalid number bases to keep (-f %s)", optarg);
+ break;
+
+ case 'l':
+ if (optarg==NULL)
+ errx(1, "[-l] parameter requires an argument value");
+ keep_last_base = strtoul(optarg,NULL,10);
+ if (keep_last_base<=0 ||  keep_last_base>=MAX_SEQ_LINE_LENGTH)
+ errx(1,"Invalid number bases to keep (-l %s)", optarg);
+ break;
+
+ default:
+ errx(1, __FILE__ ":%d: Unknown argument (%c)", __LINE__, optc ) ;
+
+ }
+ return 1;
+}
+
+
+int main(int argc, char* argv[])
+{
+ size_t i;
+
+ fastx_parse_cmdline(argc, argv, "l:f:", parse_program_args);
+
+ fastx_init_reader(&fastx, get_input_filename(),
+ FASTA_OR_FASTQ, ALLOW_N, REQUIRE_UPPERCASE);
+
+ fastx_init_writer(&fastx, get_output_filename(), OUTPUT_SAME_AS_INPUT, compress_output_flag());
+
+ while ( fastx_read_next_record(&fastx) ) {
+
+ if (keep_last_base != DO_NOT_TRIM_LAST_BASE) {
+ fastx.nucleotides[keep_last_base] = 0 ;
+ }
+
+ if (keep_first_base != 1) {
+ for (i=0; i < strlen(fastx.nucleotides)-keep_first_base+1 ; i++) {
+ fastx.nucleotides[i] = fastx.nucleotides[i+keep_first_base-1];
+ fastx.quality[i] = fastx.quality[i+keep_first_base-1];
+ }
+ fastx.nucleotides[i] = 0 ;
+ }
+
+ //none of the above condition matched, so print this sequence.
+ fastx_write_record(&fastx);
+ }
+
+ if ( verbose_flag() ) {
+ fprintf(get_report_file(), "Trimming: base %d to %d\n", keep_first_base, keep_last_base ) ;
+ fprintf(get_report_file(), "Input: %zu reads.\n", num_input_reads(&fastx) ) ;
+ fprintf(get_report_file(), "Output: %zu reads.\n", num_output_reads(&fastx) ) ;
+ }
+ return 0;
+}

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/libfastx/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/libfastx/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,8 @@
+
+noinst_LIBRARIES = libfastx.a
+
+libfastx_a_SOURCES = chomp.c chomp.h \
+      fastx.c fastx.h \
+      fastx_args.c fastx_args.h \
+      sequence_alignment.h sequence_alignment.cpp
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/libfastx/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/libfastx/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,429 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+subdir = src/libfastx\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+LIBRARIES = $(noinst_LIBRARIES)\n+AR = ar\n+ARFLAGS = cru\n+libfastx_a_AR = $(AR) $(ARFLAGS)\n+libfastx_a_LIBADD =\n+am_libfastx_a_OBJECTS = chomp.$(OBJEXT) fastx.$(OBJEXT) \\\n+\tfastx_args.$(OBJEXT) sequence_alignment.$(OBJEXT)\n+libfastx_a_OBJECTS = $(am_libfastx_a_OBJECTS)\n+DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir)\n+depcomp = $(SHELL) $(top_srcdir)/config/depcomp\n+am__depfiles_maybe = depfiles\n+COMPILE = $(CC) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) $(AM_CPPFLAGS) \\\n+\t$(CPPFLAGS) $(AM_CFLAGS) $(CFLAGS)\n+CCLD = $(CC)\n+LINK = $(CCLD) $(AM_CFLAGS) $(CFLAGS) $(AM_LDFLAGS) $(LDFLAGS) -o $@\n+CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \\\n+\t$(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)\n+CXXLD = $(CXX)\n+CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \\\n+\t-o $@\n+SOURCES = $(libfastx_a_SOURCES)\n+DIST_SOURCES = $(libfastx_a_SOURCES)\n+ETAGS = etags\n+CTAGS = ctags\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARATOR@\n+RANLIB = @RANLIB@\n+SET_MAKE = @SET_MAKE@\n+SHELL = @SHELL@\n+STRIP = @STRIP@\n+VERSION = @VERSION@\n+abs_builddir = @abs_builddir@\n+abs_srcdir = @abs_srcdir@\n+abs_top_builddir = @abs_top_builddir@\n+abs_top_srcdir = @abs_top_srcdir@\n+ac_ct_CC = @ac_ct_CC@\n+ac_ct_CXX = @ac_ct_CXX@\n+am__include = @am__include@\n+am__leading_dot = @am__leading_dot@\n+am__quote = @am__quote@\n+am__tar = @am__tar@\n+am__untar = @am__un'..b'$(srcdir)/$$i; fi; \\\n+\t done | \\\n+\t $(AWK) \'{ files[$$0] = 1; nonempty = 1; } \\\n+\t END { if (nonempty) { for (i in files) print i; }; }\'`; \\\n+\ttest -z "$(CTAGS_ARGS)$$tags$$unique" \\\n+\t || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \\\n+\t $$tags $$unique\n+\n+GTAGS:\n+\there=`$(am__cd) $(top_builddir) && pwd` \\\n+\t && cd $(top_srcdir) \\\n+\t && gtags -i $(GTAGS_ARGS) $$here\n+\n+distclean-tags:\n+\t-rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags\n+\n+distdir: $(DISTFILES)\n+\t@srcdirstrip=`echo "$(srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\ttopsrcdirstrip=`echo "$(top_srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\tlist=\'$(DISTFILES)\'; \\\n+\t dist_files=`for file in $$list; do echo $$file; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-am\n+all-am: Makefile $(LIBRARIES)\n+installdirs:\n+install: install-am\n+install-exec: install-exec-am\n+install-data: install-data-am\n+uninstall: uninstall-am\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-am\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-am\n+\n+clean-am: clean-generic clean-noinstLIBRARIES mostlyclean-am\n+\n+distclean: distclean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-compile distclean-generic \\\n+\tdistclean-tags\n+\n+dvi: dvi-am\n+\n+dvi-am:\n+\n+html: html-am\n+\n+info: info-am\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-am\n+\n+install-exec-am:\n+\n+install-html: install-html-am\n+\n+install-info: install-info-am\n+\n+install-man:\n+\n+install-pdf: install-pdf-am\n+\n+install-ps: install-ps-am\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-am\n+\n+mostlyclean-am: mostlyclean-compile mostlyclean-generic\n+\n+pdf: pdf-am\n+\n+pdf-am:\n+\n+ps: ps-am\n+\n+ps-am:\n+\n+uninstall-am:\n+\n+.MAKE: install-am install-strip\n+\n+.PHONY: CTAGS GTAGS all all-am check check-am clean clean-generic \\\n+\tclean-noinstLIBRARIES ctags distclean distclean-compile \\\n+\tdistclean-generic distclean-tags distdir dvi dvi-am html \\\n+\thtml-am info info-am install install-am install-data \\\n+\tinstall-data-am install-dvi install-dvi-am install-exec \\\n+\tinstall-exec-am install-html install-html-am install-info \\\n+\tinstall-info-am install-man install-pdf install-pdf-am \\\n+\tinstall-ps install-ps-am install-strip installcheck \\\n+\tinstallcheck-am installdirs maintainer-clean \\\n+\tmaintainer-clean-generic mostlyclean mostlyclean-compile \\\n+\tmostlyclean-generic pdf pdf-am ps ps-am tags uninstall \\\n+\tuninstall-am\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/libfastx/chomp.c
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/libfastx/chomp.c Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,46 @@
+/*
+    FASTX-toolkit - FASTA/FASTQ preprocessing tools.
+    Copyright (C) 2009  A. Gordon (gordon@cshl.edu)
+
+    This program is free software: you can redistribute it and/or modify
+    it under the terms of the GNU Affero General Public License as
+    published by the Free Software Foundation, either version 3 of the
+    License, or (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU Affero General Public License for more details.
+
+    You should have received a copy of the GNU Affero General Public License
+    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+*/
+#include "chomp.h"
+
+/*
+ Chomp -
+ Removes CR/LF from given string.
