Next changeset 1:1930eb870dca (2021-12-03) |
Commit message:
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/megan commit 2a49a6cdc1b4d37ab30eb85b8c658ccf9f5a0644" |
added:
blast2lca.xml macros.xml test-data/13-1941-6_S4_L001_R1_600000.fastq.gz test-data/13-1941-6_S4_L001_R2_600000.fastq.gz test-data/blast_R1.txt test-data/blast_R2.txt test-data/contaminants.txt test-data/kegg_output.txt test-data/taxonomy_output.txt |
b |
diff -r 000000000000 -r ad69d2a05c3c blast2lca.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/blast2lca.xml Wed Nov 24 21:52:36 2021 +0000 |
[ |
@@ -0,0 +1,143 @@ +<tool id="megan_blast2lca" name="MEGAN Blast2LCA: apply LCA alignment" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> + <description>to produce a taxonomic classification</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="bio_tools"/> + <expand macro="requirements"/> + <command detect_errors="exit_code"><![CDATA[ +#import re + +#if $blast_input.is_of_type('daa'): + #set blast_format = 'DAA' +#else if $blast_input.is_of_type('txt'): + #set blast_format = 'BlastText' +#else if $blast_input.is_of_type('blastxml'): + #set blast_format = 'BlastXML' +#else if $blast_input.is_of_type('tabular'): + #set blast_format = 'BlastTab' +#else if $blast_input.is_of_type('sam'): + #set blast_format = 'SAM' +#end if +#set blast_ext = '.' + $blast_format +#if $blast_input.ext.endswith('.gz'): + #set blast_ext = $blast_ext + '.gz' +#end if + +#set blast_input_identifier = 'blast_input' + $blast_ext +ln -s '${blast_input}' '${blast_input_identifier}' && + +blast2lca + --input '${blast_input_identifier}' + --format '${blast_format}' + --mode '${mode}' + $advanced_options.showRanks + $advanced_options.officialRanksOnly + $advanced_options.showTaxIds + --minScore $advanced_options.minScore + --maxExpected $advanced_options.maxExpected + --topPercent $advanced_options.topPercent + --minPercentIdentity $advanced_options.minPercentIdentity + --maxKeggPerRead $advanced_options.maxKeggPerRead + $advanced_options.applyTopPercentKegg + $advanced_options.parseTaxonNames + #if $advanced_options.mapDB: + --mapDB '$advanced_options.mapDB' + #end if + #if $advanced_options.acc2taxa: + --acc2taxa '$advanced_options.acc2taxa' + #end if + #if $advanced_options.syn2taxa: + --syn2taxa '$advanced_options.syn2taxa' + #end if + #if $advanced_options.acc2kegg: + --acc2kegg '$advanced_options.acc2kegg' + #end if + #if $advanced_options.syn2kegg: + --syn2kegg '$advanced_options.syn2kegg' + #end if + $advanced_options.firstWordIsAccession + #if str($advanced_options.accessionTags) != '': + --accessionTags '$advanced_options.maccessionTags' + #end if + #if $advanced_options.kegg: + --kegg + --keggOutput '$kegg_output' + #end if + --output '${taxonomy_output}' +]]></command> + <inputs> + <param name="blast_input" argument="--input" type="data" format="daa,blastxml,sam,tabular,txt" label="Blast file"/> + <param argument="--mode" type="select" label="Blast mode"> + <expand macro="blast_mode_options"/> + </param> + <section name="advanced_options" title="Advanced options" expanded="false"> + <param argument="--kegg" type="boolean" truevalue="--kegg" falsevalue="" checked="false" label="Map reads to KEGG KOs?"/> + <param argument="--showRanks" type="boolean" truevalue="--showRanks" falsevalue="" checked="true" label="Show taxonomic ranks?"/> + <param argument="--officialRanksOnly" type="boolean" truevalue="--officialRanksOnly" falsevalue="" checked="true" label="Report only taxa that have an official rank?"/> + <param argument="--showTaxIds" type="boolean" truevalue="--showTaxIds" falsevalue="" checked="false" label="Report taxon ids rather than taxon names?"/> + <expand macro="common_blast_params"/> + <param argument="--maxKeggPerRead" type="integer" value="4" label="Maximum number of KEGG assignments to report for a read"/> + <param argument="--applyTopPercentKegg" type="boolean" truevalue="--applyTopPercentKegg" falsevalue="" checked="true" label="Apply top percent filter in KEGG KO analysis?"/> + <param argument="--parseTaxonNames" type="boolean" truevalue="--parseTaxonNames" falsevalue="" checked="true" label="Apply top percent filter in KEGG KO analysis?"/> + <param argument="--mapDB" type="data" format="sqlite" optional="true" label="MEGAN mapping db"/> + <param argument="--acc2taxa" type="data" format="sqlite" optional="true" label="Accession-to-Taxonomy mapping file"/> + <param argument="--syn2taxa" type="data" format="sqlite" optional="true" label="Synonyms-to-Taxonomy mapping file"/> + <param argument="--acc2kegg" type="data" format="sqlite" optional="true" label="Accession-to-KEGG mapping file"/> + <param argument="--syn2kegg" type="data" format="sqlite" optional="true" label="Synonyms-to-KEGG mapping file"/> + <param argument="--firstWordIsAccession" type="boolean" truevalue="--firstWordIsAccession" falsevalue="" checked="true" label="First word in reference header is accession number?" help="Set to true for NCBI-nr downloaded Sep 2016 or later"/> + <param argument="--accessionTags" type="text" optional="true" label="List of accession tags" help="Specify a space-separated list of tags (e.g., 'gb|' 'ref|')"> + <expand