| Previous changeset 1:4351ee79c942 (2016-11-14) Next changeset 3:f68b43be32d7 (2018-06-11) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6 |
|
modified:
macros.xml nhmmscan.xml |
|
added:
test-data/MADE1.nhmmscan_out test-data/MADE1.nhmmscan_out.aliscoresout test-data/MADE1.nhmmscan_out.dfamtblout test-data/MADE1.nhmmscan_out.tblout test-data/nhmmer.out.dfamtblout test-data/nhmmer.out.tblout |
|
removed:
tool_dependencies.xml |
| b |
| diff -r 4351ee79c942 -r c3075b7fdbdd macros.xml --- a/macros.xml Mon Nov 14 15:12:05 2016 -0500 +++ b/macros.xml Sat Apr 07 03:49:11 2018 -0400 |
| [ |
| b'@@ -2,11 +2,11 @@\n <macros>\n <xml name="requirements">\n <requirements>\n- <requirement type="package" version="3.1b2">hmmer</requirement>\n+ <requirement type="package" version="@TOOL_VERSION@">hmmer</requirement>\n <yield/>\n </requirements>\n </xml>\n- <token name="@WRAPPER_VERSION@">0.1</token>\n+ <token name="@TOOL_VERSION@">3.1b2</token>\n <xml name="stdio">\n <stdio>\n <!-- Anything other than zero is an error -->\n@@ -21,64 +21,64 @@\n -E $E\n --domE $domE\n \n-#if $T:\n--T $T\n+#if str($T):\n+ -T $T\n #end if\n \n-#if $domT:\n---domT $domT\n+#if str($domT):\n+ --domT $domT\n #end if\n \n-#if $incE:\n---incE $incE\n+#if str($incE):\n+ --incE $incE\n #end if\n \n-#if $incT:\n---incT $incT\n+#if str($incdomE):\n+ --incdomE $incdomE\n #end if\n \n-#if $incdomE:\n---incdomE $incdomE\n+#if str($incT):\n+ --incT $incT\n #end if\n \n-#if $incdomT:\n---incdomT $incdomT\n+#if str($incdomT):\n+ --incdomT $incdomT\n #end if\n </token>\n <xml name="thresholds_xml">\n <!-- Options controlling reporting thresholds -->\n- <param name="E" label="report sequences <= this E-Value threshold in output" help="(-E)" value="10.0" type="float" min="0"/>\n- <param name="domE" label="report domains <= this E-Value threshold in output" help="(--domE)" value="10.0" type="float" min="0"/>\n- <param name="T" label="report sequences >= this score threshold in output" help="(-T)" type="float" optional="True"/>\n- <param name="domT" label="report domains >= this score threshold in output" help="(--domT)" type="float" optional="True"/>\n+ <param argument="-E" type="float" min="0" value="10.0" label="report sequences <= this E-Value threshold in output" />\n+ <param argument="--domE" type="float" min="0" value="10.0" label="report domains <= this E-Value threshold in output" />\n+ <param argument="-T" type="float" optional="true" label="report sequences >= this score threshold in output" />\n+ <param argument="--domT" type="float" optional="true" label="report domains >= this score threshold in output" />\n <!-- Options controlling inclusion (significance) thresholds -->\n- <param name="incE" label="consider sequences <= this E-Value threshold as significant" help="(--incE)" type="float" optional="True"/>\n- <param name="incdomE" label="consider domains <= this E-Value threshold as significant" help="(--incdomE)" type="float" optional="True"/>\n- <param name="incT" label="consider sequences >= this score threshold as significant" help="(--incT)" type="float" optional="True"/>\n- <param name="incdomT" label="consider domains >= this score threshold as significant" help="(--incdomT)" type="float" optional="True"/>\n+ <param argument="--incE" type="float" optional="true" label="consider sequences <= this E-Value threshold as significant" />\n+ <param argument="--incdomE" type="float" optional="true" label="consider domains <= this E-Value threshold as significant" />\n+ <param argument="--incT" type="float" optional="true" label="consider sequences >= this score threshold as significant" />\n+ <param argument="--incdomT" type="float" optional="true" label="consider domains >= this score threshold as significant" />\n </xml>\n <token name="@THRESHOLDS_NODOM@">\n -E $E\n \n-#if $T:\n--T $T\n+#if str($T):\n+ -T $T\n #end if\n \n-#if $incE:\n---incE $incE\n+#if str($incE):\n+ --incE $incE\n #end if\n \n-#if $incT:\n---incT $incT\n+#if str($incT):\n+ --incT $incT\n #end if\n </token>\n <xml name="thresholds_nodom">\n <!