+
+ Input -
+ string - NULL terminated string.
+ WILL BE MODIFIED!
+ Output -
+ None
+
+ Remarks -
+ The first CR (ASCII 13) or LF (ASCII 10) found in the string will be replaced with a NULL -
+ Effectively chomping the string.
+*/
+void chomp(char *string)
+{
+ while (*string != 0) {
+ if (*string==13 || *string==10) {
+ *string = 0 ;
+ return;
+ }
+ string++;
+ }
+ return ;
+}
+
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/libfastx/chomp.h
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/libfastx/chomp.h Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,24 @@
+/*
+    FASTX-toolkit - FASTA/FASTQ preprocessing tools.
+    Copyright (C) 2009  A. Gordon (gordon@cshl.edu)
+
+    This program is free software: you can redistribute it and/or modify
+    it under the terms of the GNU Affero General Public License as
+    published by the Free Software Foundation, either version 3 of the
+    License, or (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU Affero General Public License for more details.
+
+    You should have received a copy of the GNU Affero General Public License
+    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+*/
+#ifndef __CHOMP_H__
+#define __CHOMP_H__
+
+void chomp(char *string);
+
+#endif
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/libfastx/fastx.c
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/libfastx/fastx.c Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,481 @@\n+/*\n+ FASTX-toolkit - FASTA/FASTQ preprocessing tools.\n+ Copyright (C) 2009 A. Gordon (gordon@cshl.edu)\n+\n+ This program is free software: you can redistribute it and/or modify\n+ it under the terms of the GNU Affero General Public License as\n+ published by the Free Software Foundation, either version 3 of the\n+ License, or (at your option) any later version.\n+\n+ This program is distributed in the hope that it will be useful,\n+ but WITHOUT ANY WARRANTY; without even the implied warranty of\n+ MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\n+ GNU Affero General Public License for more details.\n+\n+ You should have received a copy of the GNU Affero General Public License\n+ along with this program. If not, see <http://www.gnu.org/licenses/>.\n+*/\n+#include <stdio.h>\n+#include <stdlib.h>\n+#include <error.h>\n+#include <err.h>\n+#include <string.h>\n+#include <linux/limits.h>\n+#include <unistd.h>\n+#include <sys/types.h>\n+#include <sys/stat.h>\n+#include <fcntl.h>\n+\n+\n+#include "chomp.h"\n+#include "fastx.h"\n+\n+/*\n+\tvalid_sequence_string - \n+\t\tcheck validity of a given sequence string.\n+\t\n+\tinput - \n+\t\tsequence - NULL terminated string to be validated.\n+\n+\tOutput - \n+\t\t1 (true) - The given sequence is valid - contained only A/C/G/N/T characters.\n+\t\t0 (false) - The given string contained invalid characeters.\n+\n+\tRemark -\n+\t\tsequences with unknown (N) bases are considered VALID.\n+*/\n+static int validate_nucleotides_string(const FASTX *pFASTX)\n+{\n+\tint match = 1 ;\n+\tconst char* seq = pFASTX->nucleotides;\n+\t\n+\twhile (*seq != \'\\0\' && match) {\n+\t\tmatch &= pFASTX->allowed_nucleotides[ (int) *seq ];\n+\t\tseq++;\n+\t}\n+\treturn match;\n+}\n+\n+static void create_lookup_table(FASTX *pFASTX)\n+{\n+\tint i;\n+\n+\tfor (i=0; i<256; i++)\n+\t\tpFASTX->allowed_nucleotides[i] = 0 ;\n+\n+\tpFASTX->allowed_nucleotides[\'A\'] = 1;\n+\tpFASTX->allowed_nucleotides[\'C\'] = 1;\n+\tpFASTX->allowed_nucleotides[\'G\'] = 1;\n+\tpFASTX->allowed_nucleotides[\'T\'] = 1;\n+\n+\tif (pFASTX->allow_N)\n+\t\tpFASTX->allowed_nucleotides[\'N\'] = 1;\n+\n+\tif (pFASTX->allow_lowercase) {\n+\t\tpFASTX->allowed_nucleotides[\'a\'] = 1;\n+\t\tpFASTX->allowed_nucleotides[\'c\'] = 1;\n+\t\tpFASTX->allowed_nucleotides[\'g\'] = 1;\n+\t\tpFASTX->allowed_nucleotides[\'t\'] = 1;\n+\n+\t\tif (pFASTX->allow_N)\n+\t\t\tpFASTX->allowed_nucleotides[\'n\'] = 1;\n+\t}\n+}\n+\n+static void detect_input_format(FASTX *pFASTX)\n+{\n+\t//Get the first character in the file,\n+\t//and put it right back\n+\tint c = fgetc(pFASTX->input);\n+\tungetc(c, pFASTX->input);\n+\t\n+\tswitch(c) {\n+\tcase \'>\':\t/* FASTA file */\n+\t\tif ( pFASTX->allow_input_filetype==FASTQ_ONLY )\n+\t\t\terrx(1,"input file (%s) is FASTA, but only FASTQ input is allowed.", \n+\t\t\t\tpFASTX->input_file_name);\n+\t\tpFASTX->read_fastq = 0 ;\n+\t\tbreak;\n+\n+\tcase \'@\':\t/* FASTQ file */\n+\t\tif ( pFASTX->allow_input_filetype==FASTA_ONLY )\n+\t\t\terrx(1,"input file (%s) is FASTQ, but only FASTA input is allowed.", \n+\t\t\t\tpFASTX->input_file_name);\n+\t\tpFASTX->read_fastq = 1;\t\n+\t\tbreak;\n+\t\n+\tcase -1: /* EOF as first character - no input */\n+\t\terrx(1, "Premature End-Of-File (filename =\'%s\')", pFASTX->input_file_name);\n+\t\tbreak; \n+\n+\tdefault:\n+\t\terrx(1, "input file (%s) has unknown file format (not FASTA or FASTQ), first character = %c (%d)", \n+\t\t\tpFASTX->input_file_name, c,c);\n+\t}\n+}\n+\n+static void convert_ascii_quality_score_line(const char* ascii_quality_scores, FASTX *pFASTX)\n+{\n+\tsize_t i;\n+\n+\tif (strlen(ascii_quality_scores) != strlen(pFASTX->nucleotides))\n+\t\terrx(1,"number of quality values (%zu) doesn\'t match number of nucleotides (%zu) on line %lld",\n+\t\t\t\tstrlen(ascii_quality_scores), strlen(pFASTX->nucleotides),\n+\t\t\t\tpFASTX->input_line_number);\n+\n+\tfor (i=0; i<strlen(ascii_quality_scores); i++) {\n+\t\tpFASTX->quality[i] = (int) (ascii_quality_scores[i] - 64) ;\n+\t\tif (pFASTX->quality[i] < -15 || pFASTX->quality[i] > 40) \n+\t\t\terrx(1, "Invalid quality score value (char \'%c\' ord %d quality value %d) on line %lld",\n+\t\t\t\tascii_quality_scores[i], ascii_quality_scores[i],\n+\t\t\t\tpFASTX'..b'(pFASTX->nucleotides, MAX_SEQ_LINE_LENGTH, pFASTX->input) == NULL) \n+\t\terrx(1,"Failed to read complete record, missing 2nd line (nucleotides), on line %lld\\n",\n+\t\t\tpFASTX->input_line_number);\n+\n+\tchomp(pFASTX->name);\n+\tchomp(pFASTX->nucleotides);\n+\n+\tvalidate_nucleotides_string(pFASTX);\n+\t\n+\tif (pFASTX->read_fastq) {\n+\t\tpFASTX->input_line_number++;\n+\t\tif (fgets(pFASTX->input_name2_prefix, MAX_SEQ_LINE_LENGTH, pFASTX->input) == NULL) \n+\t\t\terrx(1,"Failed to read complete record, missing 3rd line (name-2), on line %lld\\n",\n+\t\t\t\tpFASTX->input_line_number);\n+\t\t\n+\t\tpFASTX->input_line_number++;\n+\t\tif (fgets(temp_qual, sizeof(temp_qual), pFASTX->input) == NULL)\n+\t\t\terrx(1,"Failed to read complete record, missing 4th line (quality), on line %lld\\n",\n+\t\t\t\tpFASTX->input_line_number);\n+\n+\t\tchomp(pFASTX->name2);\n+\t\tchomp(temp_qual);\n+\t\t\n+\t\tif (strlen(temp_qual) == strlen(pFASTX->nucleotides)) {\n+\t\t\t//Assume this is an ASCII quality score line, convert it to values\n+\t\t\tconvert_ascii_quality_score_line ( temp_qual, pFASTX ) ;\n+\t\t\tpFASTX->read_fastq_ascii = 1 ;\n+\t\t} else {\n+\t\t\t//Assume this is a numeric quality score line, convert it to values\n+\t\t\tconvert_numeric_quality_score_line ( temp_qual, pFASTX ) ;\n+\t\t\tpFASTX->read_fastq_ascii = 0 ;\n+\t\t}\n+\n+\t\t//Copy the input format to the output format flag\n+\t\tif (pFASTX->copy_input_fastq_format_to_output) {\n+\t\t\tpFASTX->write_fastq_ascii = pFASTX->read_fastq_ascii;\n+\t\t}\n+\t\t\t\n+\n+\t}\n+\n+\tpFASTX->num_input_sequences++;\n+\tpFASTX->num_input_reads += get_reads_count(pFASTX);\n+\n+\treturn 1;\n+}\n+\n+static void write_ascii_qual_string(FASTX *pFASTX, int length)\n+{\n+\tint i;\n+\tint rc;\n+\n+\tfor (i=0; i<length; i++) {\n+\t\trc = fprintf(pFASTX->output, "%c", pFASTX->quality[i] + 64 ) ;\n+\t\tif (rc<=0)\n+\t\t\terr(1,"writing quality scores failed");\n+\t}\n+\trc = fprintf(pFASTX->output, "\\n");\n+\tif (rc<=0)\n+\t\terr(1,"writing quality scores failed");\n+}\n+\n+static void write_numeric_qual_string(FASTX *pFASTX, int length)\n+{\n+\tint i;\n+\tint rc;\n+\tfor (i=0; i<length; i++) {\n+\t\trc = fprintf(pFASTX->output, "%d", pFASTX->quality[i] ) ;\n+\t\tif (rc<=0)\n+\t\t\terr(1,"writing quality scores failed");\n+\t\tif (i<length-1) {\n+\t\t\trc = fprintf(pFASTX->output," ");\n+\t\t\tif (rc<=0)\n+\t\t\t\terr(1,"writing quality scores failed");\n+\t\t}\n+\t}\n+\trc = fprintf(pFASTX->output, "\\n");\n+\tif (rc<=0)\n+\t\terr(1,"writing quality scores failed");\n+}\n+\n+void fastx_write_record(FASTX *pFASTX)\n+{\n+\tint len;\n+\tint rc;\n+\n+\tif (pFASTX==NULL)\n+\t\terrx(1,"Internal error: pFASTX==NULL (%s:%d)", __FILE__,__LINE__);\n+\n+\t\n+\trc = fprintf(pFASTX->output, "%c%s\\n", \n+\t\t\tpFASTX->output_sequence_id_prefix,\n+\t\t\tpFASTX->name ) ;\n+\tif (rc<=0)\n+\t\terr(1,"writing sequence identifier failed");\n+\t\n+\trc = fprintf(pFASTX->output, "%s\\n", pFASTX->nucleotides);\n+\tif (rc<=0)\n+\t\terr(1,"writing nucleotides failed");\n+\n+\tif (pFASTX->write_fastq) {\n+\t\trc = fprintf(pFASTX->output, "+%s\\n", pFASTX->name2 ) ;\n+\t\tif (rc<=0)\n+\t\t\terr(1,"writing 2nd sequence identifier failed");\n+\n+\t\tlen = strlen(pFASTX->nucleotides);\t\n+\t\tif (pFASTX->write_fastq_ascii)\n+\t\t\twrite_ascii_qual_string(pFASTX, len);\n+\t\telse\n+\t\t\twrite_numeric_qual_string(pFASTX, len);\n+\t}\n+\n+\tpFASTX->num_output_sequences++;\n+\tpFASTX->num_output_reads += get_reads_count(pFASTX);\n+}\n+\n+int get_reads_count(const FASTX *pFASTX)\n+{\n+\tchar *dash = NULL ;\n+\n+\t//FASTQ files are never collapsed (at least not in Gordon\'s Galaxy)\n+\tif (pFASTX->read_fastq)\n+\t\treturn 1;\n+\n+\tdash = strchr(pFASTX->name,\'-\');\n+\n+\t// minus character wasn\'t found-\n+\t// this sequence is most probably not collapsed\n+\tif (dash==NULL)\n+\t\treturn 1;\n+\n+\tint count = atoi(dash+1);\n+\tif (count>0)\n+\t\treturn count;\n+\t\n+\treturn 1;\n+}\n+\n+size_t num_input_sequences(const FASTX *pFASTX)\n+{\n+\treturn pFASTX->num_input_sequences;\n+}\n+\n+size_t num_input_reads(const FASTX *pFASTX)\n+{\n+\treturn pFASTX->num_input_reads;\n+}\n+\n+size_t num_output_sequences(const FASTX *pFASTX)\n+{\n+\treturn pFASTX->num_output_sequences;\n+}\n+\n+size_t num_output_reads(const FASTX *pFASTX)\n+{\n+\treturn pFASTX->num_output_reads;\n+}\n+\n+\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/libfastx/fastx.h
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/libfastx/fastx.h Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,136 @@
+/*
+    FASTX-toolkit - FASTA/FASTQ preprocessing tools.
+    Copyright (C) 2009  A. Gordon (gordon@cshl.edu)
+
+    This program is free software: you can redistribute it and/or modify
+    it under the terms of the GNU Affero General Public License as
+    published by the Free Software Foundation, either version 3 of the
+    License, or (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU Affero General Public License for more details.
+
+    You should have received a copy of the GNU Affero General Public License
+    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+*/
+#ifndef __FASTX_HEADER__
+#define __FASTX_HEADER__
+
+#ifdef __cplusplus
+extern "C" {
+#endif
+
+#ifndef PATH_MAX
+#include <linux/limits.h>
+#endif
+
+#define MIN_QUALITY_VALUE (-50)
+#define MAX_QUALITY_VALUE 50
+#define QUALITY_VALUES_RANGE (MAX_QUALITY_VALUE-MIN_QUALITY_VALUE)
+
+
+#ifndef MAX_SEQ_LINE_LENGTH
+#define MAX_SEQ_LINE_LENGTH (25000)
+#endif
+
+typedef enum {
+ FASTA_ONLY=0,
+ FASTA_OR_FASTQ=1,
+ FASTQ_ONLY=2
+} ALLOWED_INPUT_FILE_TYPES;
+
+typedef enum {
+ DISALLOW_N=0,
+ ALLOW_N=1
+} ALLOWED_INPUT_UNKNOWN_BASES;
+
+typedef enum {
+ REQUIRE_UPPERCASE=0,
+ ALLOW_LOWERCASE=1
+} ALLOWED_INPUT_CASE;
+
+typedef enum {
+ OUTPUT_FASTA=0,
+ OUTPUT_FASTQ_ASCII_QUAL=1,
+ OUTPUT_FASTQ_NUMERIC_QUAL=2,
+ OUTPUT_SAME_AS_INPUT=3
+} OUTPUT_FILE_TYPE;
+
+#pragma pack(1)
+typedef struct
+{
+ /* Record data - common for FASTA/FASTQ */
+ char    input_sequence_id_prefix[1];   //DON'T touch this - this hack will read the entire name into the variable 'name',
+   //leaving the prefix ('>' or '@') in 'input_sequence_id_name'.
