| Previous changeset 9:0a563fd2f22e (2019-03-14) Next changeset 11:41929aa1e7f3 (2019-08-17) |
|
Commit message:
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/rgrnastar commit 686574b0392e554b75035a9b79bc919dfda9ab97" |
|
modified:
macros.xml rg_rnaStar.xml test-data/rnastar_test.log test-data/rnastar_test2.log test-data/rnastar_test2_mapped_reads.bam test-data/rnastar_test_mapped_reads.bam test-data/rnastar_test_twopass.log test-data/test3.chimjunc.tabular tool_data_table_conf.xml.sample |
|
added:
test-data/41737_R1.fastq.sub240k.gz test-data/41737_R2.fastq.sub240k.gz test-data/737K-august-2016.small.txt.gz test-data/SNORD83B.22.fa test-data/SNORD83B.22.gtf test-data/rnastar_index2_versioned.loc test-data/rnastar_test_mapped_reads_twopass.bam test-data/rnastar_test_transcriptome_mapped_reads.bam test-data/test-cache/tophat-test/Genome test-data/test-cache/tophat-test/SA test-data/test-cache/tophat-test/SAindex test-data/test-cache/tophat-test/chrLength.txt test-data/test-cache/tophat-test/chrName.txt test-data/test-cache/tophat-test/chrNameLength.txt test-data/test-cache/tophat-test/chrStart.txt test-data/test-cache/tophat-test/genomeParameters.txt tool-data/rnastar_index2_versioned.loc.sample tool_data_table_conf.xml.test |
|
removed:
README.rst tool-data/rnastar_index2.loc.sample |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e README.rst --- a/README.rst Thu Mar 14 16:12:38 2019 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| b |
| @@ -1,9 +0,0 @@ - -System Requirements -=================== - -- **Memory**: To run efficiently, RNA-STAR requires enough free memory to - hold the SA-indexed reference genome in RAM. For Human Genome hg19 this - index is about 27GB and running RNA-STAR requires approximately ~30GB of RAM. - For custom genomes, the rule of thumb is to multiply the size of the - reference FASTA file by 9 to estimate the required amount of RAM. |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e macros.xml --- a/macros.xml Thu Mar 14 16:12:38 2019 -0400 +++ b/macros.xml Thu Aug 15 01:54:13 2019 -0400 |
| [ |
| b'@@ -1,10 +1,39 @@\n <macros>\n+ <!-- REMEMBER to bump the version of rna_star_index_builder_data_manager\n+ whenever you make changes to the following two version tokens!\n+ The data manager uses a symlink to this macro file to keep the versions in\n+ sync. -->\n+ <!-- STAR version to be used -->\n+ <token name="@VERSION@">2.7.2a</token>\n+ <!-- STAR index version compatible with this version of STAR\n+ This is the STAR version that introduced the index structure expected\n+ by the current version.\n+ It can be found for any specific version of STAR with:\n+ STAR -h | grep versionGenome\n+ or by looking for the versionGenome parameter in source/parametersDefault\n+ of STAR\'s source code -->\n+ <token name="@IDX_VERSION@">2.7.1a</token>\n+\n <xml name="requirements">\n <requirements>\n- <requirement type="package" version="2.6.0b">star</requirement>\n- <requirement type="package" version="1.8">samtools</requirement>\n+ <requirement type="package" version="@VERSION@">star</requirement>\n+ <requirement type="package" version="1.9">samtools</requirement>\n </requirements>\n </xml>\n+\n+ <xml name="index_selection" token_with_gene_model="1">\n+ <param argument="--genomeDir" name="genomeDir" type="select"\n+ label="Select reference genome"\n+ help="If your genome of interest is not listed, contact the Galaxy team">\n+ <options from_data_table="rnastar_index2_versioned">\n+ <filter type="static_value" column="4" value="@WITH_GENE_MODEL@" />\n+ <filter type="static_value" column="5" value="@IDX_VERSION@" />\n+ <filter type="sort_by" column="2" />\n+ <validator type="no_options" message="No