| Previous changeset 1:8192b4014977 (2014-06-03) Next changeset 3:85263dc18cec (2018-05-08) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_clipper commit a1517c9d22029095120643bbe2c8fa53754dd2b7 |
|
modified:
fastx_clipper.xml test-data/fastx_clipper1a.out tool_dependencies.xml |
| b |
| diff -r 8192b4014977 -r bdf1ce174e39 fastx_clipper.xml --- a/fastx_clipper.xml Tue Jun 03 14:54:53 2014 -0400 +++ b/fastx_clipper.xml Wed Nov 11 12:38:51 2015 -0500 |
| [ |
| @@ -1,80 +1,77 @@ -<tool id="cshl_fastx_clipper" name="Clip" version="1.0.1" > - <description>adapter sequences</description> - <requirements> - <requirement type="package" version="0.0.13">fastx_toolkit</requirement> - </requirements> - <command> - zcat -f $input | fastx_clipper -l $minlength -a $clip_source.clip_sequence -d $keepdelta -o $output -v $KEEP_N $DISCARD_OPTIONS +<tool id="cshl_fastx_clipper" name="Clip" version="1.0.1"> + <description>adapter sequences</description> + <requirements> + <requirement type="package" version="0.0.13">fastx_toolkit</requirement> + </requirements> + <command> +<![CDATA[ +zcat -f < '$input' | fastx_clipper -l $minlength -a '$clip_source.clip_sequence' -d $keepdelta -o '$output' -v $KEEP_N $DISCARD_OPTIONS #if $input.ext == "fastqsanger": - -Q 33 + -Q 33 #end if - </command> - - <inputs> - <param format="fasta,fastqsanger,fastqsolexa,fastqillumina" name="input" type="data" label="Library to clip" /> - - <param name="minlength" size="4" type="integer" value="15"> - <label>Minimum sequence length (after clipping, sequences shorter than this length will be discarded)</label> - </param> +]]> + </command> - <conditional name="clip_source"> - <param name="clip_source_list" type="select" label="Source"> - <option value="prebuilt" selected="true">Standard (select from the list below)</option> - <option value="user">Enter custom sequence</option> - </param> + <inputs> + <param format="fasta,fastqsanger,fastqsolexa,fastqillumina" name="input" type="data" label="Library to clip" /> - <when value="user"> - <param name="clip_sequence" size="30" label="Enter custom clipping sequence" type="text" value="AATTGGCC" /> - </when> + <param name="minlength" type="integer" value="15"> + <label>Minimum sequence length (after clipping, sequences shorter than this length will be discarded)</label> + </param> - <when value="prebuilt"> - <param name="clip_sequence" type="select" label="Choose Adapter"> - <options from_file="fastx_clipper_sequences.txt"> - <column name="name" index="1"/> - <column name="value" index="0"/> - </options> - </param> - </when> - </conditional> + <conditional name="clip_source"> + <param name="clip_source_list" type="select" label="Source"> + <option value="prebuilt" selected="true">Standard (select from the list below)</option> + <option value="user">Enter custom sequence</option> + </param> + + <when value="user"> + <param name="clip_sequence" label="Enter custom clipping sequence" type="text" value="AATTGGCC" /> + </when> - <param name="keepdelta" size="2" type="integer" value="0"> - <label>enter non-zero value to keep the adapter sequence and x bases that follow it</label> - <help>use this for hairpin barcoding. keep at 0 unless you know what you're doing.</help> - </param> + <when value="prebuilt"> + <param name="clip_sequence" type="select" label="Choose Adapter"> + <options from_file="fastx_clipper_sequences.txt"> + <column name="name" index="1"/> + <column name="value" index="0"/> + </options> + </param> + </when> + </conditional> - <param name="KEEP_N" type="select" label="Discard sequences with unknown (N) bases"> - <option value="">Yes</option> - <option value="-n">No</option> - </param> + <param name="keepdelta" type="integer" value="0"> + <label>enter non-zero value to keep the adapter sequence and x bases that follow it</label> + <help>use this for hairpin barcoding. keep at 0 unless you know what you're doing.