+ char    name[MAX_SEQ_LINE_LENGTH+1];
+ char    nucleotides[MAX_SEQ_LINE_LENGTH+1];
+ /* Record data - only for FASTQ */
+ char    input_name2_prefix[1];         //same hack as 'input_sequence_id_prefix'
+ char name2[MAX_SEQ_LINE_LENGTH+1];
+ int quality[MAX_SEQ_LINE_LENGTH+1];  //note: this is NOT ascii values, but numerical values
+        //      numeric quality scores and ASCII quality scores
+        //      are automatically converted to numbers (-15 to 40)
+
+ /* Configuration */
+ int allow_input_filetype; // 0 = Allow only FASTA
+ int allow_N; // 1 = N is valid nucleotide, 0 = only A/G/C/T are valid
+ int allow_lowercase;
+ int read_fastq; // 1 = Input is FASTQ (only if allow_input_fastq==1)
+ int read_fastq_ascii; // 1 = Input is FASTQ with ASCII quality scores (0 = with numeric quality scores)
+ int write_fastq; // 0 = Write only FASTA (regardless of input type)
+ int write_fastq_ascii; // 1 = Write ASCII quality scores, 0 = write numeric quality scores
+ int compress_output; // 1 = pass output through GZIP
+
+ int     copy_input_fastq_format_to_output ; // 1 = copy 'read_fastq_ascii' to 'write_fastq_ascii'
+     // so that the output format is the same as the input
+
+
+ /* Internal data */
+ int allowed_nucleotides[256]; //quick lookup table for valid input
+ char output_sequence_id_prefix; // '>' or '@', depending on the requested output type
+
+ char input_file_name[PATH_MAX]; //in linux, PATH_MAX is defined in <linux/limits.h>
+ unsigned long long input_line_number;
+ char output_file_name[PATH_MAX]; //in linux, PATH_MAX is defined in <linux/limits.h>
+
+ size_t num_input_sequences;
+ size_t  num_output_sequences;
+ size_t  num_input_reads;
+ size_t  num_output_reads;
+
+ FILE* input;
+ FILE* output;
+} FASTX ;
+
+
+void fastx_init_reader(FASTX *pFASTX, const char* filename,
+ ALLOWED_INPUT_FILE_TYPES allowed_input_filetype,
+ ALLOWED_INPUT_UNKNOWN_BASES allow_N,
+ ALLOWED_INPUT_CASE allow_lowercase);
+
+// If the sequence identifier is collapsed (= "N-N") returns the reads_count,
+// otherwise, returns 1
+int get_reads_count(const FASTX *pFASTX);
+
+void fastx_init_writer(FASTX *pFASTX,
+ const char* filename,
+ OUTPUT_FILE_TYPE output_type,
+ int compress_output);
+
+int fastx_read_next_record(FASTX *pFASTX);
+
+void fastx_write_record(FASTX *pFASTX);
+
+size_t num_input_sequences(const FASTX *pFASTX);
+size_t num_input_reads(const FASTX *pFASTX);
+size_t num_output_sequences(const FASTX *pFASTX);
+size_t num_output_reads(const FASTX *pFASTX);
+
+#ifdef __cplusplus
+}
+#endif
+
+#endif
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/libfastx/fastx_args.c
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/libfastx/fastx_args.c Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,132 @@
+/*
+    FASTX-toolkit - FASTA/FASTQ preprocessing tools.
+    Copyright (C) 2009  A. Gordon (gordon@cshl.edu)
+
+    This program is free software: you can redistribute it and/or modify
+    it under the terms of the GNU Affero General Public License as
+    published by the Free Software Foundation, either version 3 of the
+    License, or (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU Affero General Public License for more details.
+
+    You should have received a copy of the GNU Affero General Public License
+    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+*/
+#include <err.h>
+#include <stdio.h>
+#include <stdlib.h>
+#include <unistd.h>
+#include <sys/types.h>
+#include <string.h>
+#include <getopt.h>
+
+#include "fastx_args.h"
+
+/*
+ * Each program should specify its own usage string
+ */
+extern char* usage;
+
+
+/*
+ * globals.. yuck
+ *
+ * some day this will be a stand alone class
+ */
+const char* input_filename = "-";
+const char* output_filename = "-";
+int verbose = 0;
+int compress_output = 0 ;
+FILE* report_file;
+
+const char* get_input_filename()
+{
+ return input_filename;
+}
+
+const char* get_output_filename()
+{
+ return output_filename;
+}
+
+int verbose_flag()
+{
+ return verbose;
+}
+
+int compress_output_flag()
+{
+ return compress_output ;
+}
+
+FILE* get_report_file()
+{
+ return report_file;
+}
+
+int fastx_parse_cmdline( int argc, char* argv[],
+ const char* program_options,
+ parse_argument_func program_parse_args )
+{
+ int opt;
+
+ char combined_options_string[100];
+
+ strcpy(combined_options_string, "zhvi:o:");
+ strcat(combined_options_string, program_options);
+
+ report_file = stderr ; //since the default output is STDOUT, the report goes by default to STDERR
+
+ while ( (opt = getopt(argc, argv, combined_options_string) ) != -1 ) {
+
+ // Parse the program's custom options
+ if ( strchr(program_options, opt) != NULL ) {
+ if (!program_parse_args(optind, opt, optarg))
+ return 0;
+ continue;
+ }
+
+ //Parse the default options
+ switch(opt) {
+ case 'h':
+ printf("%s", usage);
+ exit(1);
+
+ case 'v':
+ verbose = 1 ;
+ break ;
+
+ case 'z':
+ compress_output = 1 ;
+ break ;
+
+
+ case 'i':
+ if (optarg==NULL)
+ errx(1,"[-i] option requires FILENAME argument");
+ input_filename = optarg;
+ break;
+
+ case 'o':
+ if (optarg==NULL)
+ errx(1,"[-o] option requires FILENAME argument");
+ output_filename = optarg;
+
+ //The user specified a specific output file, so the report can go to STDOUT
+ report_file = stdout;
+ break;
+
+ default:
+ printf("use '-h' for usage information.\n");
+ exit(1);
+ break;
+
+ }
+ }
+
+ return 1;
+}
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/libfastx/fastx_args.h
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/libfastx/fastx_args.h Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,45 @@
+/*
+    FASTX-toolkit - FASTA/FASTQ preprocessing tools.
+    Copyright (C) 2009  A. Gordon (gordon@cshl.edu)
+
+    This program is free software: you can redistribute it and/or modify
+    it under the terms of the GNU Affero General Public License as
+    published by the Free Software Foundation, either version 3 of the
+    License, or (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU Affero General Public License for more details.