indexes are available for the selected input dataset" />\n+ </options>\n+ </param>\n+ </xml>\n+\n <token name="@FASTQ_GZ_OPTION@">\n --readFilesCommand zcat\n </token>\n@@ -13,8 +42,8 @@\n <citation type="doi">10.1093/bioinformatics/bts635</citation>\n </citations>\n </xml>\n- <xml name="@SJDBOPTIONS@">\n- <param argument="--sjdbGTFfile" type="data" format="gff3,gtf" label="Gene model (gff3,gtf) file for splice junctions" optional="true" help="Exon junction information for mapping splices"/>\n+ <xml name="@SJDBOPTIONS@" token_optional="true">\n+ <param argument="--sjdbGTFfile" type="data" format="gff3,gtf" label="Gene model (gff3,gtf) file for splice junctions" optional="@OPTIONAL@" help="Exon junction information for mapping splices"/>\n <param argument="--sjdbOverhang" type="integer" min="1" value="100" label="Length of the genomic sequence around annotated junctions" help="Used in constructing the splice junctions database. Ideal value is ReadLength-1"/>\n </xml>\n <xml name="dbKeyActions">\n@@ -22,7 +51,7 @@\n <conditional name="refGenomeSource.geneSource">\n <when value="indexed">\n <action type="metadata" name="dbkey">\n- <option type="from_data_table" name="rnastar_index2" column="1" offset="0">\n+ <option type="from_data_table" name="rnastar_index2_versioned" column="1" offset="0">\n <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/>\n <filter type="param_value" ref="refGenomeSource.GTFconditional.genomeDir" column="0"/>\n </option>\n@@ -36,4 +65,99 @@\n </conditional>\n </actions>\n </xml>\n+ <token name="@TEMPINDEX@"><![CDATA[\n+ ## Create temporary index for custom reference\n+ #if str($refGenomeSource.geneSource) == \'history\':\n+ mkdir -p tempstargenomedir &&\n+ STAR\n+ --runMode genomeGenerate\n+ --genomeDir \'tempstargenomedir\'\n+ --genomeFastaFiles \'${refGenomeSource.genomeFastaFiles}\'\n+ ## Handle difference betwee'..b' #if $refGenomeSource.GTFconditional.sjdbGTFfile:\n+ --sjdbOverhang $refGenomeSource.GTFconditional.sjdbOverhang\n+ --sjdbGTFfile \'${refGenomeSource.GTFconditional.sjdbGTFfile}\'\n+ #if str($refGenomeSource.GTFconditional.sjdbGTFfile.ext) == \'gff3\':\n+ --sjdbGTFtagExonParentTranscript Parent\n+ #end if\n+ #end if\n+ #end if\n+ #end if\n+ ]]></token>\n+ <xml name="stdio" >\n+ <stdio>\n+ <regex match="FATAL error" source="both" level="fatal"/>\n+ <regex match="EXITING: FATAL INPUT ERROR:" source="both" level="fatal"/>\n+ <regex match="EXITING: fatal error trying to allocate genome arrays, exception thrown: std::bad_alloc" source="both" level="fatal"/>\n+ <regex match="\\[sam_read1\\] missing header\\? Abort!" source="both" level="fatal"/>\n+ </stdio>\n+ </xml>\n+ <xml name="refgenomehandling" >\n+ <conditional name="refGenomeSource">\n+ <param name="geneSource" type="select" label="Custom or built-in reference genome" help="Built-ins were indexed using default options">\n+ <option value="indexed" selected="true">Use a built-in index</option>\n+ <option value="history">Use reference genome from history and create temporary index</option>\n+ </param>\n+ <when value="indexed">\n+ <conditional name="GTFconditional">\n+ <param name="GTFselect" type="select"\n+ label="Reference genome with or without an annotation"\n+ help="Select the \'... with builtin gene-model\' option to select from the list of available indexes that were built with splice junction information. Select the \'... without builtin gene-model\' option to select from the list of available indexes without annotated splice junctions.">\n+ <option value="without-gtf">use genome reference with builtin gene-model</option>\n+ <option value="with-gtf">use genome reference without builtin gene-model</option>\n+ </param>\n+ <when value="with-gtf">\n+ <expand macro="index_selection" with_gene_model="0" />\n+ <expand macro="@SJDBOPTIONS@" />\n+ </when>\n+ <when value="without-gtf">\n+ <expand macro="index_selection" with_gene_model="1" />\n+ </when>\n+ </conditional>\n+ </when>\n+ <when value="history">\n+ <param argument="--genomeFastaFiles" type="data" format="fasta" label="Select a reference genome" />\n+ <!