-- Options controlling reporting thresholds -->\n- <param name="E" label="report sequences <= this E-Value threshold in output" help="(-E)" value="10.0" type="float" min="0"/>\n- <param name="T" label="report sequences >= this score threshold in output" help="(-T)" type="float" optional="True"/>\n+ <param argument="-E" type="float" min="0" value="10.0" label="report sequences <= this E-Value threshold in output" />\n+ <param argument="'..b'abel="use profile\'s TC gathering cutoffs to set all thresholding" />\n </xml>\n <token name="@MCSS@">\n --$mcs.model_construction_strategy_select\n \n #if $mcs.model_construction_strategy_select == "fast":\n---symfrac $mcs.symfrac\n+ --symfrac $mcs.symfrac\n #end if\n-\n+#if str($fragthresh)\n+ --fragthresh $fragthresh\n+#end if\n </token>\n <xml name="mcss">\n <!-- Alternative model construction strategies -->\n@@ -353,12 +353,11 @@\n <option value="hand">Manual construction (requires reference annotation) (--hand)</option>\n </param>\n <when value="fast">\n- <param name="symfrac" value="0.5" type="float" label="Sets sym fraction controlling --fast construction"/>\n+ <param argument="--symfrac" value="0.5" type="float" label="Sets sym fraction controlling --fast construction"/>\n </when>\n <when value="hand"></when>\n </conditional>\n- <param name="fragthresh" label="Fraction of alignment length, under which sequences are excluded" help="HMMER infers fragments if the sequence length L is less than or equal to a fraction x times the alignment length in columns (--fragthresh)" value="0.5" optional="True" type="float" />\n-\n+ <param argument="--fragthresh" type="float" value="0.5" optional="true" label="Fraction of alignment length, under which sequences are excluded" help="HMMER infers fragments if the sequence length L is less than or equal to a fraction x times the alignment length in columns" />\n </xml>\n <token name="@PRIOR@">\n $aps_select\n@@ -376,32 +375,32 @@\n </citations>\n </xml>\n <token name="@LENGTHS@">\n-#if $w_beta:\n---w_beta $w_beta\n+#if str($w_beta):\n+ --w_beta $w_beta\n #end if\n \n-#if $w_length:\n---w_length $w_length\n+#if str($w_length):\n+ --w_length $w_length\n #end if\n-\n </token>\n <xml name="lengths">\n- <param name="w_beta" label="Tail mass at which window length is determined"\n- help="(--w_beta)" optional="True" type="float"/>\n- <param name="w_length" label="Window Length"\n- help="(--w_length)" optional="True" type="integer" />\n+ <param argument="--w_beta" type="float" optional="true" label="Tail mass at which window length is determined" />\n+ <param argument="--w_length" type="integer" optional="true" label="Window Length" />\n </xml>\n- <token name="@INPUTHMMCHOICE@">\n+ <token name="@INPUTHMMCHOICE@"><![CDATA[\n #if $input_hmm_conditional.input_hmm_source == "history":\n- \'$input_hmm_conditional.hmmfile\'\n+ #set $input_hmm_filename = "localref.hmm"\n+ ln -s \'${input_hmm_conditional.hmmfile}\' \'${input_hmm_filename}\' &&\n+ ## "Press" database\n+ hmmpress \'${input_hmm_filename}\' &&\n #else:\n- \'$input_hmm_conditional.index.fields.db_path\'\n+ #set $input_hmm_filename = str($input_hmm_conditional.index.fields.db_path)\n #end if\n- </token>\n+ ]]></token>\n <xml name="input_hmm_choice">\n <conditional name="input_hmm_conditional">\n <param name="input_hmm_source" type="select" label="Use a built-in HMM model database or own from your history" >\n- <option value="indexed" selected="True">Use a built-in HMM model database</option>\n+ <option value="indexed" selected="true">Use a built-in HMM model database</option>\n <option value="history">Use a HMM database from history</option>\n </param>\n <when value="indexed">\n@@ -413,12 +412,12 @@\n </param>\n </when>\n <when value="history">\n- <param name="hmmfile" type="data" label="HMM model" format="hmm2,hmm3"/>\n+ <param name="hmmfile" type="data" format="hmm2,hmm3" label="HMM model" />\n </when> <!-- history -->\n </conditional> <!-- input_hmm_conditional -->\n </xml>\n <xml name="input_hmm">\n- <param name="hmmfile" type="data" label="HMM model" format="hmm2,hmm3"/>\n+ <param name="hmmfile" type="data" format="hmm2,hmm3" label="HMM model" />\n </xml>\n <xml name="input_msa">\n <param name="msafile" type="data" label="Multiple Sequence Alignment" format="stockholm,clustal,fasta"\n' |
| b |
| diff -r 4351ee79c942 -r c3075b7fdbdd nhmmscan.xml --- a/nhmmscan.xml Mon Nov 14 15:12:05 2016 -0500 +++ b/nhmmscan.xml Sat Apr 07 03:49:11 2018 -0400 |
| [ |
| @@ -1,5 +1,5 @@ <?xml version="1.0"?> -<tool id="hmmer_nhmmscan" name="nhmmscan" version="@WRAPPER_VERSION@.0"> +<tool id="hmmer_nhmmscan" name="nhmmscan" version="@TOOL_VERSION@"> <description>search DNA sequence(s) against a DNA profile database</description> <macros> <import>macros.xml</import> @@ -7,8 +7,7 @@ <expand macro="requirements"/> <expand macro="stdio"/> <command><![CDATA[ -hmmpress $hmmfile; - +@INPUTHMMCHOICE@ nhmmscan @OFORMAT_WITH_OPTS_N@ @@ -24,12 +23,12 @@ @CPU@ @SEED@ -$hmmfile -$seqfile -> $output - ]]></command> +'$input_hmm_filename' +'$seqfile' +> '$output' + ]]></command> <inputs> - <expand macro="input_hmm" /> + <expand macro="input_hmm_choice" /> <!-- todo use Galaxy features like data libraries/data tables/??? --> <param name="seqfile" type="data" format="fasta" label="Sequence file"/> <expand macro="oformat_with_opts_n"/> @@ -37,37 +36,38 @@ <expand macro="cut"/> <expand macro="accel_heur_xml"/> - <param name="B1" type="integer" label="window length for biased-composition modifier (MSV)" help="(--B1)" value="110"/> - <param name="B2" type="integer" label="window length for biased-composition modifier (Vit)" help="(--B2)" value="240"/> - <param name="B3" type="integer" label="window length for biased-composition modifier (Fwd)" help="(--B3)" value="1000"/> + <param argument="--B1" type="integer" value="110" label="window length for biased-composition modifier (MSV)" /> + <param argument="--B2" type="integer" value="240" label="window length for biased-composition modifier (Vit)" /> + <param argument="--B3" type="integer" value="1000" label="window length for biased-composition modifier (Fwd)" /> <expand macro="adv_opts"/> <expand macro="lengths"/> <expand macro="seed"/> </inputs> <outputs> - <data format="txt" name="output" label="HMM matches of $seqfile.name in $hmmfile.name"/> + <data name="output" format="txt" label="HMM matches of $seqfile.name against the profile database"/> - <data format="txt" name="tblout" label="Table of per-sequence hits from HMM matches of $seqfile.name in $hmmfile.name"> - <filter>'tblout' in str(oformat)</filter> + <data name="tblout" format="txt" label="Table of per-sequence hits from HMM matches of $seqfile.name against the profile database"> + <filter>oformat and 