|
Commit message:
Upload ctat tools. |
|
added:
ctat_lncrna.xml test-data/slncky/reads.simPE.browse.html test-data/slncky/reads.simPE.canonical_to_lncs.txt test-data/slncky/reads.simPE.canonical_to_lncs.txt.sorted test-data/slncky/reads.simPE.cluster_info.txt test-data/slncky/reads.simPE.cluster_info.txt.sorted test-data/slncky/reads.simPE.filtered_info.txt test-data/slncky/reads.simPE.filtered_info.txt.sorted test-data/slncky/reads.simPE.lncs.bed test-data/slncky/reads.simPE.lncs.bed.sorted test-data/slncky/reads.simPE.lncs.info.txt test-data/slncky/reads.simPE.lncs.info.txt.sorted test-data/slncky/reads.simPE.orfs.txt test-data/slncky/reads.simPE.orthologs.top.txt test-data/slncky/reads.simPE.orthologs.top.txt.sorted test-data/slncky/reads.simPE.orthologs.txt test-data/slncky/reads.simPE.orthologs.txt.sorted tool-data/ctat_lncrna_annotations.loc.sample tool_data_table_conf.xml.sample |
| b |
| diff -r 000000000000 -r a940c4a36a43 ctat_lncrna.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ctat_lncrna.xml Tue Jul 17 11:49:16 2018 -0400 |
| [ |
| b'@@ -0,0 +1,181 @@\n+<tool id="ctat_lncrna" name="ctat_lncrna" version="1.0.0" profile="17.05">\n+\n+ <description>Filters a high-quality set of lncRNA from reconstructed RNA-seq data</description>\n+ <requirements>\n+ <requirement type="package" version="1.0.1">ctat-lncrna</requirement>\n+ </requirements>\n+ <command detect_errors="default">\n+ <![CDATA[\n+ #if str($bedfile) != "":\n+ lncrna --bedfile $bedfile\n+ --config "${assembly.fields.path}" \n+ #end if\n+\n+ #if str($assembly) != "":\n+ --assembly "${assembly.fields.value}"\n+ #end if\n+\n+ #if $min_overlap != "":\n+ --min_overlap "$min_overlap"\n+ #end if\n+\n+ #if str($min_cluster) != "":\n+ --min_cluster "$min_cluster"\n+ #end if\n+\n+ #if str($min_coding) != "":\n+ --min_coding "$min_coding"\n+ #end if\n+\n+ #if str($minMatch) != "":\n+ --minMatch "$minMatch"\n+ #end if\n+\n+ #if str($pad) != "":\n+ --pad "$pad"\n+ #end if\n+\n+ #if str($gap_open) != "":\n+ --gap_open "$gap_open"\n+ #end if\n+\n+ #if str($gap_extend) != "":\n+ --gap_extend "$gap_extend"\n+ #end if\n+ --web \n+ && cp -r slncky.EvolutionBrowser $html_file.files_path\n+]]>\n+ </command>\n+\n+ <inputs>\n+ <param name="bedfile" format="interval" type="data" value="bedfile" label="Bed File:" help="Reconstructed transcripts (ex. from StringTie or Trinity)"/>\n+ <param name="min_overlap" type="float" value="0.0" label="Min overlap" help="Remove any transcript that overlap annotated coding gene greater than min_overlap" />\n+ <param name="min_cluster" type="integer" value="2" label="Min cluster" help="Minimum size of duplication clusters to remove" />\n+ <param name="min_coding" type="float" value="0.1" label="Min exonic identity to filter out transcript that aligns to orthologous coding gene" help="default is set by learning coding alignment distribution from data"/>\n+ <param name="minMatch" type="float" value="0.1" label="Min match" help="Minimum match parameter for liftover" />\n+ <param name="pad" type="integer" value="0" label="Pad" help="No. of basepairs to search up- and down-stream when lifting over lnc to ortholog" />\n+ <param name="gap_open" type="integer" value="200" label="Gap open penalty to pass to lastz" help="Decreasing this parameter will increase sensitivity of orthology search"/>\n+ <param name="gap_extend" type="integer" value="40" label="Gap extend penalty to pass to lastz" help="Decreasing this parameter will increase sensitivity of orthology search."/>\n+ <param name="assembly" type="select" label="Choose annotation:" help="Select annotation">\n+ <options from_data_table="ctat_lncrna_annotations" />\n+ </param>\n+ </inputs>\n+\n+ <outputs>\n+ <data format="html" name="html_file" label="web_report" from_work_dir="slncky.EvolutionBrowser/browse.html"/>\n+ <data format="tabular" name="canonical_to_lncs" label="canonical_to_lncs" from_work_dir="slncky.canonical_to_lncs.txt"/>\n+ <data format="tabular" name="cluster_info" label="cluster_info" from_work_dir="slncky.cluster_info.txt"/>\n+ <data format="tabular" name="filtered_info" label="filtered_info" from_work_dir="slncky.filtered_info.txt"/>\n+ <data format="bed" name="lncs" label="lncs" from_work_dir="slncky.lncs.bed"/>\n+ <data format="tabular" name="lncs_info" label="lncs.info" from_work_dir="slncky.lncs.info.txt"/>\n+ <data format="tabular" name="orfs" label="orfs" from_work_dir="slncky.orfs.txt"/>\n+ <data format="tabular" name="orthologs_top" label="orthologs.top" from_work_dir="slncky.orthologs.top.txt"/>\n+ <data format="tabular" name="orthologs" label="orthologs" from_work_dir="slncky.orthologs.txt"/>\n+ </outputs>\n+\n+ <stdio>\n+ <exit_code range="1:" level="fatal" description="Error in SLNCky" />\n+ </stdio>\n+\n+ <tests>\n+ <test>\n+ <param name="bed'..b'format="bed" name="lncs" label="lncs" from_work_dir="slncky.lncs.bed"/> -->\n+ <output name="lncs" file="slncky/reads.simPE.lncs.bed" />\n+\n+ <!-- <data format="txt" name="lncs_info" label="lncs.info" from_work_dir="slncky.lncs.info.txt"/> -->\n+ <output name="lncs_info" file="slncky/reads.simPE.lncs.info.txt" />\n+\n+ <!-- <data format="txt" name="orfs" label="orfs" from_work_dir="slncky.orfs.txt"/> -->\n+ <output name="orfs" file="slncky/reads.simPE.orfs.txt" />\n+\n+ <!-- <data format="txt" name="orthologs_top" label="orthologs.top" from_work_dir="slncky.orthologs.top.txt"/> -->\n+ <output name="orthologs_top" file="slncky/reads.simPE.orthologs.top.txt" />\n+\n+ <!-- <data format="txt" name="orthologs" label="orthologs" from_work_dir="slncky.orthologs.txt"/> -->\n+ <output name="orthologs" file="slncky/reads.simPE.orthologs.txt" />\n+\n+ </test>\n+ <test>\n+ <param name="bedfile" value="mir-17-92.StringTie.transcripts.bed" />\n+ <param name="assembly" value="hg19" /> \n+ <param name="min_overlap" value="0.0" />\n+ <param name="min_cluster" value="2" />\n+ <param name="min_coding" value="0.1" />\n+ <param name="minMatch" value="0.1" />\n+ <param name="pad" value="0" />\n+ <param name="gap_open" value="200" />\n+ <param name="gap_extend" value="40" />\n+\n+ <!-- <data format="html" name="html_file" label="web_report" from_work_dir="slncky.EvolutionBrowser/browse.html"/> -->\n+ <output name="html_file" file="slncky/mir-17-92.browse.html" />\n+\n+ <!-- <data format="txt" name="canonical_to_lncs" label="canonical_to_lncs" from_work_dir="slncky.canonical_to_lncs.txt"/> -->\n+ <output name="canonical_to_lncs" file="slncky/mir-17-92.canonical_to_lncs.txt.sorted" sort="true" />\n+ \n+ <!-- <data format="txt" name="cluster_info" label="cluster_info" from_work_dir="slncky.cluster_info.txt"/> -->\n+ <!-- This file isn\'t being created for some reason...\n+ <output name="cluster_info" >\n+ <assert_contents>\n+ <has_line_matching expression=".+" />\n+ </assert_contents>\n+ </output>\n+ -->\n+\n+ <!-- <data format="txt" name="filtered_info" label="filtered_info" from_work_dir="slncky.filtered_info.txt"/> -->\n+ <output name="filtered_info" file="slncky/mir-17-92.filtered_info.txt.sorted" sort="true" />\n+\n+ <!-- <data format="bed" name="lncs" label="lncs" from_work_dir="slncky.lncs.bed"/> -->\n+ <output name="lncs" file="slncky/mir-17-92.lncs.bed" />\n+\n+ <!-- <data format="txt" name="lncs_info" label="lncs.info" from_work_dir="slncky.lncs.info.txt"/> -->\n+ <output name="lncs_info" file="slncky/mir-17-92.lncs.info.txt" />\n+\n+ <!-- <data format="txt" name="orfs" label="orfs" from_work_dir="slncky.orfs.txt"/> -->\n+ <output name="orfs" file="slncky/mir-17-92.orfs.txt" />\n+\n+ <!-- <data format="txt" name="orthologs_top" label="orthologs.top" from_work_dir="slncky.orthologs.top.txt"/> -->\n+ <output name="orthologs_top" file="slncky/mir-17-92.orthologs.top.txt" />\n+\n+ <!-- <data format="txt" name="orthologs" label="orthologs" from_work_dir="slncky.orthologs.txt"/> -->\n+ <output name="orthologs" file="slncky/mir-17-92.orthologs.txt" />\n+ </test>\n+ </tests>\n+\n+ <help>\n+.. class:: infomark\n+\n+slncky is a tool for lncRNA discovery from RNA-Seq data. slncky filters a high-quality set of noncoding transcripts, discovers lncRNA orthologs, and characterizes conserved lncRNA evolution.\n+\n+To learn more about slncky visit their website_ .\n+\n+.. _website: https://github.com/slncky/slncky\n+\n+</help>\n+\n+<citations>\n+ <citation type="doi">10.1186/s13059-016-0880-9</citation>\n+</citations>\n+\n+</tool>\n' |
| b |
| diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.browse.html --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.browse.html Tue Jul 17 11:49:16 2018 -0400 |
