| Next changeset 1:01585d091036 (2025-05-07) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/main/tools/kaiju commit 59064c06143fdc7d7b17178e46911ba1009cd32e |
|
added:
kaiju-mergeOutputs.xml macros.xml test-data/kaiju-taxnames.out test-data/kaiju-test-db/database.fmi test-data/kaiju-test-db/names.dmp test-data/kaiju-test-db/nodes.dmp test-data/kaiju.loc test-data/kaiju.out test-data/kaiju2krona.out test-data/kaiju2table.out test-data/kaijux.out test-data/query.fa tool-data/kaiju.loc.sample tool_data_table_conf.xml.sample tool_data_table_conf.xml.test |
| b |
| diff -r 000000000000 -r cdc8a98ed4fc kaiju-mergeOutputs.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/kaiju-mergeOutputs.xml Tue Apr 22 14:03:00 2025 +0000 |
| [ |
| @@ -0,0 +1,66 @@ +<tool id="kaiju_mergeoutputs" name="kaiju-mergeOutputs" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@" license="MIT"> + <description></description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="xrefs"/> + <expand macro="requirements"/> + <command detect_errors="exit_code"><![CDATA[ + sort -k2,2 '$kaiju_table' > kaiju.out.sort && + sort -k2,2 '$kraken_table' > kraken.out.sort && + kaiju-mergeOutputs + -i kaiju.out.sort + -j kraken.out.sort + -o '$combined_out' + -c $optional.conflict.mode + #if $optional.conflict.mode in ["lca", "lowest"] + -t '$reference.fields.path'/nodes.dmp + #end if + $optional.s + -v + ]]></command> + <inputs> + <param name="kaiju_table" type="data" format="tabular" label="kaiju output table"/> + <param name="kraken_table" type="data" format="tabular" label="Another output table" help="e.g. from kraken"/> + <section name="optional" title="Optional arguments" expanded="false"> + <conditional name="conflict"> + <param argument="-c" name="mode" type="select" label="Conflict resolution mode"> + <option value="1">use taxid from 1st input</option> + <option value="2">use taxid from 2nd input</option> + <option value="lca" selected="true">least common ancestor (LCA) of the two taxon IDs</option> + <option value="lowest">lower rank of the two taxa is used if they are within the same lineage and LCA otherwise</option> + </param> + <when value="1"/> + <when value="2"/> + <when value="lca"> + <expand macro="reference"/> + </when> + <when value="lowest"> + <expand macro="reference"/> + </when> + </conditional> + <param argument="-s" type="boolean" truevalue="-s" falsevalue="" checked="false" label="Use score" help="Use 4th column with classification score to give precedence to taxon with better score" /> + </section> + </inputs> + <outputs> + <data name="combined_out" format="tabular"/> + </outputs> + <tests> + <test> + <param name="kaiju_table" value="kaiju.out"/> + <param name="kraken_table" value="kaiju.out"/> + <output name="combined_out" value="kaiju.out"/> + </test> + </tests> + <help><![CDATA[ + +.. class:: infomark + +**What it does** + +Merge two tab-separated output files in the column format (see above) used by Kaiju and Kraken. Only the first three columns are used. + + + ]]></help> + <expand macro="citations"/> +</tool> \ No newline at end of file |
| b |
| diff -r 000000000000 -r cdc8a98ed4fc macros.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Tue Apr 22 14:03:00 2025 +0000 |
| b |
