| Previous changeset 14:526b91fbde60 (2017-07-19) Next changeset 16:21e8ea8e1adb (2017-09-30) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hisat2 commit 48012d1879395ecf1b4e6cd962f325c372164a33 |
|
modified:
hisat2.xml hisat2_macros.xml test-data/hisat_output_1.bam test-data/hisat_output_2.bam test-data/hisat_output_3.bam |
|
added:
test-data/cached_locally/hisat2_indexes.loc test-data/cached_locally/phiX.1.ht2 test-data/cached_locally/phiX.2.ht2 test-data/cached_locally/phiX.3.ht2 test-data/cached_locally/phiX.4.ht2 test-data/cached_locally/phiX.5.ht2 test-data/cached_locally/phiX.6.ht2 test-data/cached_locally/phiX.7.ht2 test-data/cached_locally/phiX.8.ht2 test-data/cached_locally/phiX.fa test-data/hisat_output.summary test-data/hisat_output_4.bam tool_data_table_conf.xml.test |
| b |
| diff -r 526b91fbde60 -r d5fe9aead222 hisat2.xml --- a/hisat2.xml Wed Jul 19 04:57:27 2017 -0400 +++ b/hisat2.xml Tue Sep 26 17:01:28 2017 -0400 |
| [ |
| b'@@ -1,11 +1,10 @@\n-<?xml version="1.0"?>\n-<tool id="hisat2" name="HISAT2" version="2.0.5.2" profile="17.01">\n+<tool id="hisat2" name="HISAT2" version="2.1.0" profile="17.01">\n <description>A fast and sensitive alignment program</description>\n <macros>\n <import>hisat2_macros.xml</import>\n </macros>\n <requirements>\n- <requirement type="package" version="2.0.5">hisat2</requirement>\n+ <requirement type="package" version="2.1.0">hisat2</requirement>\n <requirement type="package" version="1.4">samtools</requirement>\n </requirements>\n <stdio>\n@@ -15,488 +14,672 @@\n </stdio>\n <version_command>hisat2 --version</version_command>\n <command><![CDATA[\n- #if str($spliced_options.spliced_options_selector) == "advanced" and str($spliced_options.known_splice_gtf) != \'None\':\n- ln -s \'${spliced_options.known_splice_gtf}\' splice_sites.gtf &&\n- hisat2_extract_splice_sites.py splice_sites.gtf > splice_sites.txt &&\n+\n+## Prepare HISAT2 index\n+\n+#if $reference_genome.source == "history":\n+ ln -s \'$reference_genome.history_item\' genome.fa &&\n+ hisat2-build -p \\${GALAXY_SLOTS:-1} genome.fa genome &&\n+ #set index_path = \'genome\'\n+#else:\n+ #set index_path = $reference_genome.index.fields.path\n+#end if\n+\n+\n+## If using known splice sites\n+\n+#if str($adv.spliced_options.spliced_options_selector) == "advanced" and str($adv.spliced_options.known_splice_gtf) != \'None\':\n+ ln -s \'${adv.spliced_options.known_splice_gtf}\' splice_sites.gtf &&\n+ hisat2_extract_splice_sites.py splice_sites.gtf > splice_sites.txt &&\n+#end if\n+\n+\n+## Link in the input files, so HISAT2 can tell their type\n+\n+#set compressed="False"\n+#set reads_are_fastq = True\n+\n+#if str($library.type) == \'paired\':\n+ #if $library.input_1.is_of_type("fastq.gz", "fastqsanger.gz"):\n+ #set read1 = "input_f.fastq.gz"\n+ #set compressed = "GZ"\n+ #else if $library.input_1.is_of_type("fastq.bz2", "fastqsanger.bz2"):\n+ #set read1 = "input_f.fastq.bz2"\n+ #set compressed = "BZ2"\n+ #else if $library.input_1.is_of_type(\'fasta\'):\n+ #set reads_are_fastq = False\n+ #set read1 = "input_f.fasta"\n+ #else:\n+ #set read1 = "input_f.fastq"\n+ #end if\n+ ln -f -s \'${library.input_1}\' ${read1} &&\n+\n+ #if $library.input_2.is_of_type("fastq.gz", "fastqsanger.gz"):\n+ #set read2 = "input_r.fastq.gz"\n+ #set compressed = "GZ"\n+ #else if $library.input_2.is_of_type("fastq.bz2", "fastqsanger.bz2"):\n+ #set read2 = "input_r.fastq.bz2"\n+ #set compressed = "BZ2"\n+ #else if $library.input_2.is_of_type(\'fasta\'):\n+ #set read2 = "input_r.fasta"\n+ #else:\n+ #set read2 = "input_r.fastq"\n+ #end if\n+ ln -f -s \'${library.input_2}\' ${read2} &&\n+\n+#else if str($library.type) == \'paired_collection\':\n+ #if $library.input_1.forward.is_of_type("fastq.gz", "fastqsanger.gz"):\n+ #set read1 = "input_f.fastq.gz"\n+ #set compressed = "GZ"\n+ #else if $library.input_1.forward.is_of_type("fastq.bz2", "fastqsanger.bz2"):\n+ #set read1 = "input_f.fastq.bz2"\n+ #set compressed = "BZ2"\n+ #else if $library.input_1.forward.is_of_type(\'fasta\'):\n+ #set reads_are_fastq = False\n+ #set read1 = "input_f.fasta"\n+ #else:\n+ #set read1 = "input_f.fastq"\n+ #end if\n+ ln -s \'${library.input_1.forward}\' ${read1} &&\n+\n+ #if $library.input_1.reverse.is_of_type("fastq.gz", "fastqsanger.gz"):\n+ #set read2 = "input_r.fastq.gz"\n+ #set compressed = "GZ"\n+ #else if $library.input_1.reverse.is_of_type("fastq.bz2", "fastqsanger.bz2"):\n+ #set read2 = "input_r.fastq.bz2"\n+ #set compressed = "BZ2"\n+ #else if $library.input_1.reverse.is_of_type("fasta"):\n+ #set read2 = "input_r.fasta"\n+ #else:\n+ #set read2 = "input_r.fastq"\n+ #end if\n+ ln -s \'${library.input_1.reverse}\' ${read2} &&\n+\n+#else:\n+ #if $library.input_1.is_of_type("fastq.gz", "fa'..b', `-X`). This option disables that behavior.