| Previous changeset 10:7ec1d063fecd (2020-06-06) Next changeset 12:97ca48f470ef (2020-06-17) |
|
Commit message:
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/chira commit 51f68a6d51d9e87f8e54021ce760b1506a3589b8" |
|
modified:
chira_extract.xml macros.xml test-data/chimeras test-data/interactions |
|
removed:
test-data/singletons |
| b |
| diff -r 7ec1d063fecd -r a618f28e1496 chira_extract.xml --- a/chira_extract.xml Sat Jun 06 08:12:25 2020 -0400 +++ b/chira_extract.xml Sun Jun 14 17:37:05 2020 -0400 |
| b |
| @@ -32,9 +32,12 @@ #end if $hybridize $seed_interaction + -sbp '$seed_bp' + -smpu '$seed_min_pu' + -acc '$accessibility' + -accw '$acc_width' + -m '$intarna_mode' $summarize - -a '$accessibility' - -m '$intarna_mode' -p "\${GALAXY_SLOTS:-2}" -o ./ ]]></command> @@ -93,29 +96,39 @@ <param name="hybridize" type="boolean" truevalue="-r" falsevalue="" checked="false" label="Hybridize chimeric loci?" help="Turning this option on increases the run time of the tool significantly."/> - <param name="seed_interaction" type="boolean" truevalue="" falsevalue="--noSeed" checked="false" - label="Enforce seed interaction?"/> - <param name="accessibility" type="boolean" truevalue="C" falsevalue="N" checked="false" - label="Compute accessibility profiles for interacting sequences?"/> <param name="intarna_mode" type="select"> <option value="H">Heuristic</option> <option value="M">Exact</option> <option value="S">Seed-only</option> </param> + <param name="seed_interaction" type="boolean" truevalue="" falsevalue="--noSeed" checked="true" + label="Enforce seed interaction?"/> + <param name="seed_bp" type="integer" value="5" min="2" max="20" + label="Number of inter-molecular base pairs within the seed region" + help="IntaRNA --seedBP parameter"/> + <param name="seed_min_pu" type="float" value="0" min="0" max="1" + label="Minimal unpaired probability (per sequence) a seed region may have" + help="IntaRNA --seedMinPu parameter"/> + <param name="accessibility" type="boolean" truevalue="C" falsevalue="N" checked="false" + label="Compute accessibility profiles for interacting sequences?"/> + <param name="acc_width" type="integer" value="150" min="0" max="99999" + label="Sliding window size for accessibility computation" + help="IntaRNA --accW parameter"/> + <param name="temperature" type="float" value="37" min="0" max="100" + label="IntaRNA temperature parameter in Celsius to setup the VRNA energy parameters"/> <param name="summarize" type="boolean" truevalue="-s" falsevalue="" checked="false" label="Summarize interactions at loci level?"/> </inputs> <outputs> <data format="tabular" name="chimeras" from_work_dir="chimeras" label="ChiRA chimeric reads on ${on_string}"/> - <data format="tabular" name="singletons" from_work_dir="singletons" label="ChiRA singleton reads on ${on_string}"/> <data format="tabular" name="interactions" from_work_dir="interactions" label="ChiRA interaction summary on ${on_string}"> <filter>summarize == True</filter> </data> </outputs> <tests> - <test expect_num_outputs="3"> + <test expect_num_outputs="2"> <param name="loci" value="loci.counts"/> <param name="ref_type" value="split"/> <param name="ref_fasta1" value="ref1.fasta"/> @@ -124,7 +137,6 @@ <param name="hybridize" value="true" /> <param name="summarize" value="true" /> <output name="chimeras" file="chimeras"/> - <output name="singletons" file="singletons"/> <output name="interactions" file="interactions"/> </test> </tests> |
| b |
| diff -r 7ec1d063fecd -r a618f28e1496 macros.xml --- a/macros.xml Sat Jun 06 08:12:25 2020 -0400 +++ b/macros.xml Sun Jun 14 17:37:05 2020 -0400 |
| b |
