| Next changeset 1:02f8a17a4ebd (2015-11-11) |
|
Commit message:
Uploaded tool tarball. |
|
added:
fastx_renamer.xml tool_dependencies.xml |
| b |
| diff -r 000000000000 -r d7bce63e6e09 fastx_renamer.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_renamer.xml Wed Sep 25 11:19:14 2013 -0400 |
| b |
| @@ -0,0 +1,67 @@ +<tool id="cshl_fastx_renamer" name="Rename sequences" version="0.0.11" > + <description></description> + <requirements> + <requirement type="package" version="0.0.13">fastx_toolkit</requirement> + </requirements> + <command>zcat -f $input | fastx_renamer -n $TYPE -o $output -v +#if $input.ext == "fastqsanger": +-Q 33 +#end if + </command> + + <inputs> + <param format="fastqsolexa,fasta,fastqsanger" name="input" type="data" label="FASTQ/A Library to rename" /> + + <param name="TYPE" type="select" label="Rename sequence identifiers to"> + <option value="SEQ">Nucleotides sequence</option> + <option value="COUNT">Numeric Counter</option> + </param> + </inputs> + + <outputs> + <data format="input" name="output" metadata_source="input" /> + </outputs> + +<help> + +**What it does** + +This tool renames the sequence identifiers in a FASTQ/A file. + +.. class:: infomark + +Use this tool at the beginning of your workflow, as a way to keep the original sequence (before trimming, clipping, barcode-removal, etc). + +-------- + +**Example** + +The following Solexa-FASTQ file:: + + @CSHL_4_FC042GAMMII_2_1_517_596 + GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT + +CSHL_4_FC042GAMMII_2_1_517_596 + 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 + +Renamed to **nucleotides sequence**:: + + @GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT + GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT + +GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT + 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 + +Renamed to **numeric counter**:: + + @1 + GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT + +1 + 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ +</help> +<!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> +</tool> |
| b |
| diff -r 000000000000 -r d7bce63e6e09 tool_dependencies.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Wed Sep 25 11:19:14 2013 -0400 |
| b |
| @@ -0,0 +1,6 @@ +<?xml version="1.0"?> +<tool_dependency> + <package name="fastx_toolkit" version="0.0.13"> + <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="http://toolshed.g2.bx.psu.edu" /> + </package> +</tool_dependency> |