macro="sanitize_query" validinitial="string.ascii_letters,string.punctuation"/> + </param> + </section> + </inputs> + <outputs> + <data name="taxonomy_output" format="txt"/> + <data name="kegg_output" format="txt" label="${tool.name} on ${on_string} (KEGG)"> + <filter>advanced_options['kegg']</filter> + </data> + </outputs> + <tests> + <test expect_num_outputs="2"> + <param name="blast_input" value="blast_R1.txt" ftype="txt"/> + <param name="mode" value="BlastN"/> + <section name="advanced_options"> + <param name="kegg" value="true"/> + </section> + <output name="taxonomy_output" file="taxonomy_output.txt" ftype="txt"/> + <output name="kegg_output" file="kegg_output.txt" ftype="txt"/> + </test> + </tests> + <help> +**What it does** + +Applies the LCA alignment to reads and can also perform KEGG classification. The input is a BLAST file or something similar. +This wrapper supports the following formats for the input Blast file. The SAM, Tabular and Text formats can be produced by +The Galaxy MALT Analyzer tool. When these formats are used, this tool will apply the SAM, BlastText and BlastTab format options +required by MEGAN. + + * **Direct Access Archive (DAA)** - a proprietary file format developed by PowerISO Computing for disk image files + * **BlastXML** - XML output from Blast + * **Sequence Alignment/Map (SAM)** - a tab-delimited text format consisting of a header section, which is optional, and an alignment section + * **Tabular** - information presented in the form of a table with rows and columns + * **Text** - plain text format + +The tool produces a text file for the LCA alignment. + +If the option to Map reads to KEGG KOs is selected, an additional text file containing the KEGG classification is produced. +The KEGG database provides a collection of metabolic pathways and other pathways, but due to KEGG licensing restrictions, the +Community Edition of KEGG (used by this tool) ships with an early 2011 version of the KEGG classification, so KEGG pathways +cannot be viewed in the putput. + +The KEGG classification can be displayed as a tree. Genes are mapped onto so-called KO groups and these are present in one or +more pathways. The MEGAN program will attempt to map each read onto a gene that has a valid KO identifier and thus, to one or +more pathways. + +To perform this analysis, MEGAN uses a mapping of GI numbers to KO groups. Hence, if a KEGG-based analysis is desired, then +the database that is used in the BLAST alignment must contain GI numbers. + </help> + <citations> + <citation type="doi">https://doi.org/10.1101/050559</citation> + </citations> +</tool> + |
b |
diff -r 000000000000 -r ad69d2a05c3c macros.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Wed Nov 24 21:52:36 2021 +0000 |
b |
@@ -0,0 +1,71 @@ +<macros> + <token name="@TOOL_VERSION@">6.21.7</token> + <token name="@VERSION_SUFFIX@">0</token> + <token name="@PROFILE@">20.09</token> + <xml name="bio_tools"> + <xrefs> + <xref type="bio.tools">megan</xref> + </xrefs> + </xml> + <xml name="requirements"> + <requirements> + <requirement type="package" version="@TOOL_VERSION@">megan</requirement> + </requirements> + </xml> + <macro name="input_type_cond"> + <conditional name="input_type_cond"> + <param name="input_type" type="select" label="Choose the category of the reads files to be analyzed"> + <option value="single" selected="true">Single dataset</option> + <option value="pair">Dataset pair</option> + <option value="paired">List of dataset pairs</option> + </param> + <when value="single"> + <param name="read1" type="data" format="fasta,fasta.gz,fastqsanger.gz,fastqsanger" label="Forward read file" help="This read file should be the one used by Blast to generate the Blast file below"/> + <param name="blast1" type="data" format="daa,blastxml,sam,tabular,txt" label="Output file of Blast on input forward read file"/> + </when> + <when value="pair"> + <param name="read1" type="data" format="fasta,fasta.gz,fastqsanger.gz,fastqsanger" label="Forward read file" help="This read file should be the one used by Blast to generate the Blast file below"/> + <param name="read2" type="data" format="fasta,fasta.gz,fastqsanger.gz,fastqsanger" label="Reverse read file" help="This read file should be the one used by Blast to generate the Blast file below"/> + <param argument="--pairedSuffixLength" type="integer" value="0" label="Length of name suffix used to distinguish read names" help="Use 0 if read and mate have the same name"/> + <param name="blast1" type="data" format="daa,blastxml,sam,tabular,txt" label="Output file of Blast on input forward read file"/> + <param name="blast2" type="data" format="daa,blastxml,sam,tabular,txt" label="Output file of Blast on input reverse read file"/> + </when> + <when value="paired"> + <param name="reads_collection" type="data_collection" format="fasta,fasta.gz,fastqsanger,fastqsanger.gz" collection_type="paired" label="Collection of paired read files"/> + <param argument="--pairedSuffixLength" type="integer" value="0" label="Length of name suffix used to distinguish read names" help="Use 0 if read and mate have the same name"/> + <param name="blast1" type="data" format="daa,blastxml,sam,tabular,txt" label="Blast file for forward read"/> + <param name="blast2" type="data" format="daa,blastxml,sam,tabular,txt" label="Blast