'tblout' in oformat</filter> </data> - <data format="txt" name="dfamtblout" label="Table of per-sequence/per-domain hits from HMM matches of $seqfile.name in $hmmfile.name"> - <filter>'pfamtblout' in str(oformat)</filter> + <data name="dfamtblout" format="txt" label="Table of per-sequence/per-domain hits from HMM matches of $seqfile.name against the profile database"> + <filter>oformat and 'dfamtblout' in oformat</filter> </data> - <data format="txt" name="aliscoresout" label="Scores for positional matches of $seqfile.name in $hmmfile.name"> - <filter>'aliscoresout' in str(oformat)</filter> + <data name="aliscoresout" format="txt" label="Scores for positional matches of $seqfile.name against the profile database"> + <filter>oformat and 'aliscoresout' in oformat</filter> </data> </outputs> <tests> <test> - <param name="hmmfile" value="MADE1.hmm"/> + <param name="input_hmm_conditional|input_hmm_source" value="history"/> + <param name="input_hmm_conditional|hmmfile" value="MADE1.hmm"/> <param name="seqfile" value="dna_target.fa"/> <expand macro="oformat_test" /> <expand macro="seed_test" /> - <output name="output" file="MADE1.out" lines_diff="140"/> - <output name="tblout" file="MADE1.out.tblout" lines_diff="30"/> - <output name="domtblout" file="MADE1.out.domtblout" lines_diff="30"/> - <output name="pfamtblout" file="MADE1.out.pfamtblout" lines_diff="36"/> + <output name="output" file="MADE1.nhmmscan_out" lines_diff="12" /> + <output name="tblout" file="MADE1.nhmmscan_out.tblout" lines_diff="10" /> + <output name="dfamtblout" file="MADE1.nhmmscan_out.dfamtblout" /> + <output name="aliscoresout" file="MADE1.nhmmscan_out.aliscoresout" lines_diff="10" /> </test> </tests> <help><![CDATA[ |
| b |
| diff -r 4351ee79c942 -r c3075b7fdbdd test-data/MADE1.nhmmscan_out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/MADE1.nhmmscan_out Sat Apr 07 03:49:11 2018 -0400 |
| [ |
| @@ -0,0 +1,109 @@ +# nhmmscan :: search DNA sequence(s) against a DNA profile database +# HMMER 3.1b2 (February 2015); http://hmmer.org/ +# Copyright (C) 2015 Howard Hughes Medical Institute. +# Freely distributed under the GNU General Public License (GPLv3). +# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - +# query sequence file: /tmp/tmpc_c3amjg/files/000/dataset_2.dat +# target HMM database: /tmp/tmpc_c3amjg/files/000/dataset_1.dat +# per-seq hits tabular output: /tmp/tmpc_c3amjg/files/000/dataset_4.dat +# hits output in Dfam format: /tmp/tmpc_c3amjg/files/000/dataset_5.dat +# max ASCII text line length: unlimited +# Vit filter P threshold: <= 0.001 +# Fwd filter P threshold: <= 1e-05 +# random number seed set to: 4 +# number of worker threads: 1 +# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - + +Query: humanchr1/239220001-239550000 [L=330000] +Scores for complete hit: + E-value score bias Model start end Description + ------- ------ ----- -------- ----- ----- ----------- + 1.2e-10 38.6 7.4 MADE1 302390 302466 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + 7.8e-08 29.6 8.3 MADE1 174456 174498 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + 1.2e-07 28.9 6.0 MADE1 302466 302390 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + 7.2e-06 23.3 7.0 MADE1 174493 174456 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + ------ inclusion threshold ------ + 1.4 6.3 7.0 MADE1 304073 304104 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + + +Annotation for each hit (and alignments): +>> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 38.6 7.4 1.2e-10 4 80 .] 302390 302466 .. 302387 302466 .. 