+
+    You should have received a copy of the GNU Affero General Public License
+    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+*/
+#ifndef __FASTX_ARGS__
+#define __FASTX_ARGS__
+
+#ifdef __cplusplus
+extern "C" {
+#endif
+
+//One day this would all be OO :-)
+
+const char* get_input_filename();
+const char* get_output_filename();
+int verbose_flag();
+int compress_output_flag();
+FILE* get_report_file();
+
+typedef int (*parse_argument_func)(int optind, int optc, char* optarg)  ;
+
+int fastx_parse_cmdline( int argc, char* argv[],
+ const char* program_options,
+ parse_argument_func program_parse_arg ) ;
+
+
+#ifdef __cplusplus
+}
+#endif
+
+#endif
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/libfastx/sequence_alignment.cpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/libfastx/sequence_alignment.cpp Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,710 @@\n+#include <string>\n+#include <vector>\n+#include <ostream>\n+#include <iostream>\n+#include <algorithm>\n+#include <iomanip>\n+#include <err.h>\n+\n+#include "sequence_alignment.h"\n+\n+using namespace std;\n+\n+void SequenceAlignmentResults::print(std::ostream& strm) const\n+{\n+\tsize_t delta;\n+\tsize_t index;\n+\n+\tstrm << "Query-Alingment = " << query_alignment << endl ;\n+\tstrm << "target-Alingment= " << target_alignment << endl ;\n+\n+\n+ \tstrm << (alignment_found ? "Alignment Found" : "Alignment NOT found") << endl;\n+\tstrm << "Score = " << score << " ("\n+\t << matches << " matches, "\n+\t << neutral_matches << " neutral-matches, "\n+\t << mismatches << " mismatches, "\n+\t << gaps << " gaps) "\n+\t << std::endl ;\n+\t\n+\tstrm << "Query = " << query_sequence\n+\t << "(qsize " << query_size\n+\t << " qstart " << query_start\n+\t << " qend " << query_end \n+\t << std::endl ;\n+\n+\tstrm << "Target= " << target_sequence\n+\t << "(tsize " << target_size\n+\t << " tstart " << target_start\n+\t << " tend " << target_end \n+\t << std::endl ;\n+\n+ strm << endl;\n+\n+\tdelta = max(target_start, query_start);\n+\n+\n+\t//Spaces before the query string\n+\tif ( delta - query_start > 0 )\n+\t\tstrm << std::string( delta - query_start-1, \' \') ;\n+\t//Un-Aligned query part (prefix)\n+\tif ( query_start > 0 )\n+\t\tstrm << query_sequence.substr(0, query_start-1) ;\n+\t//Aligned query part\n+\tstrm << "(" << query_alignment << ")";\n+\t//Un-Aligned query part (suffix)\n+\tif ( query_end < query_sequence.length() )\n+\t\tstrm << query_sequence.substr( query_end+1 ) ;\n+\tstrm << std::endl ;\n+\n+\t//Alignment bars\n+\tif ( delta > 0 )\n+\t\tstrm << std::string( delta-1, \' \') ;\n+\tstrm << "(" ;\n+\tfor (index=0; index<query_alignment.length(); index++) {\n+\t\tstrm << ((query_alignment[index]==target_alignment[index]) ? \'*\' : \'|\' );\n+\t}\n+\tstrm << ")" ;\n+\tstrm << std::endl;\n+\n+\t//Spaces before the target string\n+\tif ( delta - target_start > 0 )\n+\t\tstrm << std::string( delta - target_start, \' \') ;\n+\t//Un-Aligned target part (prefix)\n+\tif ( target_start > 0 )\n+\t\tstrm << target_sequence.substr(0, target_start-1);\n+\t//Aligned target part\n+\tstrm << "(" << target_alignment << ")";\n+\n+\t//Un-Aligned target part (suffix)\n+\tif ( target_end < target_sequence.length() )\n+\t\tstrm << target_sequence.substr( target_end+1 );\n+\tstrm << std::endl;\n+\n+}\n+\n+SequenceAlignment::SequenceAlignment ( ) :\n+\t_gap_panelty(-5),\n+\t_match_panelty(1),\n+\t_mismatch_panelty(-1),\n+\t_neutral_panelty(0.1)\n+\n+{\n+}\n+\n+\n+void SequenceAlignment::set_sequences(const std::string& _query, const std::string& _target)\n+{\n+\t_query_sequence = _query ;\n+\t_target_sequence = _target ;\n+}\n+\n+void SequenceAlignment::reset_alignment_results()\n+{\n+\t_alignment_results = SequenceAlignmentResults() ;\n+\t//\n+\t//Reset the results\n+\t_alignment_results.query_sequence = query_sequence() ;\n+\t_alignment_results.target_sequence = target_sequence() ;\n+}\n+\n+const SequenceAlignmentResults& SequenceAlignment::align ( const std::string& query, const std::string& target )\n+{\n+\tset_sequences ( query, target ) ;\n+\n+\treset_alignment_results();\n+\n+\tresize_matrix ( query_sequence().length(), target_sequence().length() ) ;\n+\tpopulate_match_matrix();\n+\n+\treset_matrix( matrix_width(), matrix_height() );\n+\tpopulate_matrix();\n+\tfind_optimal_alignment();\n+\n+\tpost_process();\n+\n+\treturn _alignment_results;\n+}\n+\n+void SequenceAlignment::resize_matrix(size_t width, size_t height)\n+{\n+\tsize_t i;\n+\n+\tif ( matrix_width() >= width && matrix_height() >= height )\n+\t\treturn ;\n+\n+\tquery_border.resize ( width ) ;\n+\ttarget_border.resize ( height ) ;\n+\n+\tscore_matrix.resize ( width );\n+\tfor (i=0;i<width;i++)\n+\t\tscore_matrix[i].resize(height) ;\n+\n+\torigin_matrix.resize ( width );\n+\tfor (i=0;i<width;i++)\n+\t\torigin_matrix[i].resize(height) ;\n+\n+\tmatch_matrix.resize ( width );\n+\tfor (i=0;i<width;i++) {\n+\t\tmatch_matrix[i].resize(height) ;\n+\t}\n+}\n+\n+void SequenceAlignment::populate_match_matrix()\n+{\n+\tfor (size_t x=0; x<matrix_width(); x++)\n+\t\tfor(size_t y=0;y<ma'..b' query_sequence().c_str());\n+\t\t\tprintf("Target= %s\\n", target_sequence().c_str());\n+\t\t\texit(1);\n+\t\t}\n+\t}\n+\n+\tresults.query_size = query_sequence().length();\n+\tresults.target_size= target_sequence().length();\n+\n+\tstd::reverse(results.target_alignment.begin(),results.target_alignment.end());\n+\tstd::reverse(results.query_alignment.begin(), results.query_alignment.end());\n+\n+\treturn results;\n+}\n+\n+void HalfLocalSequenceAlignment::find_optimal_alignment ( ) \n+{\n+\tSequenceAlignmentResults results ;\n+\t\n+\n+\t//Try to find a good alignment, \n+\t//starting from the highest score cell.\n+\tresults = find_optimal_alignment_from_point ( highest_scored_query_index,\n+\t\t\t\t\t\t highest_scored_target_index ) ;\n+\n+\t//Some heuristics:\n+\t//If the adapter matched 7 nucleotides anywhere in the query\n+\t//without mismatches/gaps, accept it.\n+\tif ( results.matches >= 7 \n+\t && \n+\t results.mismatches == 0\n+\t &&\n+\t results.gaps == 0 ) {\n+\t \t\n+\t\t_alignment_results = results ;\n+\t\treturn ;\n+\t}\n+\n+\tif ( starting_point_close_to_end_of_sequences ( highest_scored_query_index,\n+\t\t\t\t\t\t highest_scored_target_index ) ) {\n+\t\t//We\'re already very close to the end of the target or query,\n+\t\t//can\'t improve much else, so return what we\'ve got.\n+\t\t_alignment_results = results ;\n+\t\treturn ;\n+\t}\n+\n+\n+\t//More heuristics:\n+\t/* The adapter is not covering the query until the end.\n+\t * Force the alignment to start from the end of the query,\n+\t * find the best score at the end of the query\n+\t *\n+\t * Try (desperately) to find a match that starts at the end of the query or the end of the target/adapter)\n+\t */\n+\tssize_t query_index = highest_scored_query_index ;\n+\tssize_t target_index = highest_scored_target_index;\n+\tfind_alignment_starting_point ( query_index, target_index ) ;\n+\n+\t_alignment_results = results ;\n+}\n+\n+void HalfLocalSequenceAlignment::post_process()\n+{\n+#if 0\n+\t//Removes the Ns which were added in \'set_sequences\'\n+\t//And adjust the results values accordingly\n+\n+\t//return ;\n+\t//_query_sequence.erase ( _query_sequence.find_last_not_of(\'N\') + 1) ;\n+\t//_target_sequence.erase ( 0, _target_sequence.find_first_not_of(\'N\') ) ;\n+\n+\t_alignment_results.query_sequence.erase ( _query_sequence.find_last_not_of(\'N\') + 1) ;\n+\t_alignment_results.target_sequence.erase ( 0, _target_sequence.find_first_not_of(\'N\') ) ;\n+\t_alignment_results.query_size = _alignment_results.query_sequence.length();\n+\t_alignment_results.target_size = _alignment_results.target_sequence.length();\n+\n+\n+\tsize_t query_n_position = _alignment_results.query_alignment.find_last_not_of(\'N\') ;\n+\tint query_n_count;\n+\n+\tif ( query_n_position != string::npos )\n+\t\tquery_n_count = _alignment_results.query_alignment.length() - query_n_position ;\n+\telse\n+\t\tquery_n_count = 0 ;\n+\n+\tint target_n_count = _alignment_results.target_alignment.find_first_not_of(\'N\') ;\n+\n+\tif (query_n_position != string::npos )\n+\t\t_alignment_results.query_alignment.erase( query_n_position ) ;\n+\t_alignment_results.target_alignment.erase( 0,target_n_count ) ;\n+\n+\t//Update Results strucure\n+\t_alignment_results.query_start+= target_n_count ;\n+\t_alignment_results.query_end -= query_n_count ;\n+\n+\t_alignment_results.target_start = 0;\n+\t_alignment_results.target_end = _alignment_results.query_end - _alignment_results.query_start ;\n+\n+\t_alignment_results.query_alignment.erase ( 0, _alignment_results.query_start ) ;\n+\t_alignment_results.target_alignment.erase ( _alignment_results.target_end+1 ) ;\n+\n+\t//Update match/mismatch/gap counts\n+\t_alignment_results.matches = 0 ;\n+\t_alignment_results.mismatches = 0 ;\n+\t_alignment_results.gaps = 0 ;\n+\n+\tfor (size_t index=0; index<_alignment_results.query_alignment.length(); index++) {\n+\t\tchar q = _alignment_results.query_alignment[index];\n+\t\tchar t = _alignment_results.target_alignment[index];\n+\n+\t\tif ( q == \'-\' || t==\'-\' ) {\n+\t\t\t_alignment_results.gaps ++ ;\n+\t\t} else {\n+\t\t\tif ( q== t )\n+\t\t\t\t_alignment_results.matches++;\n+\t\t\telse\n+\t\t\t\t_alignment_results.mismatches++;\n+\t\t}\n+\t}\n+#endif \n+}\n+\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/libfastx/sequence_alignment.h
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/libfastx/sequence_alignment.h Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,250 @@
+/*
+    FASTX-toolkit - FASTA/FASTQ preprocessing tools.