| b |
| @@ -0,0 +1,83 @@ +<html> +<head> +<script type="text/javascript" charset="utf8" src="search.js"></script> + +<!-- DataTables CSS --> +<link rel="stylesheet" type="text/css" href="https://cdn.datatables.net/1.10.9/css/jquery.dataTables.css"> +<!-- Bootstrap CSS --> +<link rel="stylesheet" type="text/css" href="https://bootswatch.com/paper/bootstrap.min.css"> +<!-- jQuery --> +<script type="text/javascript" charset="utf8" src="https://code.jquery.com/jquery-1.11.3.min.js"></script> + +<!-- DataTables --> +<script type="text/javascript" charset="utf8" src="https://cdn.datatables.net/1.10.9/js/jquery.dataTables.min.js"></script> +<style> select { font-size: 90%; width: 30px; } th { font-size: 80%; } td { font-size: 80%; } td.red {color: red;} td.green {color: #009900;} </style> +<script type="text/javascript" class="init"> +$(document).ready(function() { + $('#table_id').DataTable(); +} ); +</script> + + +</head> +<body> + +<nav class="navbar navbar-default"> +<div class="container-fluid" style="position: absolute; width: 100%;"> +<div class="navbar-header"> +<button type="button" class="navbar-toggle collapsed" data-toggle="collapse" data-target="#bs-example-navbar-collapse-2"> +<span class="sr-only">Toggle navigation</span> +<span class="icon-bar"></span> +<span class="icon-bar"></span> +<span class="icon-bar"></span> +</button> +<a class ="navbar-brand" href="#"><p style="font-size:26"><em>slncky</em> Evolution Browser</p></a> +</div> + +<div class="collapse navbar-collapse" id="bs-example-navbar-collapse-2"> +<ul class="nav navbar-nav"> + +<a href="#"><li class="active">Browse</a></li> +</ul> +<ul class="nav navbar-nav navbar-right"> +</ul> +</div> +</div> +</nav> + +<div class="container"> +<div class="jumbotron"> +<h2>Browse lncRNAs</h2> +<hr> +<br> +<table id="table_id" class="table table-striped table-hover" cellspacing="0" width="100%"> +<thead> +<tr> +<th>Lnc</th> +<th>Name</th> +<th>Ortholog</th> +<th>Ortholog Name</th> +<th>Type</th> +<th>Transcript-Transcript Identity</th> +<th>Trascript-Genome Identity</th> +<th>Indel Rate</th> +<th>Conserved Splice Sites</th> +<th>Total Splice Sites</th> +<th>Lnc Exons Aligned</th> +<th>Ortholog Exons Aligned</th> +</tr> +</thead> +<tbody> +<tr><td><a href="lnc/STRG.25.1.html" target="_blank">STRG.25.1</a></td><td>MALAT1</td><td>uc008gfj.2</td><td>Malat1</td><td>intergenic</td><td>0.63</td><td>0.63</td><td>-</td><td>0.0</td><td>0</td><td>1,</td><td>1,</td></tr> +<tr><td><a href="lnc/STRG.5.1.html" target="_blank">STRG.5.1</a></td><td>Unannotated</td><td>uc009vfa.1</td><td>Atpase6</td><td>intergenic</td><td>0.00</td><td>0.00</td><td>-</td><td>0.0</td><td>0</td><td>NA</td><td>NA</td></tr> +<tr><td><a href="lnc/STRG.52.1.html" target="_blank">STRG.52.1</a></td><td>JA760615</td><td>uc012hdm.1</td><td>BC071253</td><td>intergenic</td><td>0.00</td><td>-0.00</td><td>-</td><td>0.0</td><td>0</td><td>NA</td><td>NA</td></tr> +<tr><td><a href="lnc/STRG.48.2.html" target="_blank">STRG.48.2</a></td><td>OK/SW-cl.16</td><td>uc009vez.1</td><td>Cox2</td><td>intergenic</td><td>0.00</td><td>-0.00</td><td>-</td><td>0.0</td><td>0</td><td>NA</td><td>NA</td></tr> +<tr><td><a href="lnc/STRG.44.1.html" target="_blank">STRG.44.1</a></td><td>TVAS5</td><td>uc009vew.1</td><td>AK018753</td><td>intergenic</td><td>0.00</td><td>-0.00</td><td>-</td><td>0.0</td><td>0</td><td>NA</td><td>NA</td></tr> +<tr><td><a href="lnc/STRG.49.1.html" target="_blank">STRG.49.1</a></td><td>OK/SW-cl.16</td><td>uc009vfa.1</td><td>Atpase6</td><td>intergenic</td><td>0.00</td><td>-0.00</td><td>-</td><td>0.0</td><td>0</td><td>NA</td><td>NA</td></tr> +<tr><td><a href="lnc/STRG.45.1.html" target="_blank">STRG.45.1</a></td><td>TVAS5</td><td>uc009vew.1</td><td>AK018753</td><td>intergenic</td><td>0.00</td><td>-0.00</td><td>-</td><td>0.0</td><td>0</td><td>NA</td><td>NA</td></tr> +<tr><td><a href="lnc/STRG.51.1.html" target="_blank">STRG.51.1</a></td><td>MTND5</td><td>uc009vfc.1</td><td>Cytb</td><td>intergenic</td><td>0.00</td><td>-0.00</td><td>-</td><td>0.0</td><td>0</td><td>NA</td><td>NA</td></tr> +</tbody> +</table> +</div> +</body> +</html> |
| b |
| diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.canonical_to_lncs.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.canonical_to_lncs.txt Tue Jul 17 11:49:16 2018 -0400 |
| b |
| @@ -0,0 +1,27 @@ +#canonical lncs +STRG.45.1 STRG.45.1, +STRG.28.1 STRG.28.2,STRG.28.1, +STRG.25.1 STRG.25.2,STRG.25.1, +STRG.44.1 STRG.44.1, +STRG.2.1 STRG.2.1, +STRG.15.2 STRG.15.2,STRG.15.1, +STRG.50.1 STRG.50.1, +STRG.3.1 STRG.3.1, +STRG.17.1 STRG.17.1, +STRG.48.1 STRG.48.1, +STRG.48.2 STRG.48.2, +STRG.1.1 STRG.1.1, +STRG.42.1 STRG.42.1, +STRG.51.1 STRG.51.1, +STRG.8.1 STRG.8.1, +STRG.7.1 STRG.7.1, +STRG.6.1 STRG.6.1, +STRG.52.1 STRG.52.1, +STRG.10.1 STRG.10.1, +STRG.47.1 STRG.47.1, +STRG.46.1 STRG.46.1, +STRG.5.1 STRG.5.1,STRG.5.2,STRG.4.1, +STRG.22.1 STRG.22.1, +STRG.43.1 STRG.43.1, +STRG.23.1 STRG.23.1, +STRG.49.1 STRG.49.1,STRG.49.2,STRG.49.3, |
| b |
| diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.canonical_to_lncs.txt.sorted --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.canonical_to_lncs.txt.sorted Tue Jul 17 11:49:16 2018 -0400 |
| b |
| @@ -0,0 +1,27 @@ +#canonical lncs +STRG.10.1 STRG.10.1, +STRG.1.1 STRG.1.1, +STRG.15.2 STRG.15.2,STRG.15.1, +STRG.17.1 STRG.17.1, +STRG.2.1 STRG.2.1, +STRG.22.1 STRG.22.1, +STRG.23.1 STRG.23.1, +STRG.25.1 STRG.25.2,STRG.25.1, +STRG.28.1 STRG.28.2,STRG.28.1, +STRG.3.1 STRG.3.1, +STRG.42.1 STRG.42.1, +STRG.43.1 STRG.43.1, +STRG.44.1 STRG.44.1, +STRG.45.1 STRG.45.1, +STRG.46.1 STRG.46.1, +STRG.47.1 STRG.47.1, +STRG.48.1 STRG.48.1, +STRG.48.2 STRG.48.2, +STRG.49.1 STRG.49.1,STRG.49.2,STRG.49.3, +STRG.50.1 STRG.50.1, +STRG.51.1 STRG.51.1, +STRG.5.1 STRG.5.1,STRG.5.2,STRG.4.1, +STRG.52.1 STRG.52.1, +STRG.6.1 STRG.6.1, +STRG.7.1 STRG.7.1, +STRG.8.1 STRG.8.1, |
| b |
| diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.cluster_info.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.cluster_info.txt Tue Jul 17 11:49:16 2018 -0400 |
| b |
| @@ -0,0 +1,6 @@ +3 N STRG.22.1,STRG.15.2,STRG.6.1, +3 N STRG.7.1,STRG.10.1,STRG.43.1, +2 N STRG.1.1,STRG.46.1, +2 N STRG.47.1,STRG.2.1, +2 N STRG.48.1,STRG.3.1, +#clusterSize alignToDup? transcripts |
| b |
| diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.cluster_info.txt.sorted --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.cluster_info.txt.sorted Tue Jul 17 11:49:16 2018 -0400 |
| b |
| @@ -0,0 +1,6 @@ +2 N STRG.1.1,STRG.46.1, +2 N STRG.47.1,STRG.2.1, +2 N STRG.48.1,STRG.3.1, +3 N STRG.22.1,STRG.15.2,STRG.6.1, +3 N STRG.7.1,STRG.10.1,STRG.43.1, +#clusterSize alignToDup? transcripts |
| b |
| diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.filtered_info.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.filtered_info.txt Tue Jul 17 11:49:16 2018 -0400 |
| b |
| @@ -0,0 +1,49 @@ +STRG.19.1 200.0% exonic overlap with coding transcript uc003ubx.4 +STRG.16.1 100.0% exonic overlap with coding transcript NM_001003806 +STRG.14.1 100.0% exonic overlap with coding transcript uc003nxk.2 +STRG.29.1 100.0% exonic overlap with coding transcript NM_001014449 +STRG.13.1 100.0% exonic overlap with coding transcript NM_005345 +STRG.27.1 100.0% exonic overlap with coding transcript uc001oja.3 +STRG.18.1 100.0% exonic overlap with coding transcript uc003tzi.4 +STRG.26.1 100.0% exonic overlap with coding transcript uc001oiw.2 +STRG.20.1 99.8% exonic overlap with coding transcript NM_198085 +STRG.37.1 99.8% exonic overlap with coding transcript uc002klr.3 +STRG.41.1 99.6% exonic overlap with coding transcript NM_014649 +STRG.33.1 97.7% exonic overlap with coding transcript NM_198993 +STRG.40.1 88.6% exonic overlap with coding transcript NM_002967 +STRG.31.3 71.4% exonic overlap with coding transcript uc002hqy.1 +STRG.32.1 40.2% exonic overlap with coding transcript uc002hrq.1 +STRG.30.1 37.4% exonic overlap with coding transcript uc002fnn.2 +STRG.34.1 35.7% exonic overlap with coding transcript uc002hsq.3 +STRG.24.1 32.7% exonic overlap with coding transcript uc001ocx.3 +STRG.39.1 32.6% exonic overlap with coding transcript NM_004152 +STRG.36.1 20.8% exonic overlap with coding transcript uc002iyw.4 +STRG.38.1 transcript entirely within coding transcript NM_001003652 +STRG.11.1 transcript entirely within coding transcript NM_173666 +STRG.21.2 transcript entirely within coding transcript uc011leg.2 +STRG.21.1 transcript entirely within coding transcript NM_001164750 +STRG.31.1 transcript entirely within coding transcript NM_000978 +STRG.31.2 transcript entirely within coding transcript uc002hqx.1 +STRG.9.1 transcript entirely within coding transcript NM_020357 +STRG.35.1 transcript entirely within coding transcript NM_001075099 +STRG.12.1 transcript entirely within coding transcript uc011dmq.2 +STRG.2.1 aligns to STRG.47.1 with 98.6% identity and 99.9% coverage. Appears to be duplication. +STRG.15.2 aligns to STRG.22.1 with 99.4% identity and 100.0% coverage. Appears to be duplication. +STRG.15.2 aligns to STRG.6.1 with 97.0% identity and 100.0% coverage. Appears to be duplication. +STRG.3.1 aligns to STRG.48.1 with 98.2% identity and 99.9% coverage. Appears to be duplication. +STRG.48.1 aligns to STRG.3.1 with 98.2% identity and 99.9% coverage. Appears to be duplication. +STRG.1.1 aligns to STRG.46.1 with 98.5% identity and 99.9% coverage. Appears to be duplication. +STRG.7.1 aligns to STRG.43.1 with 90.7% identity and 100.0% coverage. Appears to be duplication. +STRG.7.1 aligns to STRG.10.1 with 90.1% identity and 98.9% coverage. Appears to be duplication. +STRG.6.1 aligns to STRG.22.1 with 97.1% identity and 100.0% coverage. Appears to be duplication. +STRG.6.1 aligns to STRG.15.2 with 97.0% identity and 100.0% coverage. Appears to be duplication. +STRG.10.1 aligns to STRG.7.1 with 90.1% identity and 98.9% coverage. Appears to be duplication. +STRG.10.1 aligns to STRG.43.1 with 89.5% identity and 99.3% coverage. Appears to be duplication. +STRG.47.1 aligns to STRG.2.1 with 98.6% identity and 99.9% coverage. Appears to be duplication. +STRG.46.1 aligns to STRG.1.1 with 98.5% identity and 99.9% coverage. Appears to be duplication. +STRG.22.1 aligns to STRG.15.2 with 99.4% identity and 100.0% coverage. Appears to be duplication. +STRG.22.1 aligns to STRG.6.1 with 97.1% identity and 100.0% coverage. Appears to be duplication. +STRG.43.1 aligns to STRG.10.1 with 89.5% identity and 99.3% coverage. Appears to be duplication. +STRG.43.1 aligns to STRG.7.1 with 90.7% identity and 100.0% coverage. Appears to be duplication. +STRG.17.1 aligns to mm9 coding transcript uc008zth.2 with 65.4% exonic identity +STRG.17.1 aligns to mm9 coding transcript NM_133900 with 65.4% exonic identity |
| b |
| diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.filtered_info.txt.sorted --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.filtered_info.txt.sorted Tue Jul 17 11:49:16 2018 -0400 |
| b |
| @@ -0,0 +1,49 @@ +STRG.10.1 aligns to STRG.43.1 with 89.5% identity and 99.3% coverage. Appears to be duplication. +STRG.10.1 aligns to STRG.7.1 with 90.1% identity and 98.9% coverage. Appears to be duplication. +STRG.11.1 transcript entirely within coding transcript NM_173666 +STRG.1.1 aligns to STRG.46.1 with 98.5% identity and 99.9% coverage. Appears to be duplication. +STRG.12.1 transcript entirely within coding transcript uc011dmq.2 +STRG.13.1 100.0% exonic overlap with coding transcript NM_005345 +STRG.14.1 100.0% exonic overlap with coding transcript uc003nxk.2 +STRG.15.2 aligns to STRG.22.1 with 99.4% identity and 100.0% coverage. Appears to be duplication. +STRG.15.2 aligns to STRG.6.1 with 97.0% identity and 100.0% coverage. Appears to be duplication. +STRG.16.1 100.0% exonic overlap with coding transcript NM_001003806 +STRG.17.1 aligns to mm9 coding transcript NM_133900 with 65.4% exonic identity +STRG.17.1 aligns to mm9 coding transcript uc008zth.2 with 65.4% exonic identity +STRG.18.1 100.0% exonic overlap with coding transcript uc003tzi.4 +STRG.19.1 200.0% exonic overlap with coding transcript uc003ubx.4 +STRG.20.1 99.8% exonic overlap with coding transcript NM_198085 +STRG.21.1 transcript entirely within coding transcript NM_001164750 +STRG.21.2 transcript entirely within coding transcript uc011leg.2 +STRG.2.1 aligns to STRG.47.1 with 98.6% identity and 99.9% coverage. Appears to be duplication. +STRG.22.1 aligns to STRG.15.2 with 99.4% identity and 100.0% coverage. Appears to be duplication. +STRG.22.1 aligns to STRG.6.1 with 97.1% identity and 100.0% coverage. Appears to be duplication. +STRG.24.1 32.7% exonic overlap with coding transcript uc001ocx.3 +STRG.26.1 