| Next changeset 1:daaf552153fe (2015-11-11) |
|
Commit message:
Imported from capsule None |
|
added:
fastq_stats.py fastq_stats.xml test-data/fastq_stats1.fastq test-data/fastq_stats_1_out.tabular tool_dependencies.xml |
| b |
| diff -r 000000000000 -r 9b7b4e0ca9db fastq_stats.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastq_stats.py Mon Jan 27 09:29:03 2014 -0500 |
| [ |
| @@ -0,0 +1,48 @@ +#Dan Blankenberg +import sys +from galaxy_utils.sequence.fastq import fastqReader, fastqAggregator + +VALID_NUCLEOTIDES = [ 'A', 'C', 'G', 'T', 'N' ] +VALID_COLOR_SPACE = map( str, range( 7 ) ) + [ '.' ] +SUMMARY_STAT_ORDER = ['read_count', 'min_score', 'max_score', 'sum_score', 'mean_score', 'q1', 'med_score', 'q3', 'iqr', 'left_whisker', 'right_whisker' ] + +def main(): + input_filename = sys.argv[1] + output_filename = sys.argv[2] + input_type = sys.argv[3] or 'sanger' + + aggregator = fastqAggregator() + num_reads = None + fastq_read = None + for num_reads, fastq_read in enumerate( fastqReader( open( input_filename ), format = input_type ) ): + aggregator.consume_read( fastq_read ) + out = open( output_filename, 'wb' ) + valid_nucleotides = VALID_NUCLEOTIDES + if fastq_read: + if fastq_read.sequence_space == 'base': + out.write( '#column\tcount\tmin\tmax\tsum\tmean\tQ1\tmed\tQ3\tIQR\tlW\trW\toutliers\tA_Count\tC_Count\tG_Count\tT_Count\tN_Count\tother_bases\tother_base_count\n' ) + else: + out.write( '#column\tcount\tmin\tmax\tsum\tmean\tQ1\tmed\tQ3\tIQR\tlW\trW\toutliers\t0_Count\t1_Count\t2_Count\t3_Count\t4_Count\t5_Count\t6_Count\t._Count\tother_bases\tother_base_count\n' ) + valid_nucleotides = VALID_COLOR_SPACE + for i in range( aggregator.get_max_read_length() ): + column_stats = aggregator.get_summary_statistics_for_column( i ) + out.write( '%i\t' % ( i + 1 ) ) + out.write( '%s\t' * len( SUMMARY_STAT_ORDER ) % tuple( [ column_stats[ key ] for key in SUMMARY_STAT_ORDER ] ) ) + out.write( '%s\t' % ','.join( map( str, column_stats['outliers'] ) ) ) + base_counts = aggregator.get_base_counts_for_column( i ) + for nuc in valid_nucleotides: + out.write( "%s\t" % base_counts.get( nuc, 0 ) ) + extra_nucs = sorted( [ nuc for nuc in base_counts.keys() if nuc not in valid_nucleotides ] ) + out.write( "%s\t%s\n" % ( ','.join( extra_nucs ), ','.join( str( base_counts[nuc] ) for nuc in extra_nucs ) ) ) + out.close() + if num_reads is None: + print "No valid fastq reads could be processed." + else: + print "%i fastq reads were processed." % ( num_reads + 1 ) + print "Based upon quality values and sequence characters, the input data is valid for: %s" % ( ", ".join( aggregator.get_valid_formats() ) or "None" ) + ascii_range = aggregator.get_ascii_range() + decimal_range = aggregator.get_decimal_range() + print "Input ASCII range: %s(%i) - %s(%i)" % ( repr( ascii_range[0] ), ord( ascii_range[0] ), repr( ascii_range[1] ), ord( ascii_range[1] ) ) #print using repr, since \x00 (null) causes info truncation in galaxy when printed + print "Input decimal range: %i - %i" % ( decimal_range[0], decimal_range[1] ) + +if __name__ == "__main__": main() |
