| Previous changeset 12:e522022137f6 (2019-12-25) Next changeset 14:92182c270ce4 (2021-10-14) |
|
Commit message:
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/bcftools commit 8ad854180e3be0934cdb1f0021886199a2edf9c3" |
|
modified:
bcftools_consensus.xml macros.xml |
| b |
| diff -r e522022137f6 -r d6dc477167f8 bcftools_consensus.xml --- a/bcftools_consensus.xml Wed Dec 25 12:25:37 2019 -0500 +++ b/bcftools_consensus.xml Fri Feb 05 19:48:42 2021 +0000 |
| [ |
| @@ -1,5 +1,5 @@ <?xml version='1.0' encoding='utf-8'?> -<tool name="bcftools @EXECUTABLE@" id="bcftools_@EXECUTABLE@" version="@TOOL_VERSION@"> +<tool name="bcftools @EXECUTABLE@" id="bcftools_@EXECUTABLE@" version="@TOOL_VERSION@+galaxy1"> <description>Create consensus sequence by applying VCF variants to a reference fasta file</description> <macros> <token name="@EXECUTABLE@">consensus</token> @@ -34,6 +34,10 @@ #end if @SAMPLE@ +#set $section = $sec_restrict +@INCLUDE@ +@EXCLUDE@ + #if $chain: --chain '$chain_file' #end if @@ -64,6 +68,10 @@ </section> <param name="chain" type="boolean" truevalue="yes" falsevalue="no" label="Write a chain file for liftover" /> <param name="rename" type="boolean" truevalue="yes" falsevalue="no" label="Set output FASTA ID from name of VCF" /> + <section name="sec_restrict" expanded="false" title="Restrict to"> + <expand macro="macro_include" /> + <expand macro="macro_exclude" /> + </section> </inputs> <outputs> <data name="output_file" format="fasta" label="${tool.name} on ${on_string}: consensus fasta"/> @@ -119,6 +127,18 @@ </assert_contents> </output> </test> + <test> + <expand macro="test_using_reference" ref="consensus.fa" /> + <param name="input_file" ftype="vcf" value="consensus.vcf" /> + <section name="sec_restrict"> + <param name="include" value='TYPE="snp"' /> + </section> + <output name="output_file"> + <assert_contents> + <has_text text="TACAAAATATGACATATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGA" /> + </assert_contents> + </output> + </test> </tests> <help><![CDATA[ ===================================== |
| b |
| diff -r e522022137f6 -r d6dc477167f8 macros.xml --- a/macros.xml Wed Dec 25 12:25:37 2019 -0500 +++ b/macros.xml Fri Feb 05 19:48:42 2021 +0000 |
| [ |
| @@ -436,11 +436,19 @@ #end if </token> + <xml name="macro_include_exclude_validate_sanitize"> + <validator type="expression" message="Single quote or trailing backslash not allowed">"'" not in value and value[-1] != "\\"</validator> + <sanitizer> + <valid initial="string.ascii_letters,string.digits,string.whitespace,string.punctuation"> + <remove value="@" /> + <remove value="'" /> + </valid> + </sanitizer> + </xml> <xml name="macro_include"> <param argument="--include" type="text" optional="true" label="Include" help="Select sites for which the expression is true"> - <validator type="regex" message="Single quote not allowed">^[^']*$</validator> - <sanitizer sanitize="False"/> + <expand macro="macro_include_exclude_validate_sanitize" /> </param> </xml> <token name="@INCLUDE@"> @@ -448,11 +456,10 @@ --include '${section.include}' #end if </token> - + <xml name="macro_exclude"> <param argument="--exclude" type="text" optional="true" label="Exclude" help="Exclude sites for which the expression is true"> - <validator type="regex" message="Single quote not allowed">^[^']*$</validator> - <sanitizer sanitize="False"/> + <expand macro="macro_include_exclude_validate_sanitize" /> </param> </xml> <token name="@EXCLUDE@"> |