| Previous changeset 1:b89b0765695d (2021-05-17) Next changeset 3:ff8f55893e7d (2021-09-24) |
|
Commit message:
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/metaphlan/ commit f1c6f4fe1e572ace84cf9106bc253603f55aac55" |
|
modified:
formatoutput.py macros.xml metaphlan.xml |
|
added:
test-data/no_taxon_input.fasta |
| b |
| diff -r b89b0765695d -r a92a632c4d9b formatoutput.py --- a/formatoutput.py Mon May 17 20:10:24 2021 +0000 +++ b/formatoutput.py Mon Jun 14 12:48:10 2021 +0000 |
| [ |
| @@ -57,7 +57,9 @@ # skip headers if line.startswith("#"): continue - + # skip UNKNOWN lines in Predicted taxon relative abundances + if "UNKNOWN" in line: + continue # spit lines split_line = line[:-1].split('\t') taxo_n = split_line[0].split('|') |
| b |
| diff -r b89b0765695d -r a92a632c4d9b macros.xml --- a/macros.xml Mon May 17 20:10:24 2021 +0000 +++ b/macros.xml Mon Jun 14 12:48:10 2021 +0000 |
| b |
| @@ -1,6 +1,6 @@ <?xml version="1.0"?> <macros> - <token name="@TOOL_VERSION@">3.0.8</token> + <token name="@TOOL_VERSION@">3.0.9</token> <token name="@VERSION_SUFFIX@">0</token> <token name="@PROFILE@">20.01</token> <xml name="edam_ontology"> @@ -21,7 +21,7 @@ </xml> <xml name="citations"> <citations> - <citation type="doi">1101/2020.11.19.388223</citation> + <citation type="doi">10.7554/eLife.65088</citation> </citations> </xml> </macros> |
| b |
| diff -r b89b0765695d -r a92a632c4d9b metaphlan.xml --- a/metaphlan.xml Mon May 17 20:10:24 2021 +0000 +++ b/metaphlan.xml Mon Jun 14 12:48:10 2021 +0000 |
| b |
| b'@@ -195,8 +195,7 @@\n --metaphlan_output \'$output_file\'\n --outdir \'split_levels\'\n $out.legacy_output\n-&&\n-ls split_levels\n+\n #end if\n \n #if $out.krona_output\n@@ -211,26 +210,26 @@\n <section name="inputs" title="Inputs" expanded="true">\n <conditional name="in">\n <param name="selector" type="select" label="Input(s)">\n- <option value="raw" selected="true">Fasta/FastQ file(s) with metagenomic reads</option>\n+ <option value="raw" selected="true">Fasta/FastQ file(s) with microbiota reads</option>\n <option value="sam">Externally BowTie2-mapped SAM file</option>\n- <option value="bowtie2out">Intermediary mapping file of the metagenome generated by a previous MetaPhlAn run</option>\n+ <option value="bowtie2out">Intermediary mapping file of the microbiota generated by a previous MetaPhlAn run</option>\n </param>\n <when value="raw">\n <conditional name="raw_in">\n- <param name="selector" type="select" label="Fasta/FastQ file(s) with metagenomic reads">\n+ <param name="selector" type="select" label="Fasta/FastQ file(s) with microbiota reads">\n <option value="single" selected="true">One single-end file</option>\n <option value="multiple">Multiple single-end files</option>\n <option value="paired">Paired-end files</option>\n </param>\n <when value="single">\n- <param name="in" type="data" format="@FILE_FORMATS@" label="Single-end Fasta/FastQ file with metagenomic reads"/>\n+ <param name="in" type="data" format="@FILE_FORMATS@" label="Single-end Fasta/FastQ file with microbiota reads"/>\n </when>\n <when value="multiple">\n- <param name="in" type="data" format="@FILE_FORMATS@" multiple="true" label="Single-end Fasta/FastQ files with metagenomic reads"/>\n+ <param name="in" type="data" format="@FILE_FORMATS@" multiple="true" label="Single-end Fasta/FastQ files with microbiota reads"/>\n </when>\n <when value="paired">\n- <param name="in_f" type="data" format="@FILE_FORMATS@" label="Forward paired-end Fasta/FastQ file with metagenomic reads"/>\n- <param name="in_r" type="data" format="@FILE_FORMATS@" label="Reverse paired-end Fasta/FastQ file with metagenomic reads"/>\n+ <param name="in_f" type="data" format="@FILE_FORMATS@" label="Forward paired-end Fasta/FastQ file with microbiota reads"/>\n+ <param name="in_r" type="data" format="@FILE_FORMATS@" label="Reverse paired-end Fasta/FastQ file with microbiota reads"/>\n </when>\n </conditional>\n <param argument="--read_min_len" type="integer" value="70" label="Minimum length of the reads