file for reverse read"/> + </when> + </conditional> + </macro> + <macro name="blast_mode_options"> + <option value="Unknown" selected="true">Unknown</option> + <option value="BlastN">BlastN</option> + <option value="BlastP">BlastP</option> + <option value="BlastX">BlastX</option> + <option value="Classifier">Classifier</option> + </macro> + <macro name="common_blast_params"> + <param argument="--minScore" type="float" value="50.0" label="Minimum score"/> + <param argument="--maxExpected" type="float" value="0.01" label="Maximum expected"/> + <param argument="--minPercentIdentity" type="float" value="0.0" min="0.0" max="100.0" label="Minimum percent identity"/> + <param argument="--topPercent" type="float" value="10.0" min="0.0" max="100.0" label="Top percent"/> + </macro> + <xml name="sanitize_query" token_validinitial="string.printable"> + <sanitizer> + <valid initial="@VALIDINITIAL@"> + <remove value="'" /> + <add value="|" /> + </valid> + <mapping initial="none"> + <add source="'" target="'"'"'" /> + </mapping> + </sanitizer> + </xml> + <xml name="citations"> + <citations> + <citation type="doi">10.1101/gr.5969107</citation> + </citations> + </xml> +</macros> + |
b |
diff -r 000000000000 -r ad69d2a05c3c test-data/13-1941-6_S4_L001_R1_600000.fastq.gz |
b |
Binary file test-data/13-1941-6_S4_L001_R1_600000.fastq.gz has changed |
b |
diff -r 000000000000 -r ad69d2a05c3c test-data/13-1941-6_S4_L001_R2_600000.fastq.gz |
b |
Binary file test-data/13-1941-6_S4_L001_R2_600000.fastq.gz has changed |
b |
diff -r 000000000000 -r ad69d2a05c3c test-data/blast_R1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/blast_R1.txt Wed Nov 24 21:52:36 2021 +0000 |
b |
@@ -0,0 +1,404 @@ +BLASTN output produced by MALT + + +Query= XXXXXXXXXX:7:1101:1582:1835#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1610:1859#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1743:1871#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1536:1878#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2990:100153#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1624:1906#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1666:1926#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2921:100163#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1513:1929#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2759:100170#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1708:1937#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2981:100211#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1688:1946#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2767:100225#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1536:1959#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2797:100234#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1552:1976#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1748:1978#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2779:100239#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1593:1980#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2946:100242#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1987:1781#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3046:100006#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1900:1788#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3214:100027#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1848:1879#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3237:100032#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3027:100049#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1756:1891#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3238:100065#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1915:1901#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3198:100082#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1964:1931#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3088:100091#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1840:1948#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3105:100094#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1958:1952#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3190:100106#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1993:1999#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3117:100110#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2159:1798#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3147:100111#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2152:1838#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3065:100152#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2180:1843#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3154:100159#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2125:1861#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3198:100173#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2076:1911#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3166:100190#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2196:1920#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3225:100207#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2115:1927#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3019:100219#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2179:1937#