| @@ -0,0 +1,96 @@ +<macros> + <token name="@TOOL_VERSION@">1.10.1</token> + <token name="@VERSION_SUFFIX@">0</token> + <token name="@PROFILE@">23.2</token> + + <xml name="xrefs"> + <xrefs> + <xref type="bio.tools">kaiju</xref> + </xrefs> + </xml> + + <xml name="requirements"> + <requirements> + <requirement type="package" version="@TOOL_VERSION@">kaiju</requirement> + </requirements> + </xml> + + <xml name="citations"> + <citations> + <citation type="doi">10.1038/ncomms11257</citation> + </citations> + </xml> + + <xml name="reference"> + <param name="reference" type="select" label="kaiju refernce data"> + <options from_data_table="kaiju"/> + <validator type="no_options" message="No reference data installed. Ask your Galaxy admin."/> + </param> + </xml> + + <xml name="r" tokens="optional"> + <param argument="-r" name="rank" type="select" optional="@OPTIONAL@" label="rank"> + <option value="phylum">phylum</option> + <option value="class">class</option> + <option value="order">order</option> + <option value="family">family</option> + <option value="genus">genus</option> + <option value="species">species</option> + </param> + </xml> + + <xml name="l"> + <param argument="-l" type="select" multiple="true" optional="true" label="Print taxon path containing selected ranks ranks specified "> + <option value="domain">Domain</option> + <option value="realm">Realm</option> + <option value="kingdom">Kingdom</option> + <option value="subkingdom">Subkingdom</option> + <option value="superphylum">Superphylum</option> + <option value="phylum">Phylum</option> + <option value="subphylum">Subphylum</option> + <option value="infraphylum">Infraphylum</option> + <option value="superclass">Superclass</option> + <option value="class">Class</option> + <option value="subclass">Subclass</option> + <option value="infraclass">Infraclass</option> + <option value="cohort">Cohort</option> + <option value="subcohort">Subcohort</option> + <option value="superorder">Superorder</option> + <option value="order">Order</option> + <option value="suborder">Suborder</option> + <option value="infraorder">Infraorder</option> + <option value="parvorder">Parvorder</option> + <option value="superfamily">Superfamily</option> + <option value="family">Family</option> + <option value="subfamily">Subfamily</option> + <option value="tribe">Tribe</option> + <option value="subtribe">Subtribe</option> + <option value="genus">Genus</option> + <option value="subgenus">Subgenus</option> + <option value="species_group">Species Group</option> + <option value="species_subgroup">Species Subgroup</option> + <option value="species">Species</option> + <option value="subspecies">Subspecies</option> + <option value="forma_specialis">Forma Specialis</option> + <option value="varietas">Variety</option> + <option value="subvariety">Subvariety</option> + <option value="forma">Form</option> + <option value="section">Section</option> + <option value="subsection">Subsection</option> + <option value="series">Series</option> + <option value="subseries">Subseries</option> + <option value="strain">Strain</option> + <option value="isolate">Isolate</option> + <option value="serogroup">Serogroup</option> + <option value="serotype">Serotype</option> + <option value="biotype">Biotype</option> + <option value="genotype">Genotype</option> + <option value="morph">Morph</option> + <option value="pathogroup">Pathogroup</option> + </param> + </xml> + + <xml name="u"> + <param argument="-u" type="boolean" truevalue="-u" falsevalue="" checked="false" label="Do not count unclassified reads" help="Disables counting unclassified reads towards the total number of reads when calculating percentages."/> + </xml> +</macros> \ No newline at end of file |