100.0% exonic overlap with coding transcript uc001oiw.2 +STRG.27.1 100.0% exonic overlap with coding transcript uc001oja.3 +STRG.29.1 100.0% exonic overlap with coding transcript NM_001014449 +STRG.30.1 37.4% exonic overlap with coding transcript uc002fnn.2 +STRG.31.1 transcript entirely within coding transcript NM_000978 +STRG.31.2 transcript entirely within coding transcript uc002hqx.1 +STRG.31.3 71.4% exonic overlap with coding transcript uc002hqy.1 +STRG.3.1 aligns to STRG.48.1 with 98.2% identity and 99.9% coverage. Appears to be duplication. +STRG.32.1 40.2% exonic overlap with coding transcript uc002hrq.1 +STRG.33.1 97.7% exonic overlap with coding transcript NM_198993 +STRG.34.1 35.7% exonic overlap with coding transcript uc002hsq.3 +STRG.35.1 transcript entirely within coding transcript NM_001075099 +STRG.36.1 20.8% exonic overlap with coding transcript uc002iyw.4 +STRG.37.1 99.8% exonic overlap with coding transcript uc002klr.3 +STRG.38.1 transcript entirely within coding transcript NM_001003652 +STRG.39.1 32.6% exonic overlap with coding transcript NM_004152 +STRG.40.1 88.6% exonic overlap with coding transcript NM_002967 +STRG.41.1 99.6% exonic overlap with coding transcript NM_014649 +STRG.43.1 aligns to STRG.10.1 with 89.5% identity and 99.3% coverage. Appears to be duplication. +STRG.43.1 aligns to STRG.7.1 with 90.7% identity and 100.0% coverage. Appears to be duplication. +STRG.46.1 aligns to STRG.1.1 with 98.5% identity and 99.9% coverage. Appears to be duplication. +STRG.47.1 aligns to STRG.2.1 with 98.6% identity and 99.9% coverage. Appears to be duplication. +STRG.48.1 aligns to STRG.3.1 with 98.2% identity and 99.9% coverage. Appears to be duplication. +STRG.6.1 aligns to STRG.15.2 with 97.0% identity and 100.0% coverage. Appears to be duplication. +STRG.6.1 aligns to STRG.22.1 with 97.1% identity and 100.0% coverage. Appears to be duplication. +STRG.7.1 aligns to STRG.10.1 with 90.1% identity and 98.9% coverage. Appears to be duplication. +STRG.7.1 aligns to STRG.43.1 with 90.7% identity and 100.0% coverage. Appears to be duplication. +STRG.9.1 transcript entirely within coding transcript NM_020357 |
| b |
| diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.lncs.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.lncs.bed Tue Jul 17 11:49:16 2018 -0400 |
| b |
| @@ -0,0 +1,13 @@ +chrM 3306 4262 STRG.45.1 100.0 + 3306 4262 255,0,0 1 956 0 +chr13 82264045 82265207 STRG.28.1 100.0 + 82264045 82265207 255,0,0 1 1162 0 +chr11 65265232 65273940 STRG.25.1 100.0 + 65265232 65273940 255,0,0 1 8708 0 +chrM 1670 3229 STRG.44.1 100.0 + 1670 3229 255,0,0 1 1559 0 +chrM 10058 10404 STRG.50.1 100.0 + 10058 10404 255,0,0 1 346 0 +chrM 8294 8364 STRG.48.2 100.0 + 8294 8364 255,0,0 1 70 0 +chrX 108297360 108297792 STRG.42.1 100.0 - 108297360 108297792 255,0,0 1 432 0 +chrM 12336 14148 STRG.51.1 100.0 + 12336 14148 255,0,0 1 1812 0 +chr2 26901086 26901378 STRG.8.1 100.0 - 26901086 26901378 255,0,0 1 292 0 +chrM 14148 14673 STRG.52.1 100.0 - 14148 14673 255,0,0 1 525 0 +chr1 569075 569756 STRG.5.1 100.0 + 569075 569756 255,0,0 1 681 0 +chr10 23425852 23426590 STRG.23.1 100.0 + 23425852 23426590 255,0,0 1 738 0 +chrM 9206 9990 STRG.49.1 100.0 + 9206 9990 255,0,0 1 784 0 |
| b |
| diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.lncs.bed.sorted --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.lncs.bed.sorted Tue Jul 17 11:49:16 2018 -0400 |
| b |
| @@ -0,0 +1,13 @@ +chr10 23425852 23426590 STRG.23.1 100.0 + 23425852 23426590 255,0,0 1 738 0 +chr11 65265232 65273940 STRG.25.1 100.0 + 65265232 65273940 255,0,0 1 8708 0 +chr13 82264045 82265207 STRG.28.1 100.0 + 82264045 82265207 255,0,0 1 1162 0 +chr1 569075 569756 STRG.5.1 100.0 + 569075 569756 255,0,0 1 681 0 +chr2 26901086 26901378 STRG.8.1 100.0 - 26901086 26901378 255,0,0 1 292 0 +chrM 10058 10404 STRG.50.1 100.0 + 10058 10404 255,0,0 1 346 0 +chrM 12336 14148 STRG.51.1 100.0 + 12336 14148 255,0,0 1 1812 0 +chrM 14148 14673 STRG.52.1 100.0 - 14148 14673 255,0,0 1 525 0 +chrM 1670 3229 STRG.44.1 100.0 + 1670 3229 255,0,0 1 1559 0 +chrM 3306 4262 STRG.45.1 100.0 + 3306 4262 255,0,0 1 956 0 +chrM 8294 8364 STRG.48.2 100.0 + 8294 8364 255,0,0 1 70 0 +chrM 9206 9990 STRG.49.1 100.0 + 9206 9990 255,0,0 1 784 0 +chrX 108297360 108297792 STRG.42.1 100.0 - 108297360 108297792 255,0,0 1 432 0 |