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3202:100230#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2149:1945#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3211:100242#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2169:1964#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3168:100244#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3005:100246#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2313:1789#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3253:100014#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2361:1794#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2337:1794#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3284:100039#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2477:1795#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3310:100056#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2355:1821#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3420:100060#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2418:1834#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3267:100061#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2378:1838#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3416:100083#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2481:1853#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3411:100111#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3258:100128#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2252:1856#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3428:100129#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2394:1871#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3387:100138#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2269:1904#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3444:100163#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2259:1943#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3371:100179#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2371:1957#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3311:100186#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2394:1961#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3438:100192#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2333:1962#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3479:100209#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2459:1990#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3417:100210#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2372:1994#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3452:100214#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2677:1830#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3354:100219#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2603:1846#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3600:100019#/1 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2535:1848#/1 + +***** No hits found ****** + +EOF |
b |
diff -r 000000000000 -r ad69d2a05c3c test-data/blast_R2.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/blast_R2.txt Wed Nov 24 21:52:36 2021 +0000 |
b |
@@ -0,0 +1,404 @@ +BLASTN output produced by MALT + + +Query= XXXXXXXXXX:7:1101:1582:1835#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1610:1859#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1743:1871#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1536:1878#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2990:100153#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1624:1906#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1666:1926#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2921:100163#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1513:1929#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2759:100170#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1708:1937#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2981:100211#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1688:1946#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2767:100225#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1536:1959#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2797:100234#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1552:1976#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1748:1978#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2779:100239#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1593:1980#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2946:100242#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1987:1781#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3046:100006#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1900:1788#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3214:100027#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1848:1879#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3237:100032#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3027:100049#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1756:1891#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3238:100065#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1915:1901#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3198:100082#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1964:1931#