| b |
| diff -r 000000000000 -r cdc8a98ed4fc test-data/kaiju-taxnames.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/kaiju-taxnames.out Tue Apr 22 14:03:00 2025 +0000 |
| b |
| @@ -0,0 +1,1 @@ +C testseq 2697049 Severe acute respiratory syndrome coronavirus 2 |
| b |
| diff -r 000000000000 -r cdc8a98ed4fc test-data/kaiju-test-db/database.fmi |
| b |
| Binary file test-data/kaiju-test-db/database.fmi has changed |
| b |
| diff -r 000000000000 -r cdc8a98ed4fc test-data/kaiju-test-db/names.dmp --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/kaiju-test-db/names.dmp Tue Apr 22 14:03:00 2025 +0000 |
| b |
| @@ -0,0 +1,53 @@ +10239 | Vira | | synonym | +10239 | Viridae | | synonym | +10239 | viruses | | blast name | +10239 | Viruses | | scientific name | +11118 | Coronaviridae | | scientific name | +58346 | CCUG 11118 | CCUG 11118 <type strain> | type material | +76804 | Nidovirales | | scientific name | +79912 | NCIMB 11118 | NCIMB 11118 <type strain> | type material | +153721 | DSM 11118 | DSM 11118 <type strain> | type material | +457096 | MICH 11118 | MICH 11118 <holotype> | type material | +457096 | MICH-11118 | MICH-11118 <holotype> | type material | +457096 | MICH:11118 | MICH:11118 <holotype> | type material | +557004 | Matayba cf. opaca Acevedo 11118 | | scientific name | +569542 | Nocardia sp. 11118 | | scientific name | +652290 | Sordariomycetes sp. 11118 | | scientific name | +682956 | CGMCC 1.10239 | CGMCC 1.10239 <type strain> | type material | +694002 | Betacoronavirus | | scientific name | +694002 | Coronavirus | Coronavirus <Betacoronavirus> | in-part | +694002 | Coronavirus group 2 | | equivalent name | +694002 | Group 2 species | | equivalent name | +694009 | HCoV-SARS | | acronym | +694009 | Human coronavirus (strain SARS) | | equivalent name | +694009 | SARS | | acronym | +694009 | SARS-like coronavirus | | equivalent name | +694009 | SARSr-CoV | | acronym | +694009 | SARSrCoV | | acronym | +694009 | SARS-related coronavirus | | equivalent name | +694009 | Severe acute respiratory syndrome-related coronavirus | | scientific name | +926565 | Sporocytophaga myxococcoides DSM 11118 | | scientific name | +2268389 | Arora 11118 | Arora 11118 <type material> | type material | +2499399 | Cornidovirineae | | scientific name | +2501931 | Orthocoronavirinae | | scientific name | +2509511 | Sarbecovirus | | scientific name | +2559587 | Riboviria | | scientific name | +2559587 | RNA viruses and retroviruses | | genbank common name | +2559587 | RNA viruses and viroids | | common name | +2559587 | RNA viruses | | common name | +2697049 | 2019-nCoV | | equivalent name | +2697049 | COVID-19 virus | | equivalent name | +2697049 | HCoV-19 | | equivalent name | +2697049 | Human coronavirus 2019 | | equivalent name | +2697049 | SARS-2 | | equivalent name | +2697049 | SARS2 | | equivalent name | +2697049 | SARS-CoV-2 | | acronym | +2697049 | SARS-CoV2 | | equivalent name | +2697049 | Severe acute respiratory syndrome coronavirus 2 | | scientific name | +2705539 | CLZhao 10239 | CLZhao 10239 <holotype> | type material | +2732396 | Orthornavirae | | scientific name | +2732408 | Pisuviricota | | scientific name | +2732506 | Pisoniviricetes | | scientific name | +3093623 | FAKU:10239 | FAKU:10239 <paratype> | type material | +1 | all | | synonym | +1 | root | | scientific name | |