80 0.87 + + Alignment: + score: 38.6 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80 + ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa + humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466 + 899******************************************955533.443..334.4689***********99986 PP + +>> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 29.6 8.3 7.8e-08 1 43 [. 174456 174498 .. 174456 174518 .. 80 0.92 + + Alignment: + score: 29.6 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 + ttaggtt gtgcaaaagtaattg ggtttttg cattactttt + humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 + 589************************************9975 PP + +>> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 28.9 6.0 1.2e-07 1 77 [. 302466 302390 .. 302466 302387 .. 80 0.74 + + Alignment: + score: 28.9 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77 + ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc + humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390 + 68999999999999998................5666777776222222222222222268****************************9998 PP + +>> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 23.3 7.0 7.2e-06 43 80 .] 174493 174456 .. 174513 174456 .. 80 0.91 + + Alignment: + score: 23.3 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 + taatg caaaaacc caattacttttgcac aacctaa + humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 + 689********************************985 PP + +>> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ? 6.3 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 80 0.85 + + Alignment: + score: 6.3 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 41 tttaatggcaaaaaccgcaattacttttgcac 72 + tt a tgg aaaaa ca tta ttttgca + humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104 + 455779************************86 PP + + + +Internal pipeline statistics summary: +------------------------------------- +Query sequence(s): 1 (660000 residues searched) +Target model(s): 1 (80 nodes) +Residues passing SSV filter: 61794 (0.0936); expected (0.02) +Residues passing bias filter: 46199 (0.07); expected (0.02) +Residues passing Vit filter: 2752 (0.00417); expected (0.001) +Residues passing Fwd filter: 2526 (0.00383); expected (1e-05) +Total number of hits: 5 (0.000405) +# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02 +# Mc/sec: 2640.00 +// +[ok] |
| b |
| diff -r 4351ee79c942 -r c3075b7fdbdd test-data/MADE1.nhmmscan_out.aliscoresout --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/MADE1.nhmmscan_out.aliscoresout Sat Apr 07 03:49:11 2018 -0400 |
| [ |
| @@ -0,0 +1,17 @@ +# target name accession query name accession hmmfrom hmm to alifrom ali to envfrom env to modlen strand E-value score bias description of target +#------------------- ---------- -------------------- ---------- ------- ------- ------- ------- ------- ------- ------- ------ --------- ------ ----- --------------------- +MADE1 DF0000629.2 humanchr1/239220001-239550000 - 4 80 302390 302466 302387 302466 80 + 1.2e-10 38.6 7.4 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 - 1 43 174456 174498 174456 174518 80 + 7.8e-08 29.6 8.3 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 - 1 77 302466 302390 302466 302387 80 - 1.2e-07 28.9 6.0 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 - 43 80 174493 174456 174513 174456 80 - 7.2e-06 23.3 7.0 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 - 41 72 304073 304104 304053 304109 80 + 1.4 6.3 7.0 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +# +# Program: hmmscan +# Version: 3.1b2 (February 2015) +# Pipeline mode: SCAN +# Query file: /tmp/tmpc_c3amjg/files/000/dataset_2.dat +# Target file: /tmp/tmpc_c3amjg/files/000/dataset_1.dat +# Option settings: nhmmscan --tblout /tmp/tmpc_c3amjg/files/000/dataset_4.dat --dfamtblout /tmp/tmpc_c3amjg/files/000/dataset_5.dat --notextw -E 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --B1 110 --B2 240 --B3 1000 --cpu 1 /tmp/tmpc_c3amjg/files/000/dataset_1.dat /tmp/tmpc_c3amjg/files/000/dataset_2.dat +# Current dir: /tmp/tmpc_c3amjg/job_working_directory/000/3/working +# Date: Wed Apr 4 16:58:45 2018 +# [ok] |