| b |
| diff -r 000000000000 -r 9b7b4e0ca9db fastq_stats.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastq_stats.xml Mon Jan 27 09:29:03 2014 -0500 |
| [ |
| @@ -0,0 +1,74 @@ +<tool id="fastq_stats" name="FASTQ Summary Statistics" version="1.0.0"> + <description>by column</description> + <requirements> + <requirement type="package" version="1.0.0">galaxy_sequence_utils</requirement> + </requirements> + <command interpreter="python">fastq_stats.py '$input_file' '$output_file' '${input_file.extension[len( 'fastq' ):]}'</command> + <inputs> + <param name="input_file" type="data" format="fastqsanger,fastqillumina,fastqsolexa,fastqcssanger" label="FASTQ File"/> + </inputs> + <outputs> + <data name="output_file" format="tabular" /> + </outputs> + <tests> + <test> + <param name="input_file" value="fastq_stats1.fastq" ftype="fastqsanger" /> + <output name="output_file" file="fastq_stats_1_out.tabular" /> + </test> + </tests> + <help> +This tool creates summary statistics on a FASTQ file. + +.. class:: infomark + +**TIP:** This statistics report can be used as input for the **Boxplot** tools. + +----- + +**The output file will contain the following fields:** + +* column = column number (1 to 36 for a 36-cycles read Solexa file) +* count = number of bases found in this column. +* min = Lowest quality score value found in this column. +* max = Highest quality score value found in this column. +* sum = Sum of quality score values for this column. +* mean = Mean quality score value for this column. +* Q1 = 1st quartile quality score. +* med = Median quality score. +* Q3 = 3rd quartile quality score. +* IQR = Inter-Quartile range (Q3-Q1). +* lW = 'Left-Whisker' value (for boxplotting). +* rW = 'Right-Whisker' value (for boxplotting). +* outliers = Scores falling beyond the left and right whiskers (comma separated list). +* A_Count = Count of 'A' nucleotides found in this column. +* C_Count = Count of 'C' nucleotides found in this column. +* G_Count = Count of 'G' nucleotides found in this column. +* T_Count = Count of 'T' nucleotides found in this column. +* N_Count = Count of 'N' nucleotides found in this column. +* Other_Nucs = Comma separated list of other nucleotides found in this column. +* Other_Count = Comma separated count of other nucleotides found in this column. + +For example:: + + #column count min max sum mean Q1 med Q3 IQR lW rW outliers A_Count C_Count G_Count T_Count N_Count other_bases other_base_count + 1 14336356 2 33 450600675 