| @@ -1,6 +1,6 @@ <macros> <token name="@WRAPPER_VERSION@">@TOOL_VERSION@+galaxy</token> - <token name="@TOOL_VERSION@">1.3.3</token> + <token name="@TOOL_VERSION@">1.3.4</token> <xml name="requirements"> <requirements> <requirement type="package" version="@TOOL_VERSION@">chira</requirement> |
| b |
| diff -r 7ec1d063fecd -r a618f28e1496 test-data/chimeras --- a/test-data/chimeras Sat Jun 06 08:12:25 2020 -0400 +++ b/test-data/chimeras Sun Jun 14 17:37:05 2020 -0400 |
| b |
| @@ -1,3 +1,3 @@ tagid txid1 txid2 geneid1 geneid2 symbol1 symbol2 region1 region2 tx_pos_start1 tx_pos_end1 tx_pos_strand1 length1 tx_pos_start2 tx_pos_end2 tx_pos_strand2 length2 read_info genomic_pos1 genomic_pos2 locus1 locus2 groupid1 groupid2 tpm1 tpm2 score1 score2 score sequences hybrid hybrid_pos mfe -3|2 mmu-miR-20a-5p ENSMUST00000136025 NA NA NA NA NA NA 0 23 + 23 132 142 + 188 6,28,35,44,55 mmu-miR-20a-5p:0:23:+ ENSMUST00000136025:132:142:+ mmu-miR-20a-5p:0:23:+ ENSMUST00000136025:132:142:+ 5 2 75660.00 165100.00 1.0 1.0 2.0 UAAAGUGCUUAUAGUGCAGGUAG&CUGCCUGCCU ((((((((((&)).)))))))) 1&13 -13.7 -4|1 mmu-miR-6979-3p ENSMUST00000136025 NA NA NA NA NA NA 2 12 + 21 32 46 + 188 30,39,2,15,54 mmu-miR-6979-3p:2:12:+ ENSMUST00000136025:32:46:+ mmu-miR-6979-3p:2:12:+ ENSMUST00000136025:32:46:+ 7 1 165100.00 121100.00 1.0 1.0 2.0 GUGUCUGUCU&CAGGACUCUUGGCU ((((.....((&))....)))) 3&1 -4 +3|2 mmu-miR-20a-5p ENSMUST00000136025 NA NA NA NA NA NA 0 23 + 23 132 142 + 188 6,28,35,44,55 mmu-miR-20a-5p:0:23:+ ENSMUST00000136025:132:142:+ mmu-miR-20a-5p:0:23:+ ENSMUST00000136025:132:142:+ 5 2 75660.00 165100.00 1.0 1.0 2.0 UAAAGUGCUUAUAGUGCAGGUAG&CUGCCUGCCU ............((.((((((((&)))))))))) 13&1 -13.7 +4|1 mmu-miR-6979-3p ENSMUST00000136025 NA NA NA NA NA NA 2 12 + 21 32 46 + 188 30,39,2,15,54 mmu-miR-6979-3p:2:12:+ ENSMUST00000136025:32:46:+ mmu-miR-6979-3p:2:12:+ ENSMUST00000136025:32:46:+ 7 1 165100.00 121100.00 1.0 1.0 2.0 GUGUCUGUCU&CAGGACUCUUGGCU NA NA NA |
| b |
| diff -r 7ec1d063fecd -r a618f28e1496 test-data/interactions --- a/test-data/interactions Sat Jun 06 08:12:25 2020 -0400 +++ b/test-data/interactions Sun Jun 14 17:37:05 2020 -0400 |
| b |
| @@ -1,2 +1,2 @@ -mmu-miR-20a-5p:0:23:+ ENSMUST00000136025:132:142:+ 1 UAAAGUGCUUAUAGUGCAGGUAG CUGCCUGCCU ((((((((((&)).)))))))) 1&13 -13.7 75660.00 165100.00 240760.0 1.0 1.0 2.0 NA NA mmu-miR-20a-5p ENSMUST00000136025 -mmu-miR-6979-3p:2:12:+ ENSMUST00000136025:32:46:+ 1 GUGUCUGUCU CAGGACUCUUGGCU ((((.....((&))....)))) 3&1 -4 165100.00 121100.00 286200.0 1.0 1.0 2.0 NA NA mmu-miR-6979-3p ENSMUST00000136025 +1 mmu-miR-20a-5p 0 23 + ENSMUST00000136025 132 142 + UAAAGUGCUUAUAGUGCAGGUAG CUGCCUGCCU ............((.((((((((&)))))))))) -13.7 AGUGCAGGUAG CUGCCUGCCU 13&1 mmu-miR-20a-5p 12 23 + ENSMUST00000136025 132 142 + 75660.00 165100.00 240760.0 1.0 1.0 2.0 NA NA mmu-miR-20a-5p ENSMUST00000136025 +1 mmu-miR-6979-3p 2 12 + ENSMUST00000136025 32 46 + GUGUCUGUCU CAGGACUCUUGGCU NA NA NA NA NA mmu-miR-6979-3p 2 12 + ENSMUST00000136025 32 46 + 165100.00 121100.00 286200.0 1.0 1.0 2.0 NA NA mmu-miR-6979-3p ENSMUST00000136025 |
| b |
| diff -r 7ec1d063fecd -r a618f28e1496 test-data/singletons --- a/test-data/singletons Sat Jun 06 08:12:25 2020 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| b |
| @@ -1,4 +0,0 @@ -tagid txid geneid symbol region tx_pos_start tx_pos_end tx_pos_strand length read_info genomic_pos locus groupid tpm score -2|2 mmu-miR-6898-5p NA NA NA 11 21 + NA 1,10,49 mmu-miR-6898-5p:11:21:+ mmu-miR-6898-5p:11:21:+ 6 165100.00 1.00 -6|1 ENSMUST00000160533 NA NA NA 69 82 + NA 43,55,55 ENSMUST00000160533:69:82:+ ENSMUST00000160533:69:82:+ 4 129700.00 1.00 -7|9 ENSMUST00000182010 NA NA NA 24 74 + NA 6,55,55 ENSMUST00000182010:24:74:+ ENSMUST00000182010:19:74:+ 0 64850.00 1.00 |