| b |
| diff -r 4351ee79c942 -r c3075b7fdbdd test-data/MADE1.nhmmscan_out.dfamtblout --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/MADE1.nhmmscan_out.dfamtblout Sat Apr 07 03:49:11 2018 -0400 |
| b |
| @@ -0,0 +1,10 @@ +# hit scores +# ---------- +# +# target name acc query name bits e-value bias hmm-st hmm-en strand ali-st ali-en env-st env-en modlen description of target +# ------------------- ------------------- ------------------- ------ --------- ----- ------- ------- ------ ------- ------- ------- ------- ------- --------------------- +MADE1 DF0000629.2 humanchr1/239220001-239550000 38.6 1.2e-10 7.4 4 80 + 302390 302466 302387 302466 80 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 29.6 7.8e-08 8.3 1 43 + 174456 174498 174456 174518 80 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 28.9 1.2e-07 6.0 1 77 - 302466 302390 302466 302387 80 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 23.3 7.2e-06 7.0 43 80 - 174493 174456 174513 174456 80 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 6.3 1.4 7.0 41 72 + 304073 304104 304053 304109 80 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
| b |
| diff -r 4351ee79c942 -r c3075b7fdbdd test-data/MADE1.nhmmscan_out.tblout --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/MADE1.nhmmscan_out.tblout Sat Apr 07 03:49:11 2018 -0400 |
| [ |
| @@ -0,0 +1,17 @@ +# target name accession query name accession hmmfrom hmm to alifrom ali to envfrom env to modlen strand E-value score bias description of target +#------------------- ---------- -------------------- ---------- ------- ------- ------- ------- ------- ------- ------- ------ --------- ------ ----- --------------------- +MADE1 DF0000629.2 humanchr1/239220001-239550000 - 4 80 302390 302466 302387 302466 80 + 1.2e-10 38.6 7.4 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 - 1 43 174456 174498 174456 174518 80 + 7.8e-08 29.6 8.3 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 - 1 77 302466 302390 302466 302387 80 - 1.2e-07 28.9 6.0 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 - 43 80 174493 174456 174513 174456 80 - 7.2e-06 23.3 7.0 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 - 41 72 304073 304104 304053 304109 80 + 1.4 6.3 7.0 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +# +# Program: hmmscan +# Version: 3.1b2 (February 2015) +# Pipeline mode: SCAN +# Query file: /tmp/tmpc_c3amjg/files/000/dataset_2.dat +# Target file: /tmp/tmpc_c3amjg/files/000/dataset_1.dat +# Option settings: nhmmscan --tblout /tmp/tmpc_c3amjg/files/000/dataset_4.dat --dfamtblout /tmp/tmpc_c3amjg/files/000/dataset_5.dat --notextw -E 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --B1 110 --B2 240 --B3 1000 --cpu 1 /tmp/tmpc_c3amjg/files/000/dataset_1.dat /tmp/tmpc_c3amjg/files/000/dataset_2.dat +# Current dir: /tmp/tmpc_c3amjg/job_working_directory/000/3/working +# Date: Wed Apr 4 16:58:45 2018 +# [ok] |
| b |
| diff -r 4351ee79c942 -r c3075b7fdbdd test-data/nhmmer.out.dfamtblout --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/nhmmer.out.dfamtblout Sat Apr 07 03:49:11 2018 -0400 |