| b |
| diff -r 000000000000 -r cdc8a98ed4fc test-data/kaiju-test-db/nodes.dmp --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/kaiju-test-db/nodes.dmp Tue Apr 22 14:03:00 2025 +0000 |
| b |
| @@ -0,0 +1,14 @@ +1 | 1 | no rank | | 8 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | | +2697049 | 694009 | no rank | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | | +694009 | 2509511 | species | SA | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant; specified | +2509511 | 694002 | subgenus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant | +694002 | 2501931 | genus | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant | +2501931 | 11118 | subfamily | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant | +11118 | 2499399 | family | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant | +2499399 | 76804 | suborder | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant | +76804 | 2732506 | order | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | code compliant | +2732506 | 2732408 | class | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | | +2732408 | 2732396 | phylum | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | | +2732396 | 2559587 | kingdom | | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | | +2559587 | 10239 | realm | RX | 9 | 1 | 1 | 1 | 0 | 1 | 0 | 0 | | +10239 | 1 | acellular root | | 9 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | | |
| b |
| diff -r 000000000000 -r cdc8a98ed4fc test-data/kaiju.loc --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/kaiju.loc Tue Apr 22 14:03:00 2025 +0000 |
| b |
| @@ -0,0 +1,1 @@ +test test name ${__HERE__}/kaiju-test-db/ 1.0 \ No newline at end of file |
| b |
| diff -r 000000000000 -r cdc8a98ed4fc test-data/kaiju.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/kaiju.out Tue Apr 22 14:03:00 2025 +0000 |
| b |
| @@ -0,0 +1,1 @@ +C testseq 2697049 |
| b |
| diff -r 000000000000 -r cdc8a98ed4fc test-data/kaiju2krona.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/kaiju2krona.out Tue Apr 22 14:03:00 2025 +0000 |
| b |
| @@ -0,0 +1,1 @@ +1 root Viruses Riboviria Orthornavirae Pisuviricota Pisoniviricetes Nidovirales Cornidovirineae Coronaviridae Orthocoronavirinae Betacoronavirus Sarbecovirus Severe acute respiratory syndrome-related coronavirus Severe acute respiratory syndrome coronavirus 2 |
| b |
| diff -r 000000000000 -r cdc8a98ed4fc test-data/kaiju2table.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/kaiju2table.out Tue Apr 22 14:03:00 2025 +0000 |
| b |
| @@ -0,0 +1,4 @@ +file percent reads taxon_id taxon_name +kaiju_out 100.000000 1 10239 Viruses +kaiju_out 0.000000 0 NA cannot be assigned to a (non-viral) phylum +kaiju_out 0.000000 0 NA unclassified |
| b |
| diff -r 000000000000 -r cdc8a98ed4fc test-data/kaijux.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/kaijux.out Tue Apr 22 14:03:00 2025 +0000 |
| b |
| @@ -0,0 +1,1 @@ +C testseq 1918 YP_009725295.1_2697049,YP_009724389.1_2697049, RSTNSRIKASMPTTIAKNTVKSVGKFCLEASFNYLKSPNFSKLINIIIWFLLLSVCLGSLIYSTAALGVLMSNLGMPSYCTGYREGYLNSTNVTIATYCTGSIPCSVCLSGLDSLDTYPSLETIQITISSFKWDLTAFGLVAEWFLAYILFTRFFYVLGLAAIMQLFFSYFAVHFISNSWLMWLIINLVQMAPISAMVRMYIFFASFYYVWKSYVHVVDGCNSSTCMMCYKRNRATRVECTTIVNGVRRSFYVYANGGKGFCKLHNWNCVNCDTFCAGSTFISDEVARDLSLQFKRPINPTDQSSYIVDSVTVKNGSIHLYFDKAGQKTYERHSLSHFVNLDNLRANNTKGSLPINVIVFDG, |