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3088:100091#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1840:1948#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3105:100094#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1958:1952#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3190:100106#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:1993:1999#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3117:100110#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2159:1798#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3147:100111#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2152:1838#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3065:100152#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2180:1843#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3154:100159#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2125:1861#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3198:100173#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2076:1911#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3166:100190#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2196:1920#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3225:100207#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2115:1927#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3019:100219#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2179:1937#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3202:100230#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2149:1945#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3211:100242#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2169:1964#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3168:100244#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3005:100246#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2313:1789#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3253:100014#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2361:1794#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2337:1794#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3284:100039#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2477:1795#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3310:100056#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2355:1821#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3420:100060#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2418:1834#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3267:100061#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2378:1838#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3416:100083#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2481:1853#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3411:100111#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3258:100128#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2252:1856#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3428:100129#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2394:1871#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3387:100138#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2269:1904#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3444:100163#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2259:1943#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3371:100179#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2371:1957#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3311:100186#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2394:1961#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3438:100192#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2333:1962#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3479:100209#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2459:1990#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3417:100210#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2372:1994#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3452:100214#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2677:1830#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3354:100219#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2603:1846#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:3600:100019#/2 + +***** No hits found ****** + +Query= XXXXXXXXXX:7:1101:2535:1848#/2 + +***** No hits found ****** + +EOF |
b |
diff -r 000000000000 -r ad69d2a05c3c test-data/contaminants.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/contaminants.txt Wed Nov 24 21:52:36 2021 +0000 |
b |
@@ -0,0 +1,12 @@ +Illumina Single End Adapter 1 ACACTCTTTCCCTACACGACGCTGTTCCATCT +Illumina Single End Adapter 2 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT +Illumina Single End PCR Primer 1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT +Illumina Single End PCR Primer 2 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT +Illumina Single End Sequencing Primer ACACTCTTTCCCTACACGACGCTCTTCCGATCT + +Illumina Paired End Adapter 1 ACACTCTTTCCCTACACGACGCTCTTCCGATCT +Illumina Paired End Adapter 2 CTCGGCATTCCTGCTGAACCGCTCTTCCGATCT +Illumina Paried End PCR Primer 1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT +Illumina Paired End PCR Primer 2 CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT +Illumina Paried End Sequencing Primer 1 ACACTCTTTCCCTACACGACGCTCTTCCGATCT +Illumina Paired End Sequencing Primer 2 CGGTCTCGGCATTCCTACTGAACCGCTCTTCCGATCT |