to be considered when parsing the input file"/>\n@@ -245,10 +244,10 @@\n </section>\n </when>\n <when value="sam">\n- <param name="in" type="data" format="sam" label="Externally BowTie2-mapped SAM file" help="BowTie2 needs to be used first to map metagenom reads"/>\n+ <param name="in" type="data" format="sam" label="Externally BowTie2-mapped SAM file" help="BowTie2 needs to be used first to map microbiota reads"/>\n </when>\n <when value="bowtie2out">\n- <param name="in" type="data" format="tabular" label="Intermediary mapping file of the metagenome generated by a previous MetaPhlAn run" \n+ <param name="in" type="data" format="tabular" label="Intermedia'..b's n="1"/>\n+ </assert_contents>\n+ </element>\n+ <element name="order" ftype="tabular">\n+ <assert_contents>\n+ <has_text text="order_id"/>\n+ <not_has_text text="class_id"/>\n+ <has_n_columns n="3"/>\n+ <has_n_lines n="1"/>\n+ </assert_contents>\n+ </element>\n+ <element name="family" ftype="tabular">\n+ <assert_contents>\n+ <has_text text="family_id"/>\n+ <not_has_text text="order"/>\n+ <has_n_columns n="3"/>\n+ <has_n_lines n="1"/>\n+ </assert_contents>\n+ </element>\n+ <element name="genus" ftype="tabular">\n+ <assert_contents>\n+ <has_text text="genus_id"/>\n+ <not_has_text text="family"/>\n+ <has_n_columns n="3"/>\n+ <has_n_lines n="1"/>\n+ </assert_contents>\n+ </element>\n+ <element name="species" ftype="tabular">\n+ <assert_contents>\n+ <has_text text="species_id"/>\n+ <not_has_text text="genus"/>\n+ <has_n_columns n="3"/>\n+ <has_n_lines n="1"/>\n+ </assert_contents>\n+ </element>\n+ <element name="strains" ftype="tabular">\n+ <assert_contents>\n+ <has_text text="strains_id"/>\n+ <not_has_text text="species_id"/>\n+ <has_n_columns n="3"/>\n+ <has_n_lines n="1"/>\n+ </assert_contents>\n+ </element>\n+ </output_collection>\n+ <output name="krona_output_file" ftype="tabular">\n+ <assert_contents>\n+ <not_has_text text="k__Bacteria"/>\n+ <has_n_lines n="0"/>\n+ </assert_contents>\n+ </output>\n+ </test>\n+ <test expect_num_outputs="6">\n+ <section name="inputs">\n+ <conditional name="in">\n+ <param name="selector" value="raw"/>\n+ <conditional name="raw_in">\n+ <!-- Single GZ file -->\n+ <param name="selector" value="single"/>\n <param name="in" value="SRS014464-Anterior_nares.fasta.gz"/>\n </conditional>\n <param name="read_min_len" value="70"/>\n@@ -916,13 +1061,13 @@\n - species-level resolution for bacteria, archaea, eukaryotes and viruses;\n - strain identification and tracking\n - orders of magnitude speedups compared to existing methods.\n-- metagenomic strain-level population genomics\n+- microbiota strain-level population genomics\n \n MetaPhlAn clade-abundance estimation\n ------------------------------------\n \n The basic usage of MetaPhlAn consists in the identification of the clades (from phyla to species and \n-strains in particular cases) present in the metagenome obtained from a microbiome sample and their \n+strains in particular cases) present in the microbiota obtained from a microbiome sample and their \n relative abundance.\n \n Marker level analysis\n@@ -944,7 +1089,7 @@\n \n - one or several sequence files in Fasta, FastQ (compressed or not)\n - a BowTie2 produced SAM file\n-- an intermediary mapping file of the metagenome generated by a previous MetaPhlAn run\n+- an intermediary mapping file of the microbiota generated by a previous MetaPhlAn run\n \n It also need the reference database, which can be locally installed or customized using the dedicated tools.\n \n@@ -965,4 +1110,4 @@\n \n ]]></help>\n <expand macro="citations"/>\n-</tool>\n+</tool>\n\\ No newline at end of file\n' |
| b |
| diff -r b89b0765695d -r a92a632c4d9b test-data/no_taxon_input.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/no_taxon_input.fasta Mon Jun 14 12:48:10 2021 +0000 |
| b |
| @@ -0,0 +1,4 @@ +> seq1 +ATTAGGGATTTTAGGGGGGGAGATTTAGAGAGAGAGAGAGAGAAGAAGAGAAGAAGAAGAAGAAAAAGGGGGAAGAGAGA +> seq2 +ATTAGGGATTTTAGGGGGGGAGATTTAGAGAGAGAGAGAGAGAAGAAGAGAAGAAGAAGAAGAAAAAGGGGGAAGAGAGA |