| Previous changeset 5:bb13650e8115 (2021-02-05) |
|
Commit message:
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/humann2 commit 8d953926efdf23d8c3fb8719341dff51a55a92f2" |
|
modified:
humann2.xml test-data/input_sequences.fasta |
|
added:
test-data/input_sequences.fastq.gz |
| b |
| diff -r bb13650e8115 -r cda49fede0c2 humann2.xml --- a/humann2.xml Fri Feb 05 18:28:51 2021 +0000 +++ b/humann2.xml Sun Mar 28 07:01:10 2021 +0000 |
| b |
| @@ -1,4 +1,4 @@ -<tool id="humann2" name="HUMAnN2" version="@WRAPPER_VERSION@.2"> +<tool id="humann2" name="HUMAnN2" version="@WRAPPER_VERSION@.3"> <description>to profile presence/absence and abundance of microbial pathways and gene families</description> <macros> <import>humann2_macros.xml</import> @@ -50,8 +50,28 @@ #end if #end if +#if $input.ext.startswith("fasta") + #set ext="fasta" +#else if $input.ext.startswith("fastq") + #set ext="fastq" +#else if $input.ext.endswith("bam") + #set ext="bam" +#else if $input.ext == 'sam' + #set ext="sam" +#else if $input.ext == 'biom1' + #set ext="biom" +#else + >&2 "unknown extension $input.ext" + exit 1; +#end if + +#if $input.ext.endswith(".gz") + #set ext+=".gz" +#end if + humann2 --input '$input' + --input-format $ext -o 'output' $bypass.bypass_prescreen $bypass.bypass_nucleotide_index @@ -111,7 +131,7 @@ $adv.remove_column_description_output ]]></command> <inputs> - <param argument="--input" type="data" format="fastq,fasta,sam,bam,biom1" label="Input sequence file"/> + <param argument="--input" type="data" format="fastq,fastq.gz,fasta,fasta.gz,sam,bam,biom1" label="Input sequence file"/> <section name="bypass" title="Options to bypass some steps" expanded="False"> <param name="bypass_prescreen" argument="--bypass-prescreen" type="boolean" truevalue="--bypass-prescreen" falsevalue="" checked="false" label="Bypass the prescreen step and run on the full ChocoPhlAn database?"/> <param name="bypass_nucleotide_index" argument="--bypass-nucleotide-index" type="boolean" truevalue="--bypass-nucleotide-index" falsevalue="" checked="false" label="Bypass the nucleotide index step and run on the indexed ChocoPhlAn database?"/> @@ -283,7 +303,7 @@ </output> </test> <test> - <param name="input" value="input_sequences.fasta"/> + <param name="input" value="input_sequences.fastq.gz"/> <param name="bypass_prescreen" value=""/> <param name="bypass_nucleotide_index" value=""/> <param name="bypass_translated_search" value=""/> |
| b |
| diff -r bb13650e8115 -r cda49fede0c2 test-data/input_sequences.fasta --- a/test-data/input_sequences.fasta Fri Feb 05 18:28:51 2021 +0000 +++ b/test-data/input_sequences.fasta Sun Mar 28 07:01:10 2021 +0000 |
| b |
| @@ -75,7 +75,8 @@ >r495|637000026.fna|898444|898595|_from_ |NC_004663_Bacteroides_thetaiotaomicron_VPI-5482,_c|_ln166_#0/1 GTAACTGGAGTATCTTACAAAAGACTGAAAAGACAATTTCTCTTACAATATTCCTGTTACTCTTTATCCTTGGAGTATCCATTGGCTCTAATAGCCTGATTGTGAATAATCTCGGTAAGTTTGGATGGCAGGCGATCATTCTTGCCGTATC >r497|641736196.fna|48795|48946|_from_ |NZ_ABFZ02000020_Bacteroides_stercoris_ATCC_43183,|_ln354_#0/1 -TTGCCATCCCGCTCCCGTGCAAGGACTCCACACCTTTAAGATTCTGTCGAGCCACGGCAAGTTCCGATTGCAAAGAACTCAATTCGACCGAACGTATATCTACCATCCTTTTACCTTTTTCTGCATAATCGCCAAGTGAAAAGTAGCTTTT>r2|637000026.fna|5753889|5754040|_from_ |NC_004663_Bacteroides_thetaiotaomicron_VPI-5482,_c|_ln383_#0/1 +TTGCCATCCCGCTCCCGTGCAAGGACTCCACACCTTTAAGATTCTGTCGAGCCACGGCAAGTTCCGATTGCAAAGAACTCAATTCGACCGAACGTATATCTACCATCCTTTTACCTTTTTCTGCATAATCGCCAAGTGAAAAGTAGCTTTT +>r2|637000026.fna|5753889|5754040|_from_ |NC_004663_Bacteroides_thetaiotaomicron_VPI-5482,_c|_ln383_#0/1 CTCCGTCCGCTGGTAGAACGTCTGGTAGAAGCTCAAAAAGCATTGGCAACCAAATACCTTTCCGAAGCCAAACGACTGATTGCCTCCAACGACAAGAAGGAAGTGGAAGAAGGATTCCTTGCCCTTTATCGTAGCCACAAGTGTCTTCCGA >r3|637000026.fna|1749333|1749484|_from_ |NC_004663_Bacteroides_thetaiotaomicron_VPI-5482,_c|_ln165_#0/1 AAGTAAAAGTCTACACACAGGAAGGAACGATAATGGAAAGTACGATTGAAGTAAATCGTCCGATGGAGATAGCAGGATGGAAAATTTATCAGCTTAGTTATGATGAGTCGAAAGGTCGCTGGAGCGATATCAGTGTCTTTGAGCTGGTTCG |
| b |
| diff -r bb13650e8115 -r cda49fede0c2 test-data/input_sequences.fastq.gz |
| b |
| Binary file test-data/input_sequences.fastq.gz has changed |