b |
diff -r 000000000000 -r ad69d2a05c3c test-data/kegg_output.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/kegg_output.txt Wed Nov 24 21:52:36 2021 +0000 |
b |
@@ -0,0 +1,100 @@ +XXXXXXXXXX:7:1101:1582:1835#/1; ; +XXXXXXXXXX:7:1101:1610:1859#/1; ; +XXXXXXXXXX:7:1101:1743:1871#/1; ; +XXXXXXXXXX:7:1101:1536:1878#/1; ; +XXXXXXXXXX:7:1101:2990:100153#/1; ; +XXXXXXXXXX:7:1101:1624:1906#/1; ; +XXXXXXXXXX:7:1101:1666:1926#/1; ; +XXXXXXXXXX:7:1101:2921:100163#/1; ; +XXXXXXXXXX:7:1101:1513:1929#/1; ; +XXXXXXXXXX:7:1101:2759:100170#/1; ; +XXXXXXXXXX:7:1101:1708:1937#/1; ; +XXXXXXXXXX:7:1101:2981:100211#/1; ; +XXXXXXXXXX:7:1101:1688:1946#/1; ; +XXXXXXXXXX:7:1101:2767:100225#/1; ; +XXXXXXXXXX:7:1101:1536:1959#/1; ; +XXXXXXXXXX:7:1101:2797:100234#/1; ; +XXXXXXXXXX:7:1101:1552:1976#/1; ; +XXXXXXXXXX:7:1101:1748:1978#/1; ; +XXXXXXXXXX:7:1101:2779:100239#/1; ; +XXXXXXXXXX:7:1101:1593:1980#/1; ; +XXXXXXXXXX:7:1101:2946:100242#/1; ; +XXXXXXXXXX:7:1101:1987:1781#/1; ; +XXXXXXXXXX:7:1101:3046:100006#/1; ; +XXXXXXXXXX:7:1101:1900:1788#/1; ; +XXXXXXXXXX:7:1101:3214:100027#/1; ; +XXXXXXXXXX:7:1101:1848:1879#/1; ; +XXXXXXXXXX:7:1101:3237:100032#/1; ; +XXXXXXXXXX:7:1101:3027:100049#/1; ; +XXXXXXXXXX:7:1101:1756:1891#/1; ; +XXXXXXXXXX:7:1101:3238:100065#/1; ; +XXXXXXXXXX:7:1101:1915:1901#/1; ; +XXXXXXXXXX:7:1101:3198:100082#/1; ; +XXXXXXXXXX:7:1101:1964:1931#/1; ; +XXXXXXXXXX:7:1101:3088:100091#/1; ; +XXXXXXXXXX:7:1101:1840:1948#/1; ; +XXXXXXXXXX:7:1101:3105:100094#/1; ; +XXXXXXXXXX:7:1101:1958:1952#/1; ; +XXXXXXXXXX:7:1101:3190:100106#/1; ; +XXXXXXXXXX:7:1101:1993:1999#/1; ; +XXXXXXXXXX:7:1101:3117:100110#/1; ; +XXXXXXXXXX:7:1101:2159:1798#/1; ; +XXXXXXXXXX:7:1101:3147:100111#/1; ; +XXXXXXXXXX:7:1101:2152:1838#/1; ; +XXXXXXXXXX:7:1101:3065:100152#/1; ; +XXXXXXXXXX:7:1101:2180:1843#/1; ; +XXXXXXXXXX:7:1101:3154:100159#/1; ; +XXXXXXXXXX:7:1101:2125:1861#/1; ; +XXXXXXXXXX:7:1101:3198:100173#/1; ; +XXXXXXXXXX:7:1101:2076:1911#/1; ; +XXXXXXXXXX:7:1101:3166:100190#/1; ; +XXXXXXXXXX:7:1101:2196:1920#/1; ; +XXXXXXXXXX:7:1101:3225:100207#/1; ; +XXXXXXXXXX:7:1101:2115:1927#/1; ; +XXXXXXXXXX:7:1101:3019:100219#/1; ; +XXXXXXXXXX:7:1101:2179:1937#/1; ; +XXXXXXXXXX:7:1101:3202:100230#/1; ; +XXXXXXXXXX:7:1101:2149:1945#/1; ; +XXXXXXXXXX:7:1101:3211:100242#/1; ; +XXXXXXXXXX:7:1101:2169:1964#/1; ; +XXXXXXXXXX:7:1101:3168:100244#/1; ; +XXXXXXXXXX:7:1101:3005:100246#/1; ; +XXXXXXXXXX:7:1101:2313:1789#/1; ; +XXXXXXXXXX:7:1101:3253:100014#/1; ; +XXXXXXXXXX:7:1101:2361:1794#/1; ; +XXXXXXXXXX:7:1101:2337:1794#/1; ; +XXXXXXXXXX:7:1101:3284:100039#/1; ; +XXXXXXXXXX:7:1101:2477:1795#/1; ; +XXXXXXXXXX:7:1101:3310:100056#/1; ; +XXXXXXXXXX:7:1101:2355:1821#/1; ; +XXXXXXXXXX:7:1101:3420:100060#/1; ; +XXXXXXXXXX:7:1101:2418:1834#/1; ; +XXXXXXXXXX:7:1101:3267:100061#/1; ; +XXXXXXXXXX:7:1101:2378:1838#/1; ; +XXXXXXXXXX:7:1101:3416:100083#/1; ; +XXXXXXXXXX:7:1101:2481:1853#/1; ; +XXXXXXXXXX:7:1101:3411:100111#/1; ; +XXXXXXXXXX:7:1101:3258:100128#/1; ; +XXXXXXXXXX:7:1101:2252:1856#/1; ; +XXXXXXXXXX:7:1101:3428:100129#/1; ; +XXXXXXXXXX:7:1101:2394:1871#/1; ; +XXXXXXXXXX:7:1101:3387:100138#/1; ; +XXXXXXXXXX:7:1101:2269:1904#/1; ; +XXXXXXXXXX:7:1101:3444:100163#/1; ; +XXXXXXXXXX:7:1101:2259:1943#/1; ; +XXXXXXXXXX:7:1101:3371:100179#/1; ; +XXXXXXXXXX:7:1101:2371:1957#/1; ; +XXXXXXXXXX:7:1101:3311:100186#/1; ; +XXXXXXXXXX:7:1101:2394:1961#/1; ; +XXXXXXXXXX:7:1101:3438:100192#/1; ; +XXXXXXXXXX:7:1101:2333:1962#/1; ; +XXXXXXXXXX:7:1101:3479:100209#/1; ; +XXXXXXXXXX:7:1101:2459:1990#/1; ; +XXXXXXXXXX:7:1101:3417:100210#/1; ; +XXXXXXXXXX:7:1101:2372:1994#/1; ; +XXXXXXXXXX:7:1101:3452:100214#/1; ; +XXXXXXXXXX:7:1101:2677:1830#/1; ; +XXXXXXXXXX:7:1101:3354:100219#/1; ; +XXXXXXXXXX:7:1101:2603:1846#/1; ; +XXXXXXXXXX:7:1101:3600:100019#/1; ; +XXXXXXXXXX:7:1101:2535:1848#/1; ; |
b |
diff -r 000000000000 -r ad69d2a05c3c test-data/taxonomy_output.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/taxonomy_output.txt Wed Nov 24 21:52:36 2021 +0000 |
b |
@@ -0,0 +1,100 @@ +XXXXXXXXXX:7:1101:1582:1835#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1610:1859#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1743:1871#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1536:1878#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2990:100153#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1624:1906#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1666:1926#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2921:100163#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1513:1929#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2759:100170#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1708:1937#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2981:100211#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1688:1946#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2767:100225#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1536:1959#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2797:100234#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1552:1976#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1748:1978#