+    Copyright (C) 2009  A. Gordon (gordon@cshl.edu)
+
+    This program is free software: you can redistribute it and/or modify
+    it under the terms of the GNU Affero General Public License as
+    published by the Free Software Foundation, either version 3 of the
+    License, or (at your option) any later version.
+
+    This program is distributed in the hope that it will be useful,
+    but WITHOUT ANY WARRANTY; without even the implied warranty of
+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+    GNU Affero General Public License for more details.
+
+    You should have received a copy of the GNU Affero General Public License
+    along with this program.  If not, see <http://www.gnu.org/licenses/>.
+*/
+#ifndef __SEQUENCE_ALIGNMENT_HEADER__
+#define __SEQUENCE_ALIGNMENT_HEADER__
+
+#include <err.h>
+
+struct SequenceAlignmentResults
+{
+ int alignment_found ;
+
+ size_t query_size ;
+ size_t query_start ;
+ size_t query_end ;
+
+ size_t target_size ;
+ size_t target_start ;
+ size_t target_end ;
+
+ size_t gaps;
+ size_t neutral_matches ;
+ size_t matches ;
+ size_t mismatches ;
+
+ float score ;
+
+ std::string query_alignment ;
+ std::string target_alignment ;
+
+ std::string query_sequence ;
+ std::string target_sequence ;
+
+ SequenceAlignmentResults() :
+ alignment_found(false),
+ query_size(0),
+ query_start(0),
+ query_end(0),
+
+ target_size(0),
+ target_start(0),
+ target_end(0),
+
+ gaps(0),
+ neutral_matches(0),
+ matches(0),
+ mismatches(0),
+
+ score(0)
+ {
+ }
+
+ void print( std::ostream& ostrm = std::cout ) const;
+
+ virtual ~SequenceAlignmentResults() {}
+} ;
+
+
+class SequenceAlignment
+{
+protected:
+ typedef float score_type;
+
+ typedef enum {
+ FROM_UPPER = 1,
+ FROM_LEFT  = 2,
+ FROM_UPPER_LEFT = 3,
+ FROM_NOWHERE = 4
+ //STOP_MARKER = 5
+ } DIRECTION ;
+
+ std::vector < score_type > query_border ;
+ std::vector < score_type > target_border ;
+
+ std::vector< std::vector< score_type >  > score_matrix ;
+ std::vector< std::vector< DIRECTION >  > origin_matrix ;
+ std::vector< std::vector< char > > match_matrix ;
+
+ score_type _gap_panelty ;
+ score_type _match_panelty ;
+ score_type _mismatch_panelty ;
+ score_type _neutral_panelty ;
+
+
+ SequenceAlignmentResults _alignment_results ;
+
+ std::string _query_sequence;
+ std::string _target_sequence;
+
+public:
+ SequenceAlignment ( ) ;
+ virtual ~SequenceAlignment() {}
+
+ size_t matrix_width() const { return  score_matrix.size(); }
+ size_t matrix_height() const { return  score_matrix[0].size(); }
+
+ score_type gap_panelty() const { return _gap_panelty ; }
+ score_type match_panelty() const { return _match_panelty ; }
+ score_type mismatch_panelty() const { return _mismatch_panelty ; }
+ score_type neutral_panelty() const { return _neutral_panelty ; }
+
+ const std::string& query_sequence() const { return _query_sequence; }
+ const std::string& target_sequence() const { return _target_sequence; }
+
+ char query_nucleotide(size_t query_index) const { return _query_sequence[query_index] ; }
+ char target_nucleotide(size_t target_index) const { return _target_sequence[target_index] ; }
+
+ const SequenceAlignmentResults& results() const { return _alignment_results; }
+
+ char match_value ( const char q, const char t ) const
+ {
+ if ( q=='N' || t=='N' )
+ return 'N' ;
+
+ return ( q==t ) ? 'M' : 'x' ;
+ }
+
+ char match ( const size_t query_index, const size_t target_index) const
+ {
+ return match_matrix[query_index][target_index];
+ }
+ DIRECTION origin (  const size_t query_index, const size_t target_index) const
+ {
+ return origin_matrix[query_index][target_index];
+ }
+
+ score_type score ( const size_t query_index, const size_t target_index) const
+ {
+ return score_matrix[query_index][target_index];
+ }
+
+ score_type safe_score ( const ssize_t query_index, const ssize_t target_index) const
+ {
+ if (query_index==-1)
+ return target_border[target_index];
+ if (target_index==-1)
+ return query_border[query_index];
+
+ return score_matrix[query_index][target_index];
+ }
+
+ score_type nucleotide_match_score(const size_t query_index, const size_t target_index) const
+ {
+ char q = query_nucleotide(query_index);
+ char t = target_nucleotide(target_index);
+
+ if ( q=='N' && t=='N' )
+ return 0.0 ;
+
+ if ( q=='N' || t=='N' )
+ return neutral_panelty() ;
+
+ return ( q==t ) ? match_panelty() : mismatch_panelty() ;
+ }
+
+ void print_matrix(std::ostream& strm = std::cout) const;
+
+ #if 0
+ score_type calculate_alignment_score(const size_t query_index, const size_t target_index) const
+ {
+ score_type score = -100000000;
+
+ /*
+ score_type
+
+ //Score from the left-cell
+ if ( query_index > 0 )
+ if ( (score(query_index-1,target_index) + gap_panelty()) > score)
+ score = score_matrix[query_index-1][target_index] + gap_panelty();
+
+ //Score from the upper-cell
+ if ( target_index  > 0 )
+ if ((score_matrix[query_index][target_index-1] + gap_panelty()) > score)
+ score = score_matrix[query_index][target_index-1] + gap_panelty();
+
+ //Score from the upper-left-cell
+ if ( target_index>0 && query_index> 0) {
+ if (score_matrix[query_index-1][target_index-1] + match_score(query_index,target_index) > score)
+ score = score_matrix[query_index-1][target_index-1] + match_score(query_index,target_index) ;
+ }*/
+ return score;
+
+ }
+ #endif
+
+ const SequenceAlignmentResults& align ( const std::string& query, const std::string& target ) ;
+
+protected:
+ void resize_matrix(size_t width, size_t height);
+ void populate_match_matrix();
+
+ virtual void reset_alignment_results() ;
+
+ virtual void set_sequences ( const std::string& _query, const std::string &target ) ;
+ virtual void reset_matrix( size_t width, size_t height ) = 0 ;
+ virtual void populate_matrix ( ) = 0;
+ virtual void find_optimal_alignment ( ) = 0 ;
+ virtual void post_process() ;
+} ;
+
+#if 0
+class LocalSequenceAlignment : public SequenceAlignment
+{
+protected:
+ size_t highest_scored_query_index ;
+ size_t highest_scored_target_index ;
+
+public:
+ virtual void reset_matrix( size_t width, size_t height )  ;
+ virtual void populate_matrix ( ) ;
+ virtual void find_optimal_alignment ( )  ;
+};
+#endif
+
+
+class HalfLocalSequenceAlignment : public SequenceAlignment
+{
+protected:
+ size_t highest_scored_query_index ;
+ size_t highest_scored_target_index ;
+
+public:
+ virtual void set_sequences ( const std::string& _query, const std::string &target ) ;
+ virtual void reset_matrix( size_t width, size_t height )  ;
+ virtual void populate_matrix ( ) ;
+ virtual void find_optimal_alignment ( )  ;
+ virtual void post_process() ;
+
+ bool starting_point_close_to_end_of_sequences(const size_t query_index, const size_t target_index) const;
+ void find_alignment_starting_point(ssize_t &new_query_index, ssize_t &new_target_index) const;
+
+ SequenceAlignmentResults find_optimal_alignment_from_point ( const size_t query_start, const size_t target_start ) const ;
+};
+
+#endif
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/seqalign_test/Makefile.am
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/seqalign_test/Makefile.am Thu Aug 14 04:52:17 2014 -0400

@@ -0,0 +1,21 @@
+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>
+#
+# This file is free software; as a special exception the author gives
+# unlimited permission to copy and/or distribute it, with or without
+# modifications, as long as this notice is preserved.