| b |
| diff -r 000000000000 -r cdc8a98ed4fc test-data/query.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/query.fa Tue Apr 22 14:03:00 2025 +0000 |
| b |
| @@ -0,0 +1,26 @@ +>testseq +AATGTGAAAACTACCGAAGTTGTAGGAGACATTATACTTAAACCAGCAAATAA +TAGTTTAAAAATTACAGAAGAGGTTGGCCACACAGATCTAATGGCTGCTTATGTAGACAATTCTAGTCTT +ACTATTAAGAAACCTAATGAATTATCTAGAGTATTAGGTTTGAAAACCCTTGCTACTCATGGTTTAGCTG +CTGTTAATAGTGTCCCTTGGGATACTATAGCTAATTATGCTAAGCCTTTTCTTAACAAAGTTGTTAGTAC +AACTACTAACATAGTTACACGGTGTTTAAACCGTGTTTGTACTAATTATATGCCTTATTTCTTTACTTTA +TTGCTACAATTGTGTACTTTTACTAGAAGTACAAATTCTAGAATTAAAGCATCTATGCCGACTACTATAG +CAAAGAATACTGTTAAGAGTGTCGGTAAATTTTGTCTAGAGGCTTCATTTAATTATTTGAAGTCACCTAA +TTTTTCTAAACTGATAAATATTATAATTTGGTTTTTACTATTAAGTGTTTGCCTAGGTTCTTTAATCTAC +TCAACCGCTGCTTTAGGTGTTTTAATGTCTAATTTAGGCATGCCTTCTTACTGTACTGGTTACAGAGAAG +GCTATTTGAACTCTACTAATGTCACTATTGCAACCTACTGTACTGGTTCTATACCTTGTAGTGTTTGTCT +TAGTGGTTTAGATTCTTTAGACACCTATCCTTCTTTAGAAACTATACAAATTACCATTTCATCTTTTAAA +TGGGATTTAACTGCTTTTGGCTTAGTTGCAGAGTGGTTTTTGGCATATATTCTTTTCACTAGGTTTTTCT +ATGTACTTGGATTGGCTGCAATCATGCAATTGTTTTTCAGCTATTTTGCAGTACATTTTATTAGTAATTC +TTGGCTTATGTGGTTAATAATTAATCTTGTACAAATGGCCCCGATTTCAGCTATGGTTAGAATGTACATC +TTCTTTGCATCATTTTATTATGTATGGAAAAGTTATGTGCATGTTGTAGACGGTTGTAATTCATCAACTT +GTATGATGTGTTACAAACGTAATAGAGCAACAAGAGTCGAATGTACAACTATTGTTAATGGTGTTAGAAG +GTCCTTTTATGTCTATGCTAATGGAGGTAAAGGCTTTTGCAAACTACACAATTGGAATTGTGTTAATTGT +GATACATTCTGTGCTGGTAGTACATTTATTAGTGATGAAGTTGCGAGAGACTTGTCACTACAGTTTAAAA +GACCAATAAATCCTACTGACCAGTCTTCTTACATCGTTGATAGTGTTACAGTGAAGAATGGTTCCATCCA +TCTTTACTTTGATAAAGCTGGTCAAAAGACTTATGAAAGACATTCTCTCTCTCATTTTGTTAACTTAGAC +AACCTGAGAGCTAATAACACTAAAGGTTCATTGCCTATTAATGTTATAGTTTTTGATGGTAAATCAAAAT +GTGAAGAATCATCTGCAAAATCAGCGTCTGTTTACTACAGTCAGCTTATGTGTCAACCTATACTGTTACT +AGATCAGGCATTAGTGTCTGATGTTGGTGATAGTGCGGAAGTTGCAGTTAAAATGTTTGATGCTTACGTT +AATACGTTTTCATCAACTTTTAACGTACCAATGGAAAAACTCAAAACACTAGTTGCAACTGCAGAAGCTG +AACTTGCAAAGAATGTGTCCTTAGACAATGTCTTATCTACTTTTA |
| b |
| diff -r 000000000000 -r cdc8a98ed4fc tool-data/kaiju.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/kaiju.loc.sample Tue Apr 22 14:03:00 2025 +0000 |
| b |
| @@ -0,0 +1,5 @@ +# id: db name + date +# name: what is shown to the user in the select +# path: of the reference data must contain database.fmi, names.dmp and nodes.dmp +# version: version used for constructing the DB (or just the current version at the time when pre-computed indices were downloaded) +#id name path version \ No newline at end of file |
| b |
| diff -r 000000000000 -r cdc8a98ed4fc tool_data_table_conf.xml.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Tue Apr 22 14:03:00 2025 +0000 |
| b |
| @@ -0,0 +1,6 @@ +<tables> + <table name="kaiju" comment_char="#" allow_duplicate_entries="False"> + <columns>value, name, path, version</columns> + <file path="tool-data/kaiju.loc" /> + </table> +</tables> |
| b |
| diff -r 000000000000 -r cdc8a98ed4fc tool_data_table_conf.xml.test --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.test Tue Apr 22 14:03:00 2025 +0000 |
| b |
| @@ -0,0 +1,6 @@ +<tables> + <table name="kaiju" comment_char="#"> + <columns>value, name, path, version</columns> + <file path="${__HERE__}/test-data/kaiju.loc" /> + </table> +</tables> |