| b |
| diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.lncs.info.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.lncs.info.txt Tue Jul 17 11:49:16 2018 -0400 |
| b |
| @@ -0,0 +1,13 @@ +STRG.45.1 TVAS5 intergenic +STRG.28.1 Unannotated intergenic +STRG.25.1 MALAT1 intergenic +STRG.44.1 TVAS5 intergenic +STRG.50.1 AD intergenic +STRG.48.2 OK/SW-cl.16 intergenic +STRG.42.1 Unannotated intergenic +STRG.51.1 MTND5 intergenic +STRG.8.1 Unannotated intergenic +STRG.52.1 JA760615 intergenic +STRG.5.1 Unannotated intergenic +STRG.23.1 Unannotated intergenic +STRG.49.1 OK/SW-cl.16 intergenic |
| b |
| diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.lncs.info.txt.sorted --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.lncs.info.txt.sorted Tue Jul 17 11:49:16 2018 -0400 |
| b |
| @@ -0,0 +1,13 @@ +STRG.23.1 Unannotated intergenic +STRG.25.1 MALAT1 intergenic +STRG.28.1 Unannotated intergenic +STRG.42.1 Unannotated intergenic +STRG.44.1 TVAS5 intergenic +STRG.45.1 TVAS5 intergenic +STRG.48.2 OK/SW-cl.16 intergenic +STRG.49.1 OK/SW-cl.16 intergenic +STRG.50.1 AD intergenic +STRG.51.1 MTND5 intergenic +STRG.5.1 Unannotated intergenic +STRG.52.1 JA760615 intergenic +STRG.8.1 Unannotated intergenic |
| b |
| diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.orfs.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.orfs.txt Tue Jul 17 11:49:16 2018 -0400 |
| b |
| @@ -0,0 +1,3 @@ +lnc lncName ortholog orthologName alignScore lengthLncOrf lengthOrthOrf kN kS kN\kS lncOrf orthOrf +STRG.25.1 MALAT1 uc008gfj.2 Malat1 455430 90 90 0.04 0.02 2.286 ATGTTTCGTTTGCCTCAGACAGGTATCTCTTCGTTATCAGAAGAGTTGCTTCATTTCATCTGGGAGCAGAAAACAGCAGGCAGCTGTTAA ATGTTTCGTTTGCCTCAGACAGGTTTCTCTTCATAAGCAGAAGAGTTGCTTCATTCCATCTCGGAGCAGGAAACAGCAGACTGCTGTTGA +STRG.25.1 MALAT1 cast.naive_gene.v2.1_1455.0_chr19 Malat1 455430 90 90 0.04 0.02 2.286 ATGTTTCGTTTGCCTCAGACAGGTATCTCTTCGTTATCAGAAGAGTTGCTTCATTTCATCTGGGAGCAGAAAACAGCAGGCAGCTGTTAA ATGTTTCGTTTGCCTCAGACAGGTTTCTCTTCATAAGCAGAAGAGTTGCTTCATTCCATCTCGGAGCAGGAAACAGCAGACTGCTGTTGA |
| b |
| diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.orthologs.top.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.orthologs.top.txt Tue Jul 17 11:49:16 2018 -0400 |
| b |
| @@ -0,0 +1,9 @@ +#lnc lncGeneSymbol ortholog orthologGeneSymbol alignScore exonID locusID indelRate(exon) indelRate(intron) lncExonsAligned orthExonsAligned spliceConserved spliceTotal category(hg19) category(mm9) +STRG.25.1 MALAT1 uc008gfj.2 Malat1 455430 0.63 0.63 0.049 NA 1, 1, 0.0 0 intergenic intergenic +STRG.5.1 Unannotated uc009vfa.1 Atpase6 281595 0.00 0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.52.1 JA760615 uc012hdm.1 BC071253 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.48.2 OK/SW-cl.16 uc009vez.1 Cox2 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.44.1 TVAS5 uc009vew.1 AK018753 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.49.1 OK/SW-cl.16 uc009vfa.1 Atpase6 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.45.1 TVAS5 uc009vew.1 AK018753 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.51.1 MTND5 uc009vfc.1 Cytb 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic |
| b |
| diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.orthologs.top.txt.sorted --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.orthologs.top.txt.sorted Tue Jul 17 11:49:16 2018 -0400 |
| b |
| @@ -0,0 +1,9 @@ +#lnc lncGeneSymbol ortholog orthologGeneSymbol alignScore exonID locusID indelRate(exon) indelRate(intron) lncExonsAligned orthExonsAligned spliceConserved spliceTotal category(hg19) category(mm9) +STRG.25.1 MALAT1 uc008gfj.2 Malat1 455430 0.63 0.63 0.049 NA 1, 1, 0.0 0 intergenic intergenic +STRG.44.1 TVAS5 uc009vew.1 AK018753 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.45.1 TVAS5 uc009vew.1 AK018753 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.48.2 OK/SW-cl.16 uc009vez.1 Cox2 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.49.1 OK/SW-cl.16 uc009vfa.1 Atpase6 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.51.1 MTND5 uc009vfc.1 Cytb 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.5.1 Unannotated uc009vfa.1 Atpase6 281595 0.00 0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.52.1 JA760615 uc012hdm.1 BC071253 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic |
| b |
| diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.orthologs.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.orthologs.txt Tue Jul 17 11:49:16 2018 -0400 |
| b |
| @@ -0,0 +1,10 @@ +#lnc lncGeneSymbol ortholog orthologGeneSymbol alignScore exonID locusID indelRate(exon) indelRate(intron) lncExonsAligned orthExonsAligned spliceConserved spliceTotal category(hg19) category(mm9) +STRG.52.1 JA760615 uc012hdm.1 BC071253 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.51.1 MTND5 uc009vfc.1 Cytb 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.5.1 Unannotated uc009vfa.1 Atpase6 281595 0.00 0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.49.1 OK/SW-cl.16 uc009vfa.1 Atpase6 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.48.2 OK/SW-cl.16 uc009vez.1 Cox2 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.45.1 TVAS5 uc009vew.1 AK018753 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.44.1 TVAS5 uc009vew.1 AK018753 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.25.1 MALAT1 uc008gfj.2 Malat1 455430 0.63 0.63 0.049 NA 1, 1, 0.0 0 intergenic intergenic +STRG.25.1 MALAT1 cast.naive_gene.v2.1_1455.0_chr19 Malat1 455430 0.60 0.64 0.048 NA 1, 1,2, 0.0 0 intergenic intergenic |
| b |
| diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.orthologs.txt.sorted --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.orthologs.txt.sorted Tue Jul 17 11:49:16 2018 -0400 |
| b |
| @@ -0,0 +1,10 @@ +#lnc lncGeneSymbol ortholog orthologGeneSymbol alignScore exonID locusID indelRate(exon) indelRate(intron) lncExonsAligned orthExonsAligned spliceConserved spliceTotal category(hg19) category(mm9) +STRG.25.1 MALAT1 cast.naive_gene.v2.1_1455.0_chr19 Malat1 455430 0.60 0.64 0.048 NA 1, 1,2, 0.0 0 intergenic intergenic +STRG.25.1 MALAT1 uc008gfj.2 Malat1 455430 0.63 0.63 0.049 NA 1, 1, 0.0 0 intergenic intergenic +STRG.44.1 TVAS5 uc009vew.1 AK018753 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.45.1 TVAS5 uc009vew.1 AK018753 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.48.2 OK/SW-cl.16 uc009vez.1 Cox2 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.49.1 OK/SW-cl.16 uc009vfa.1 Atpase6 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.51.1 MTND5 uc009vfc.1 Cytb 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.5.1 Unannotated uc009vfa.1 Atpase6 281595 0.00 0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.52.1 JA760615 uc012hdm.1 BC071253 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic |
| b |
| diff -r 000000000000 -r a940c4a36a43 tool-data/ctat_lncrna_annotations.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/ctat_lncrna_annotations.loc.sample Tue Jul 17 11:49:16 2018 -0400 |
| b |
| @@ -0,0 +1,15 @@ +# This file lists the locations of CTAT lncrna annotations +# Usually there will only be one index, but it is concievable +# that there could be multiple annotations. +# This file format is as follows +# (white space characters are TAB characters): +# +#<value> <name> <path> +# value is a unique id +# name is the display name +# path is the directory where the index files are stored +# +#ctat_lncrna_annotations.loc could look like: +# +#slncky_annotations CTAT_lncrna_annotations /path/to/lncrna/annotations +# |
| b |
| diff -r 000000000000 -r a940c4a36a43 tool_data_table_conf.xml.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Tue Jul 17 11:49:16 2018 -0400 |
| b |
| @@ -0,0 +1,14 @@ +<tables> + <table name="ctat_genome_resource_libs" comment_char="#" allow_duplicate_entries="False"> + <columns>value, name, path</columns> + <file path="tool-data/ctat_genome_resource_libs.loc" /> + </table> + <table name="ctat_centrifuge_indexes" comment_char="#" allow_duplicate_entries="False"> + <columns>value, name, path</columns> + <file path="tool-data/ctat_centrifuge_indexes.loc" /> + </table> + <table name="ctat_lncrna_annotations" comment_char="#" allow_duplicate_entries="False"> + <columns>value, name, path</columns> + <file path="tool-data/ctat_lncrna_annotations.loc" /> + </table> +</tables> |