+#
+# This program is distributed in the hope that it will be useful, but
+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the
+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
+
+
+noinst_PROGRAMS = seqalign_test
+
+AM_CPPFLAGS = \
+ $(CC_WARNINGS) \
+ -I../libfastx
+
+seqalign_test_SOURCES = seqalign_test.cpp
+
+seqalign_test_LDADD = ../libfastx/libfastx.a
+

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/seqalign_test/Makefile.in
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/seqalign_test/Makefile.in Thu Aug 14 04:52:17 2014 -0400

[

b'@@ -0,0 +1,414 @@\n+# Makefile.in generated by automake 1.10.1 from Makefile.am.\n+# @configure_input@\n+\n+# Copyright (C) 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002,\n+# 2003, 2004, 2005, 2006, 2007, 2008 Free Software Foundation, Inc.\n+# This Makefile.in is free software; the Free Software Foundation\n+# gives unlimited permission to copy and/or distribute it,\n+# with or without modifications, as long as this notice is preserved.\n+\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY, to the extent permitted by law; without\n+# even the implied warranty of MERCHANTABILITY or FITNESS FOR A\n+# PARTICULAR PURPOSE.\n+\n+@SET_MAKE@\n+\n+# Copyright (C) 2008 Assaf Gordon <gordon@cshl.edu>\n+# \n+# This file is free software; as a special exception the author gives\n+# unlimited permission to copy and/or distribute it, with or without \n+# modifications, as long as this notice is preserved.\n+# \n+# This program is distributed in the hope that it will be useful, but\n+# WITHOUT ANY WARRANTY, to the extent permitted by law; without even the\n+# implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.\n+\n+VPATH = @srcdir@\n+pkgdatadir = $(datadir)/@PACKAGE@\n+pkglibdir = $(libdir)/@PACKAGE@\n+pkgincludedir = $(includedir)/@PACKAGE@\n+am__cd = CDPATH="$${ZSH_VERSION+.}$(PATH_SEPARATOR)" && cd\n+install_sh_DATA = $(install_sh) -c -m 644\n+install_sh_PROGRAM = $(install_sh) -c\n+install_sh_SCRIPT = $(install_sh) -c\n+INSTALL_HEADER = $(INSTALL_DATA)\n+transform = $(program_transform_name)\n+NORMAL_INSTALL = :\n+PRE_INSTALL = :\n+POST_INSTALL = :\n+NORMAL_UNINSTALL = :\n+PRE_UNINSTALL = :\n+POST_UNINSTALL = :\n+build_triplet = @build@\n+host_triplet = @host@\n+noinst_PROGRAMS = seqalign_test$(EXEEXT)\n+subdir = src/seqalign_test\n+DIST_COMMON = $(srcdir)/Makefile.am $(srcdir)/Makefile.in\n+ACLOCAL_M4 = $(top_srcdir)/aclocal.m4\n+am__aclocal_m4_deps = $(top_srcdir)/configure.ac\n+am__configure_deps = $(am__aclocal_m4_deps) $(CONFIGURE_DEPENDENCIES) \\\n+\t$(ACLOCAL_M4)\n+mkinstalldirs = $(install_sh) -d\n+CONFIG_HEADER = $(top_builddir)/config.h\n+CONFIG_CLEAN_FILES =\n+PROGRAMS = $(noinst_PROGRAMS)\n+am_seqalign_test_OBJECTS = seqalign_test.$(OBJEXT)\n+seqalign_test_OBJECTS = $(am_seqalign_test_OBJECTS)\n+seqalign_test_DEPENDENCIES = ../libfastx/libfastx.a\n+DEFAULT_INCLUDES = -I.@am__isrc@ -I$(top_builddir)\n+depcomp = $(SHELL) $(top_srcdir)/config/depcomp\n+am__depfiles_maybe = depfiles\n+CXXCOMPILE = $(CXX) $(DEFS) $(DEFAULT_INCLUDES) $(INCLUDES) \\\n+\t$(AM_CPPFLAGS) $(CPPFLAGS) $(AM_CXXFLAGS) $(CXXFLAGS)\n+CXXLD = $(CXX)\n+CXXLINK = $(CXXLD) $(AM_CXXFLAGS) $(CXXFLAGS) $(AM_LDFLAGS) $(LDFLAGS) \\\n+\t-o $@\n+SOURCES = $(seqalign_test_SOURCES)\n+DIST_SOURCES = $(seqalign_test_SOURCES)\n+ETAGS = etags\n+CTAGS = ctags\n+DISTFILES = $(DIST_COMMON) $(DIST_SOURCES) $(TEXINFOS) $(EXTRA_DIST)\n+ACLOCAL = @ACLOCAL@\n+AMTAR = @AMTAR@\n+AUTOCONF = @AUTOCONF@\n+AUTOHEADER = @AUTOHEADER@\n+AUTOMAKE = @AUTOMAKE@\n+AWK = @AWK@\n+CC = @CC@\n+CCDEPMODE = @CCDEPMODE@\n+CFLAGS = @CFLAGS@\n+CPP = @CPP@\n+CPPFLAGS = @CPPFLAGS@\n+CXX = @CXX@\n+CXXCPP = @CXXCPP@\n+CXXDEPMODE = @CXXDEPMODE@\n+CXXFLAGS = @CXXFLAGS@\n+CYGPATH_W = @CYGPATH_W@\n+DEFS = @DEFS@\n+DEPDIR = @DEPDIR@\n+ECHO_C = @ECHO_C@\n+ECHO_N = @ECHO_N@\n+ECHO_T = @ECHO_T@\n+EGREP = @EGREP@\n+EXEEXT = @EXEEXT@\n+GREP = @GREP@\n+INSTALL = @INSTALL@\n+INSTALL_DATA = @INSTALL_DATA@\n+INSTALL_PROGRAM = @INSTALL_PROGRAM@\n+INSTALL_SCRIPT = @INSTALL_SCRIPT@\n+INSTALL_STRIP_PROGRAM = @INSTALL_STRIP_PROGRAM@\n+LDFLAGS = @LDFLAGS@\n+LIBOBJS = @LIBOBJS@\n+LIBS = @LIBS@\n+LTLIBOBJS = @LTLIBOBJS@\n+MAKEINFO = @MAKEINFO@\n+MKDIR_P = @MKDIR_P@\n+OBJEXT = @OBJEXT@\n+PACKAGE = @PACKAGE@\n+PACKAGE_BUGREPORT = @PACKAGE_BUGREPORT@\n+PACKAGE_NAME = @PACKAGE_NAME@\n+PACKAGE_STRING = @PACKAGE_STRING@\n+PACKAGE_TARNAME = @PACKAGE_TARNAME@\n+PACKAGE_VERSION = @PACKAGE_VERSION@\n+PATH_SEPARATOR = @PATH_SEPARATOR@\n+RANLIB = @RANLIB@\n+SET_MAKE = @SET_MAKE@\n+SHELL = @SHELL@\n+STRIP = @STRIP@\n+VERSION = @VERSION@\n+abs_builddir = @abs_builddir@\n+abs_srcdir = @abs_src'..b'ho $(srcdir)/$$i; fi; \\\n+\t done | \\\n+\t $(AWK) \'{ files[$$0] = 1; nonempty = 1; } \\\n+\t END { if (nonempty) { for (i in files) print i; }; }\'`; \\\n+\ttest -z "$(CTAGS_ARGS)$$tags$$unique" \\\n+\t || $(CTAGS) $(CTAGSFLAGS) $(AM_CTAGSFLAGS) $(CTAGS_ARGS) \\\n+\t $$tags $$unique\n+\n+GTAGS:\n+\there=`$(am__cd) $(top_builddir) && pwd` \\\n+\t && cd $(top_srcdir) \\\n+\t && gtags -i $(GTAGS_ARGS) $$here\n+\n+distclean-tags:\n+\t-rm -f TAGS ID GTAGS GRTAGS GSYMS GPATH tags\n+\n+distdir: $(DISTFILES)\n+\t@srcdirstrip=`echo "$(srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\ttopsrcdirstrip=`echo "$(top_srcdir)" | sed \'s/[].