\n+\n+\n+**Output options**::\n+\n+ --un/--un-gz/--un-bz2\n+ Write unpaired reads that fail to align to file at `<path>`. These reads correspond to the SAM records with the FLAGS `0x4` bit set and neither the `0x40` nor `0x80` bits set. If `--un-gz` is specified, output will be gzip compressed. If `--un-bz2` is specified, output will be bzip2 compressed. Reads written in this way will appear exactly as they did in the input file, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the input.\n+\n+ --al/--al-gz/--al-bz2\n+ Write unpaired reads that align at least once to file at `<path>`. These reads correspond to the SAM records with the FLAGS `0x4`, `0x40`, and `0x80` bits unset. If `--al-gz` is specified, output will be gzip compressed. If `--al-bz2` is specified, output will be bzip2 compressed. Reads written in this way will appear exactly as they did in the input file, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the input.\n+\n+ --un-conc/--un-conc-gz/--un-conc-bz2\n+ Write paired-end reads that fail to align concordantly to file(s) at `<path>`. These reads correspond to the SAM records with the FLAGS `0x4` bit set and either the `0x40` or `0x80` bit set (depending on whether it\'s mate #1 or #2). .1 and .2 strings are added to the filename to distinguish which file contains mate #1 and mate #2. If a percent symbol, %, is used in <path>, the percent symbol is replaced with 1 or 2 to make the per-mate filenames. Otherwise, .1 or .2 are added before the final dot in <path> to make the per-mate filenames. Reads written in this way will appear exactly as they did in the input files, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the inputs.\n+\n+ --al-conc/--al-conc-gz/--al-conc-bz2\n+ Write paired-end reads that align concordantly at least once to file(s) at `<path>`. These reads correspond to the SAM records with the FLAGS `0x4` bit unset and either the `0x40` or `0x80` bit set (depending on whether it\'s mate #1 or #2). .1 and .2 strings are added to the filename to distinguish which file contains mate #1 and mate #2. If a percent symbol, %, is used in <path>, the percent symbol is replaced with 1 or 2 to make the per-mate filenames. Otherwise, .1 or .2 are added before the final dot in `<path>` to make the per-mate filenames. Reads written in this way will appear exactly as they did in the input files, without any modification (same sequence, same name, same quality string, same quality encoding). Reads will not necessarily appear in the same order as they did in the inputs.\n+\n+\n+**Other options**::\n+\n+ --seed <int>\n+ Use `<int>` as the seed for pseudo-random number generator. Default: 0.\n+\n+ --non-deterministic\n+ Normally, HISAT2 re-initializes its pseudo-random generator for each read. It seeds the generator with a number derived from (a) the read name, (b) the nucleotide sequence, (c) the quality sequence, (d) the value of the `--seed` option. This means that if two reads are identical (same name, same nucleotides, same qualities) HISAT2 will find and report the same alignment(s) for both, even if there was ambiguity. When `--non-deterministic` is specified, HISAT2 re-initializes its pseudo-random generator for each read using the current time. This means that HISAT2 will not necessarily report the same alignment for two identical reads. This is counter-intuitive for some users, but might be more appropriate in situations where the input consists of many identical reads.\n+\n ]]></help>\n <citations>\n <citation type="doi">10.1038/nmeth.3317</citation>\n' |
| b |
| diff -r 526b91fbde60 -r d5fe9aead222 hisat2_macros.xml --- a/hisat2_macros.xml Wed Jul 19 04:57:27 2017 -0400 +++ b/hisat2_macros.xml Tue Sep 26 17:01:28 2017 -0400 |
| [ |