</help> + </param> - <param name="DISCARD_OPTIONS" type="select" label="Output options"> - <option value="-c">Output only clipped sequences (i.e. sequences which contained the adapter)</option> - <option value="-C">Output only non-clipped sequences (i.e. sequences which did not contained the adapter)</option> - <option value="">Output both clipped and non-clipped sequences</option> - </param> + <param name="KEEP_N" type="select" label="Discard sequences with unknown (N) bases"> + <option value="">Yes</option> + <option value="-n">No</option> + </param> - </inputs> - <!-- - #functional test with param value starting with - fails. - --> - <tests> - <test> - <param name="input" value="fastx_clipper1.fastq" ftype="fastqsolexa"/> - <param name="maxmismatches" value="2" /> - <param name="minlength" value="15" /> - <param name="clip_source_list" value="user" /> - <param name="clip_sequence" value="CAATTGGTTAATCCCCCTATATA" /> - <param name="keepdelta" value="0" /> - <param name="KEEP_N" value="+-n" /> - <param name="DISCARD_OPTIONS" value="+-c" /> - <output name="output" file="fastx_clipper1a.out" /> - </test> - </tests> - <outputs> - <data format="input" name="output" metadata_source="input" /> - </outputs> - -<help> + <param name="DISCARD_OPTIONS" type="select" label="Output options"> + <option value="-c">Output only clipped sequences (i.e. sequences which contained the adapter)</option> + <option value="-C">Output only non-clipped sequences (i.e. sequences which did not contained the adapter)</option> + <option value="">Output both clipped and non-clipped sequences</option> + </param> + </inputs> + <outputs> + <data format_source="input" name="output" metadata_source="input" /> + </outputs> + <tests> + <test> + <param name="input" value="fastx_clipper1.fastq" ftype="fastqsolexa"/> + <param name="maxmismatches" value="2" /> + <param name="minlength" value="15" /> + <param name="clip_source_list" value="user" /> + <param name="clip_sequence" value="CAATTGGTTAATCCCCCTATATA" /> + <param name="keepdelta" value="0" /> + <param name="KEEP_N" value="-n" /> + <param name="DISCARD_OPTIONS" value="-c" /> + <output name="output" ftype="fastqsolexa" file="fastx_clipper1a.out" /> + </test> + </tests> + <help> **What it does** This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file. @@ -84,34 +81,21 @@ **Clipping Illustration:** -.. image:: fastx_clipper_illustration.png - - - - - - - +.. image:: fastx_clipper_illustration.png **Clipping Example:** -.. image:: fastx_clipper_example.png +.. image:: fastx_clipper_example.png - - **In the above example:** * Sequence no. 1 was discarded since it wasn't clipped (i.e. didn't contain the adapter sequence). (**Output** parameter). * Sequence no. 5 was discarded --- it's length (after clipping) was shorter than 15 nt (**Minimum Sequence Length** parameter). - - - ------ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. .. __: http://hannonlab.cshl.edu/fastx_toolkit/ - -</help> + </help> </tool> |
| b |
| diff -r 8192b4014977 -r bdf1ce174e39 test-data/fastx_clipper1a.out --- a/test-data/fastx_clipper1a.out Tue Jun 03 14:54:53 2014 -0400 +++ b/test-data/fastx_clipper1a.out Wed Nov 11 12:38:51 2015 -0500 |
| b |
| @@ -2,18 +2,6 @@ GTACGCATGACCGAACCCCCCNCCCCC +CSHL_3_FC042AGLLWW:1:2:7:203 aab^V^aU]`aa^aZaaabbXEZabaa -@CSHL_3_FC042AGLLWW:1:2:7:169 -GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCC -+CSHL_3_FC042AGLLWW:1:2:7:169 -a_M^a\Uaaa_M_aaaaaaaaaaaaaaaV\ZUGUU -@CSHL_3_FC042AGLLWW:1:2:7:1819 -AATTCAAACCACCCCAACCCACACACAGAGATA -+CSHL_3_FC042AGLLWW:1:2:7:1819 -a\\QVVVLaaLOEXUWUUEKUULEMUEUUKULI -@CSHL_3_FC042AGLLWW:1:2:7:1875 -GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCC -+CSHL_3_FC042AGLLWW:1:2:7:1875 -aaaaaaaaaXUXXEXaaaaa`_ZaaaaaaaaaXEX @CSHL_3_FC042AGLLWW:1:2:8:250 TGCCGCGCACACTGATG +CSHL_3_FC042AGLLWW:1:2:8:250 |
| b |
| diff -r 8192b4014977 -r bdf1ce174e39 tool_dependencies.xml --- a/tool_dependencies.xml Tue Jun 03 14:54:53 2014 -0400 +++ b/tool_dependencies.xml Wed Nov 11 12:38:51 2015 -0500 |
| b |
| @@ -1,6 +1,6 @@ <?xml version="1.0"?> <tool_dependency> <package name="fastx_toolkit" version="0.0.13"> - <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="http://toolshed.g2.bx.psu.edu" /> + <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" /> </package> </tool_dependency> |