| [ |
| @@ -0,0 +1,17 @@ +# target name accession query name accession hmmfrom hmm to alifrom ali to envfrom env to sq len strand E-value score bias description of target +# ------------------- ---------- -------------------- ---------- ------- ------- ------- ------- ------- ------- ------- ------ --------- ------ ----- --------------------- +humanchr1/239220001-239550000 - MADE1 DF0000629.2 4 80 302390 302466 302387 302466 330000 + 1.2e-10 38.6 7.4 - +humanchr1/239220001-239550000 - MADE1 DF0000629.2 1 43 174456 174498 174456 174518 330000 + 7.8e-08 29.6 8.3 - +humanchr1/239220001-239550000 - MADE1 DF0000629.2 1 77 302466 302390 302466 302387 330000 - 1.2e-07 28.9 6.0 - +humanchr1/239220001-239550000 - MADE1 DF0000629.2 43 80 174493 174456 174513 174456 330000 - 7.2e-06 23.3 7.0 - +humanchr1/239220001-239550000 - MADE1 DF0000629.2 41 72 304073 304104 304053 304109 330000 + 1.4 6.3 7.0 - +# +# Program: nhmmer +# Version: 3.1b2 (February 2015) +# Pipeline mode: SEARCH +# Query file: /tmp/tmpnpsbd_6p/files/000/dataset_1.dat +# Target file: /tmp/tmpnpsbd_6p/files/000/dataset_2.dat +# Option settings: nhmmer --tblout /tmp/tmpnpsbd_6p/files/000/dataset_4.dat --dfamtblout None --notextw -E 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --dna --seed 4 --cpu 1 /tmp/tmpnpsbd_6p/files/000/dataset_1.dat /tmp/tmpnpsbd_6p/files/000/dataset_2.dat +# Current dir: /tmp/tmpnpsbd_6p/job_working_directory/000/3/working +# Date: Fri Apr 6 16:39:46 2018 +# [ok] |
| b |
| diff -r 4351ee79c942 -r c3075b7fdbdd test-data/nhmmer.out.tblout --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/nhmmer.out.tblout Sat Apr 07 03:49:11 2018 -0400 |
| [ |
| @@ -0,0 +1,17 @@ +# target name accession query name accession hmmfrom hmm to alifrom ali to envfrom env to sq len strand E-value score bias description of target +# ------------------- ---------- -------------------- ---------- ------- ------- ------- ------- ------- ------- ------- ------ --------- ------ ----- --------------------- +humanchr1/239220001-239550000 - MADE1 DF0000629.2 4 80 302390 302466 302387 302466 330000 + 1.2e-10 38.6 7.4 - +humanchr1/239220001-239550000 - MADE1 DF0000629.2 1 43 174456 174498 174456 174518 330000 + 7.8e-08 29.6 8.3 - +humanchr1/239220001-239550000 - MADE1 DF0000629.2 1 77 302466 302390 302466 302387 330000 - 1.2e-07 28.9 6.0 - +humanchr1/239220001-239550000 - MADE1 DF0000629.2 43 80 174493 174456 174513 174456 330000 - 7.2e-06 23.3 7.0 - +humanchr1/239220001-239550000 - MADE1 DF0000629.2 41 72 304073 304104 304053 304109 330000 + 1.4 6.3 7.0 - +# +# Program: nhmmer +# Version: 3.1b2 (February 2015) +# Pipeline mode: SEARCH +# Query file: /tmp/tmpnpsbd_6p/files/000/dataset_1.dat +# Target file: /tmp/tmpnpsbd_6p/files/000/dataset_2.dat +# Option settings: nhmmer --tblout /tmp/tmpnpsbd_6p/files/000/dataset_4.dat --dfamtblout None --notextw -E 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --dna --seed 4 --cpu 1 /tmp/tmpnpsbd_6p/files/000/dataset_1.dat /tmp/tmpnpsbd_6p/files/000/dataset_2.dat +# Current dir: /tmp/tmpnpsbd_6p/job_working_directory/000/3/working +# Date: Fri Apr 6 16:39:46 2018 +# [ok] |
| b |
| diff -r 4351ee79c942 -r c3075b7fdbdd tool_dependencies.xml --- a/tool_dependencies.xml Mon Nov 14 15:12:05 2016 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| b |
| @@ -1,6 +0,0 @@ -<?xml version="1.0"?> -<tool_dependency> - <package name="hmmer" version="3.1b2"> - <repository changeset_revision="2a1881410dc9" name="package_hmmer_3_1b2" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> - </package> -</tool_dependency> |