31.4306281875 32.0 33.0 33.0 1.0 31 33 2,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30 4482314 2199633 4425957 3208745 19707 + 2 14336356 2 34 441135033 30.7703737965 30.0 33.0 33.0 3.0 26 34 2,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25 4419184 2170537 4627987 3118567 81 + 3 14336356 2 34 433659182 30.2489127642 29.0 32.0 33.0 4.0 23 34 2,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22 4310988 2941988 3437467 3645784 129 + 4 14336356 2 34 433635331 30.2472490917 29.0 32.0 33.0 4.0 23 34 2,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22 4110637 3007028 3671749 3546839 103 + 5 14336356 2 34 432498583 30.167957813 29.0 32.0 33.0 4.0 23 34 2,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22 4348275 2935903 3293025 3759029 124 + +----- + +.. class:: warningmark + +Adapter bases in color space reads are excluded from statistics. + +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ + + + </help> +</tool> |
| b |
| diff -r 000000000000 -r 9b7b4e0ca9db test-data/fastq_stats1.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fastq_stats1.fastq Mon Jan 27 09:29:03 2014 -0500 |
| b |
| @@ -0,0 +1,36 @@ +@CSHL_3_FC042AGLLWW:1:2:7:203 +GTACGCATGACCGAACCCCCCNCCCCCCAATTGGTT ++CSHL_3_FC042AGLLWW:1:2:7:203 +BBC?7?B6>ABB?B;BBBCC9&;BCBBBBBBBB>>A +@CSHL_3_FC042AGLLWW:1:2:7:33 +CAATGCCTCCAATTGGTTAATCCCCCTATATATACT ++CSHL_3_FC042AGLLWW:1:2:7:33 +8BBB?B;BB8?6@9B8BB=8.&1?,&;931&&&(BB +@CSHL_3_FC042AGLLWW:1:2:7:169 +GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:169 +B@.?B=6BBB@.@BBBBBBBBBBBBBBB7=;6(663 +@CSHL_3_FC042AGLLWW:1:2:7:1436 +AATTATTTATTAAATTTTAATAATATGGGAGACACT ++CSHL_3_FC042AGLLWW:1:2:7:1436 +B?BBBBBBBBBBBBBBB@6ABBBBB@4@BBBBB77< +@CSHL_3_FC042AGLLWW:1:2:7:292 +GGAGAAATACACACAATTGGTTAATCCCCCTATATA ++CSHL_3_FC042AGLLWW:1:2:7:292 +CBCBBBBBBB6.BBBBBBBBBBB=9&66&1@>6&3& +@CSHL_3_FC042AGLLWW:1:2:7:1819 +AATTCAAACCACCCCAACCCACACACAGAGATACAA ++CSHL_3_FC042AGLLWW:1:2:7:1819 +B==2777-BB-0&96866&,66-&.6&66,6-*2.6 +@CSHL_3_FC042AGLLWW:1:2:7:1875 +GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCCC ++CSHL_3_FC042AGLLWW:1:2:7:1875 +BBBBBBBBB9699&9BBBBBA@;BBBBBBBBB9&96 +@CSHL_3_FC042AGLLWW:1:2:8:624 +ACTGCAATTGGTTAATCCCCCTATATAGCGCTGTGG ++CSHL_3_FC042AGLLWW:1:2:8:624 +BB<4?A9ABB@>>009.6?@<.6@BBBBBBBBBBBB +@CSHL_3_FC042AGLLWW:1:2:8:250 +TGCCGCGCACACTGATGCAATTGGTTAATCCCCCTA ++CSHL_3_FC042AGLLWW:1:2:8:250 +BBBBBBBB?BBBBBBCCC<,91&6<39;?+6,3,9& |
| b |
| diff -r 000000000000 -r 9b7b4e0ca9db test-data/fastq_stats_1_out.tabular --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fastq_stats_1_out.tabular Mon Jan 27 09:29:03 2014 -0500 |
| b |