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2779:100239#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1593:1980#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2946:100242#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1987:1781#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3046:100006#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1900:1788#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3214:100027#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1848:1879#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3237:100032#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3027:100049#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1756:1891#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3238:100065#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1915:1901#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3198:100082#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1964:1931#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3088:100091#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1840:1948#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3105:100094#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1958:1952#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3190:100106#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:1993:1999#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3117:100110#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2159:1798#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3147:100111#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2152:1838#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3065:100152#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2180:1843#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3154:100159#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2125:1861#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3198:100173#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2076:1911#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3166:100190#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2196:1920#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3225:100207#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2115:1927#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3019:100219#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2179:1937#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3202:100230#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2149:1945#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3211:100242#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2169:1964#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3168:100244#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3005:100246#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2313:1789#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3253:100014#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2361:1794#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2337:1794#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3284:100039#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2477:1795#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3310:100056#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2355:1821#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3420:100060#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2418:1834#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3267:100061#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2378:1838#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3416:100083#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2481:1853#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3411:100111#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3258:100128#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2252:1856#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3428:100129#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2394:1871#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3387:100138#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2269:1904#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3444:100163#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2259:1943#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3371:100179#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2371:1957#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3311:100186#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2394:1961#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3438:100192#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2333:1962#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3479:100209#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2459:1990#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3417:100210#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2372:1994#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3452:100214#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2677:1830#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3354:100219#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2603:1846#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:3600:100019#/1; ; No hits; 100; +XXXXXXXXXX:7:1101:2535:1848#/1; ; No hits; 100; |