| b'@@ -1,148 +1,30 @@\n-<?xml version="1.0"?>\n <macros>\n- <xml name="single_paired_selector">\n- <param name="paired_selector" type="select" label="Single end or paired reads?">\n- <option value="paired">Paired reads</option>\n- <option value="single">Unpaired reads</option>\n+ <xml name="paired_end_options">\n+\n+ <param name="rna_strandness" argument="--rna-strandness" type="select" label="Specify strand information"\n+ help="\'FR\' means a read corresponds to a transcript. \'RF\' means a read corresponds to the reverse complemented counterpart of a transcript. With this option being used, every read alignment will have an XS attribute tag: \'+\' means a read belongs to a transcript on \'+\' strand of genome. \'-\' means a read belongs to a transcript on \'-\' strand of genome.">\n+ <option value="">Unstranded</option>\n+ <option value="FR">Forward (FR)</option>\n+ <option value="RF">Reverse (RF)</option>\n </param>\n- </xml>\n- <xml name="paired_input_conditional" tokens="ftype">\n- <conditional name="paired">\n- <expand macro="single_paired_selector" />\n- <when value="paired">\n- <conditional name="collection" label="Data structure">\n- <param name="collection_selector" type="select" label="Input is structured as" help="If a list of pairs is selected, HISAT2 will run in batch mode over each pair in the list, producing a list of output bam files">\n- <option value="files">Individual files</option>\n- <option value="collection">Pair collection or list of pairs</option>\n- </param>\n- <when value="collection">\n- <param name="reads" type="data_collection" collection_type="paired" format="@FTYPE@" label="Paired reads" />\n- </when>\n- <when value="files">\n- <param name="forward" type="data" format="@FTYPE@" label="Forward reads" />\n- <param name="reverse" type="data" format="@FTYPE@" label="Reverse reads" />\n- </when>\n- </conditional>\n- <expand macro="paired_end_conditional" />\n- <expand macro="paired_end_output" />\n- </when>\n- <when value="single">\n- <param name="reads" type="data" format="@FTYPE@" label="Reads" />\n- <param name="unaligned_file" argument="--un-gz" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" />\n- <param name="aligned_file" argument="--al-gz" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" />\n- </when>\n- </conditional>\n- </xml>\n- <xml name="paired_end_conditional">\n- <conditional name="paired_end_options">\n- <param name="paired_end_options_selector" type="select" label="Paired-end options">\n+\n+ <conditional name="paired_options">\n+ <param name="paired_options_selector" type="select" label="Paired-end options" help="See "Alignment Options" section of Help below for information">\n <option value="defaults">Use default values</option>\n <option value="advanced">Specify paired-end parameters</option>\n </param>\n- <when value="defaults" />\n+ <when value="defaults"/>\n <when value="advanced">\n- <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" label="Disable alignments of individual mates" help="By default, when hisat cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates. This option disables that behavior" />\n- <param name="no_disc'..b'tput_aligned_reads_l}\'\n- #else:\n- --al-conc \'${output_aligned_reads_l}\'\n- #end if\n- #end if\n- #if str($input_format.paired.paired_end_options.paired_end_options_selector) == \'advanced\':\n- ${input_format.paired.paired_end_options.no_mixed}\n- ${input_format.paired.paired_end_options.no_discordant}\n- #end if\n- </token>\n- <token name="@strandedness_parameters@">\n- #if str($spliced_options.spliced_options_selector) == "advanced":\n- #if str($spliced_options.rna_strandness).strip() != \'\':\n- --rna-strandness $spliced_options.rna_strandness\n- #end if\n- #end if\n- </token>\n- <token name="@FASTQGZ_SETUP@">\n-<![CDATA[\n- #set compressed="False"\n- #if str($input_format.paired.paired_selector) == \'paired\':\n- #if str($input_format.paired.collection.collection_selector) == \'collection\':\n- #if $input_format.paired.collection.reads.forward.is_of_type("fastq.gz", "fastqsanger.gz"):\n- #set read1 = "input_f.fastq.gz"\n- #set compressed = "GZ"\n- #else if $input_format.paired.collection.reads.forward.is_of_type("fastq.bz2", "fastqsanger.bz2"):\n- #set read1 = "input_f.fastq.bz2"\n- #set compressed = "BZ2"\n- #else:\n- #set read1 = "input_f.fastq"\n- #end if\n- ln -f -s \'${input_format.paired.collection.reads.forward}\' ${read1} &&\n-\n- #if $input_format.paired.collection.reads.reverse.is_of_type("fastq.gz", "fastqsanger.gz"):\n- #set read2 = "input_r.fastq.gz"\n- #set compressed = "GZ"\n- #else if $input_format.paired.collection.reads.reverse.is_of_type("fastq.bz2", "fastqsanger.bz2"):\n- #set read2 = "input_r.fastq.bz2"\n- #set compressed = "BZ2"\n- #else:\n- #set read2 = "input_r.fastq"\n- #end if\n- ln -f -s \'${input_format.paired.collection.reads.reverse}\' ${read2} &&\n- #else:\n- #if $input_format.paired.collection.forward.is_of_type("fastq.gz", "fastqsanger.gz"):\n- #set read1 = "input_f.fastq.gz"\n- #set compressed = "GZ"\n- #else if $input_format.paired.collection.forward.is_of_type("fastq.bz2", "fastqsanger.bz2"):\n- #set read1 = "input_f.fastq.bz2"\n- #set compressed = "BZ2"\n- #else:\n- #set read1 = "input_f.fastq"\n- #end if\n- ln -f -s \'${input_format.paired.collection.forward}\' ${read1} &&\n-\n- #if $input_format.paired.collection.reverse.is_of_type("fastq.gz", "fastqsanger.gz"):\n- #set read2 = "input_r.fastq.gz"\n- #set compressed = "GZ"\n- #else if $input_format.paired.collection.reverse.is_of_type("fastq.bz2", "fastqsanger.bz2"):\n- #set read2 = "input_r.fastq.bz2"\n- #set compressed = "BZ2"\n- #else:\n- #set read2 = "input_r.fastq"\n- #end if\n- ln -f -s \'${input_format.paired.collection.reverse}\' ${read2} &&\n- #end if\n- #else:\n- #if $input_format.paired.reads.is_of_type("fastq.gz", "fastqsanger.gz"):\n- #set read1 = "input_f.fastq.gz"\n- #set compressed = "GZ"\n- #else if $input_format.paired.reads.is_of_type("fastq.bz2", "fastqsanger.bz2"):\n- #set read1 = "input_f.fastq.bz2"\n- #set compressed = "BZ2"\n- #else:\n- #set read1 = "input_f.fastq"\n- #end if\n- ln -s \'${input_format.paired.reads}\' ${read1} &&\n- #end if\n-]]>\n- </token>\n-</macros>\n+</macros>\n\\ No newline at end of file\n' |
| b |
| diff -r 526b91fbde60 -r d5fe9aead222 test-data/cached_locally/hisat2_indexes.loc --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cached_locally/hisat2_indexes.loc Tue Sep 26 17:01:28 2017 -0400 |
| b |
| @@ -0,0 +1,1 @@ +phiX phiX PhiX ${__HERE__}/phiX |
| b |
| diff -r 526b91fbde60 -r d5fe9aead222 test-data/cached_locally/phiX.1.ht2 |
| b |
| Binary file test-data/cached_locally/phiX.1.ht2 has changed |
| b |
| diff -r 526b91fbde60 -r d5fe9aead222 test-data/cached_locally/phiX.2.ht2 |
| b |
| Binary file test-data/cached_locally/phiX.2.ht2 has changed |
| b |
| diff -r 526b91fbde60 -r d5fe9aead222 test-data/cached_locally/phiX.3.ht2 |
| b |
| Binary file test-data/cached_locally/phiX.3.ht2 has changed |
| b |
| diff -r 526b91fbde60 -r d5fe9aead222 test-data/cached_locally/phiX.4.ht2 |
| b |
| Binary file test-data/cached_locally/phiX.4.ht2 has changed |
| b |
| diff -r 526b91fbde60 -r d5fe9aead222 test-data/cached_locally/phiX.5.ht2 |
| b |
| Binary file test-data/cached_locally/phiX.5.ht2 has changed |
| b |
| diff -r 526b91fbde60 -r d5fe9aead222 test-data/cached_locally/phiX.6.ht2 |
| b |
| Binary file test-data/cached_locally/phiX.6.ht2 has changed |
| b |
| diff -r 526b91fbde60 -r d5fe9aead222 test-data/cached_locally/phiX.7.ht2 |
| b |
| Binary file test-data/cached_locally/phiX.7.ht2 has changed |
| b |
| diff -r 526b91fbde60 -r d5fe9aead222 test-data/cached_locally/phiX.8.ht2 |
| b |
| Binary file test-data/cached_locally/phiX.8.ht2 has changed |
| b |
| diff -r 526b91fbde60 -r d5fe9aead222 test-data/cached_locally/phiX.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cached_locally/phiX.fa Tue Sep 26 17:01:28 2017 -0400 |
| b |
| @@ -0,0 +1,79 @@ +>phiX174 +GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT +GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA +ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG +TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA +GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC +TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT +TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT +CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT +TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG +TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC +GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA +CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG +TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT +AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC +CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA +TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC +TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA +CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA +GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT +GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA +ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC +TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT +TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC +ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC +CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT +GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC +CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC +TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG +TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT +TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA +AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT +TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT +ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC +GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC +TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT +TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA +TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG +TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC +CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG +AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC +CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT +TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG +CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA +AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT +GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG +GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA +TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT +CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG +TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA +GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC +CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA +TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA +AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC +TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT +CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA +TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG +TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT +CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT +TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC +ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG +TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA +ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG +GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC +CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT +GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG +GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT +ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG +CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC +CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC +GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT +CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG +CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA +TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT +TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG +TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC +AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC +TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA + |
| b |
| diff -r 526b91fbde60 -r d5fe9aead222 test-data/hisat_output.summary --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/hisat_output.summary Tue Sep 26 17:01:28 2017 -0400 |
| b |
| @@ -0,0 +1,6 @@ +HISAT2 summary stats: + Total reads: 10 + Aligned 0 time: 0 (0.00%) + Aligned 1 time: 10 (100.00%) + Aligned >1 times: 0 (0.00%) + Overall alignment rate: 100.00% |
| b |
| diff -r 526b91fbde60 -r d5fe9aead222 test-data/hisat_output_1.bam |
| b |
| Binary file test-data/hisat_output_1.bam has changed |
| b |
| diff -r 526b91fbde60 -r d5fe9aead222 test-data/hisat_output_2.bam |
| b |
| Binary file test-data/hisat_output_2.bam has changed |
| b |
| diff -r 526b91fbde60 -r d5fe9aead222 test-data/hisat_output_3.bam |
| b |
| Binary file test-data/hisat_output_3.bam has changed |
| b |
| diff -r 526b91fbde60 -r d5fe9aead222 test-data/hisat_output_4.bam |
| b |
| Binary file test-data/hisat_output_4.bam has changed |
| b |
| diff -r 526b91fbde60 -r d5fe9aead222 tool_data_table_conf.xml.test --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.test Tue Sep 26 17:01:28 2017 -0400 |
| b |
| @@ -0,0 +1,7 @@ +<tables> + <!-- Locations of indexes in the HISAT mapper format --> + <table name="hisat2_indexes" comment_char="#" allow_duplicate_entries="False"> + <columns>value, dbkey, name, path</columns> + <file path="${__HERE__}/test-data/cached_locally/hisat2_indexes.loc" /> + </table> +</tables> |