| @@ -0,0 +1,37 @@ +#column count min max sum mean Q1 med Q3 IQR lW rW outliers A_Count C_Count G_Count T_Count N_Count other_bases other_base_count +1 9 23 34 288 32.0 33.0 33.0 33.0 0.0 33 33 23,34 3 1 4 1 0 +2 9 28 33 287 31.8888888889 30.5 33.0 33.0 2.5 28 33 3 3 2 1 0 +3 9 13 34 268 29.7777777778 27.5 33.0 33.5 6.0 27 34 13 5 1 0 3 0 +4 9 17 33 261 29.0 24.5 33.0 33.0 8.5 17 33 1 2 3 3 0 +5 9 22 33 269 29.8888888889 26.0 33.0 33.0 7.0 22 33 3 3 3 0 0 +6 9 22 33 277 30.7777777778 29.0 33.0 33.0 4.0 28 33 22 5 3 0 1 0 +7 9 21 33 258 28.6666666667 23.0 33.0 33.0 10.0 21 33 4 1 3 1 0 +8 9 12 33 263 29.2222222222 26.5 33.0 33.0 6.5 21 33 12 2 1 1 5 0 +9 9 29 33 290 32.2222222222 31.5 33.0 33.0 1.5 30 33 29 3 3 2 1 0 +10 9 23 33 277 30.7777777778 28.0 33.0 33.0 5.0 23 33 1 4 2 2 0 +11 9 12 33 245 27.2222222222 21.0 31.0 33.0 12.0 12 33 5 2 1 1 0 +12 9 13 33 214 23.7777777778 14.0 24.0 33.0 19.0 13 33 2 4 2 1 0 +13 9 5 33 249 27.6666666667 26.5 31.0 33.0 6.5 24 33 5 2 1 1 5 0 +14 9 5 33 233 25.8888888889 19.5 33.0 33.0 13.5 5 33 3 3 2 1 0 +15 9 15 33 251 27.8888888889 22.5 33.0 33.0 10.5 15 33 5 1 1 2 0 +16 9 23 34 269 29.8888888889 23.5 33.0 33.0 9.5 23 34 3 1 2 3 0 +17 9 13 34 266 29.5555555556 27.0 33.0 33.0 6.0 21 34 13 2 3 1 3 0 +18 9 21 34 272 30.2222222222 26.0 33.0 33.0 7.0 21 34 0 5 1 3 0 +19 9 5 34 244 27.1111111111 24.0 30.0 33.0 9.0 21 34 5 4 4 1 0 0 +20 9 11 34 241 26.7777777778 17.0 32.0 33.0 16.0 11 34 3 4 2 0 0 +21 9 13 33 240 26.6666666667 22.5 27.0 33.0 10.5 13 33 1 4 0 4 0 +22 9 5 33 190 21.1111111111 9.0 21.0 33.0 24.0 5 33 1 4 0 3 1 +23 9 5 33 205 22.7777777778 14.0 26.0 33.0 19.0 5 33 4 4 1 0 0 +24 9 5 33 247 27.4444444444 24.5 31.0 33.0 8.5 21 33 5 1 5 1 2 0 +25 9 11 34 241 26.7777777778 18.5 33.0 33.0 14.5 11 34 3 4 0 2 0 +26 9 5 33 212 23.5555555556 11.5 31.0 33.0 21.5 5 33 0 6 0 3 0 +27 9 5 33 227 25.2222222222 20.0 26.0 33.0 13.0 5 33 3 4 1 1 0 +28 9 21 33 255 28.3333333333 22.5 31.0 33.0 10.5 21 33 2 4 3 0 0 +29 9 5 33 228 25.3333333333 19.5 30.0 33.0 13.5 5 33 2 4 1 2 0 +30 9 10 33 213 23.6666666667 13.5 28.0 33.0 19.5 10 33 3 4 2 0 0 +31 9 5 33 236 26.2222222222 21.0 31.0 33.0 12.0 5 33 1 4 1 3 0 +32 9 5 33 210 23.3333333333 11.5 29.0 33.0 21.5 5 33 3 3 0 3 0 +33 9 5 33 183 20.3333333333 8.0 21.0 33.0 25.0 5 33 1 4 2 2 0 +34 9 5 33 150 16.6666666667 6.0 17.0 25.5 19.5 5 33 3 4 1 1 0 +35 9 13 33 217 24.1111111111 19.5 24.0 31.0 11.5 13 33 1 4 1 3 0 +36 9 5 33 195 21.6666666667 11.5 21.0 32.5 21.0 5 33 3 2 1 3 0 |
| b |
| diff -r 000000000000 -r 9b7b4e0ca9db tool_dependencies.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Mon Jan 27 09:29:03 2014 -0500 |
| b |
| @@ -0,0 +1,6 @@ +<?xml version="1.0"?> +<tool_dependency> + <package name="galaxy_sequence_utils" version="1.0.0"> + <repository changeset_revision="0643676ad5f7" name="package_galaxy_utils_1_0" owner="devteam" prior_installation_required="False" toolshed="http://toolshed.g2.bx.psu.edu" /> + </package> +</tool_dependency> |