[^$$\\\\*]/\\\\\\\\&/g\'`; \\\n+\tlist=\'$(DISTFILES)\'; \\\n+\t dist_files=`for file in $$list; do echo $$file; done | \\\n+\t sed -e "s|^$$srcdirstrip/||;t" \\\n+\t -e "s|^$$topsrcdirstrip/|$(top_builddir)/|;t"`; \\\n+\tcase $$dist_files in \\\n+\t */*) $(MKDIR_P) `echo "$$dist_files" | \\\n+\t\t\t sed \'/\\//!d;s|^|$(distdir)/|;s,/[^/]*$$,,\' | \\\n+\t\t\t sort -u` ;; \\\n+\tesac; \\\n+\tfor file in $$dist_files; do \\\n+\t if test -f $$file || test -d $$file; then d=.; else d=$(srcdir); fi; \\\n+\t if test -d $$d/$$file; then \\\n+\t dir=`echo "/$$file" | sed -e \'s,/[^/]*$$,,\'`; \\\n+\t if test -d $(srcdir)/$$file && test $$d != $(srcdir); then \\\n+\t cp -pR $(srcdir)/$$file $(distdir)$$dir || exit 1; \\\n+\t fi; \\\n+\t cp -pR $$d/$$file $(distdir)$$dir || exit 1; \\\n+\t else \\\n+\t test -f $(distdir)/$$file \\\n+\t || cp -p $$d/$$file $(distdir)/$$file \\\n+\t || exit 1; \\\n+\t fi; \\\n+\tdone\n+check-am: all-am\n+check: check-am\n+all-am: Makefile $(PROGRAMS)\n+installdirs:\n+install: install-am\n+install-exec: install-exec-am\n+install-data: install-data-am\n+uninstall: uninstall-am\n+\n+install-am: all-am\n+\t@$(MAKE) $(AM_MAKEFLAGS) install-exec-am install-data-am\n+\n+installcheck: installcheck-am\n+install-strip:\n+\t$(MAKE) $(AM_MAKEFLAGS) INSTALL_PROGRAM="$(INSTALL_STRIP_PROGRAM)" \\\n+\t install_sh_PROGRAM="$(INSTALL_STRIP_PROGRAM)" INSTALL_STRIP_FLAG=-s \\\n+\t `test -z \'$(STRIP)\' || \\\n+\t echo "INSTALL_PROGRAM_ENV=STRIPPROG=\'$(STRIP)\'"` install\n+mostlyclean-generic:\n+\n+clean-generic:\n+\n+distclean-generic:\n+\t-test -z "$(CONFIG_CLEAN_FILES)" || rm -f $(CONFIG_CLEAN_FILES)\n+\n+maintainer-clean-generic:\n+\t@echo "This command is intended for maintainers to use"\n+\t@echo "it deletes files that may require special tools to rebuild."\n+clean: clean-am\n+\n+clean-am: clean-generic clean-noinstPROGRAMS mostlyclean-am\n+\n+distclean: distclean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+distclean-am: clean-am distclean-compile distclean-generic \\\n+\tdistclean-tags\n+\n+dvi: dvi-am\n+\n+dvi-am:\n+\n+html: html-am\n+\n+info: info-am\n+\n+info-am:\n+\n+install-data-am:\n+\n+install-dvi: install-dvi-am\n+\n+install-exec-am:\n+\n+install-html: install-html-am\n+\n+install-info: install-info-am\n+\n+install-man:\n+\n+install-pdf: install-pdf-am\n+\n+install-ps: install-ps-am\n+\n+installcheck-am:\n+\n+maintainer-clean: maintainer-clean-am\n+\t-rm -rf ./$(DEPDIR)\n+\t-rm -f Makefile\n+maintainer-clean-am: distclean-am maintainer-clean-generic\n+\n+mostlyclean: mostlyclean-am\n+\n+mostlyclean-am: mostlyclean-compile mostlyclean-generic\n+\n+pdf: pdf-am\n+\n+pdf-am:\n+\n+ps: ps-am\n+\n+ps-am:\n+\n+uninstall-am:\n+\n+.MAKE: install-am install-strip\n+\n+.PHONY: CTAGS GTAGS all all-am check check-am clean clean-generic \\\n+\tclean-noinstPROGRAMS ctags distclean distclean-compile \\\n+\tdistclean-generic distclean-tags distdir dvi dvi-am html \\\n+\thtml-am info info-am install install-am install-data \\\n+\tinstall-data-am install-dvi install-dvi-am install-exec \\\n+\tinstall-exec-am install-html install-html-am install-info \\\n+\tinstall-info-am install-man install-pdf install-pdf-am \\\n+\tinstall-ps install-ps-am install-strip installcheck \\\n+\tinstallcheck-am installdirs maintainer-clean \\\n+\tmaintainer-clean-generic mostlyclean mostlyclean-compile \\\n+\tmostlyclean-generic pdf pdf-am ps ps-am tags uninstall \\\n+\tuninstall-am\n+\n+# Tell versions [3.59,3.63) of GNU make to not export all variables.\n+# Otherwise a system limit (for SysV at least) may be exceeded.\n+.NOEXPORT:\n'

diff -r dfe9332138cf -r 997f5136985f fastx_toolkit-0.0.6/src/seqalign_test/seqalign_test.cpp
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_toolkit-0.0.6/src/seqalign_test/seqalign_test.cpp Thu Aug 14 04:52:17 2014 -0400

[

@@ -0,0 +1,18 @@
+#include <string>
+#include <vector>
+#include <ostream>
+#include <iostream>
+#include "sequence_alignment.h"
+
+
+int main( /*int argc, char* argv[] */)
+{
+ HalfLocalSequenceAlignment lsa ;
+
+ const SequenceAlignmentResults& results = lsa.align("AAAGGTTTCCC","AGGCTT" );
+ lsa.print_matrix();
+ results.print();
+
+
+ return 0;
+}