-- Currently, this parameter is not exposed in the wrapper,\n+ but used only in the tests to avoid excessive index sizes for\n+ the tiny test genomes. -->\n+ <param name="genomeSAindexNbases" type="hidden" value="" />\n+ <conditional name="GTFconditional">\n+ <param name="GTFselect" type="select"\n+ label="Build index with our without known splice junctions annotation"\n+ help="To build an index with known splice junctions annotated, you will have to provide a GTF or GFF3 dataset that describes the gene models (the location of genes, transcripts and exons) known for the reference genome.">\n+ <option value="without-gtf">build index without gene-model</option>\n+ <option value="with-gtf">build index with gene-model</option>\n+ </param>\n+ <when value="with-gtf">\n+ <expand macro="@SJDBOPTIONS@" optional="false"/>\n+ </when>\n+ <when value="without-gtf" />\n+ </conditional>\n+ </when>\n+ </conditional>\n+ </xml>\n </macros>\n' |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e rg_rnaStar.xml --- a/rg_rnaStar.xml Thu Mar 14 16:12:38 2019 -0400 +++ b/rg_rnaStar.xml Thu Aug 15 01:54:13 2019 -0400 |
| [ |
| b'@@ -1,16 +1,10 @@\n-<tool id="rna_star" name="RNA STAR" version="2.6.0b-2" profile="17.01">\n+<tool id="rna_star" name="RNA STAR" version="@VERSION@" profile="17.01">\n <description>Gapped-read mapper for RNA-seq data</description>\n <macros>\n <import>macros.xml</import>\n </macros>\n <expand macro="requirements"/>\n-\n- <stdio>\n- <regex match="FATAL error" source="both" level="fatal"/>\n- <regex match="EXITING: FATAL INPUT ERROR:" source="both" level="fatal"/>\n- <regex match="EXITING: fatal error trying to allocate genome arrays, exception thrown: std::bad_alloc" source="both" level="fatal"/>\n- <regex match="\\[sam_read1\\] missing header\\? Abort!" source="both" level="fatal"/>\n- </stdio>\n+ <expand macro="stdio" />\n \n <!--\n important quote (https://groups.google.com/forum/#!topic/rna-star/q4zGzlPgwXY):\n@@ -23,176 +17,212 @@\n Alex\n -->\n <command><![CDATA[\n- ## Create temporary index for custom reference\n- #if str($refGenomeSource.geneSource) == \'history\':\n- mkdir -p tempstargenomedir &&\n- STAR\n- --runMode genomeGenerate\n- --genomeDir \'tempstargenomedir\'\n- --genomeFastaFiles \'$refGenomeSource.genomeFastaFiles\'\n- #if $refGenomeSource.sjdbGTFfile:\n- --sjdbGTFfile \'$refGenomeSource.sjdbGTFfile\'\n- --sjdbOverhang \'$refGenomeSource.sjdbOverhang\'\n- #end if\n- --runThreadN \\${GALAXY_SLOTS:-4}\n- &&\n- #end if\n-\n+ @TEMPINDEX@\n STAR\n- --runThreadN \\${GALAXY_SLOTS:-4}\n- --genomeLoad NoSharedMemory\n- --genomeDir\n- #if str($refGenomeSource.geneSource) == \'history\':\n- \'tempstargenomedir\'\n- #if $refGenomeSource.sjdbGTFfile:\n- --sjdbGTFfile \'$refGenomeSource.sjdbGTFfile\'\n- --sjdbOverhang \'$refGenomeSource.sjdbOverhang\'\n- #end if\n- #else\n- \'${refGenomeSource.GTFconditional.genomeDir.fields.path}\'\n- #end if\n+ @REFGENOMEHANDLING@\n \n --readFilesIn\n- #if str($singlePaired.sPaired) == "paired_collection"\n+ #if str($singlePaired.sPaired) == \'paired_collection\':\n \'$singlePaired.input.forward\' \'$singlePaired.input.reverse\'\n \n- #if $singlePaired.input.forward.is_of_type("fastq.gz", "fastqsanger.gz"):\n+ #if $singlePaired.input.forward.is_of_type(\'fastq.gz\', \'fastqsanger.gz\'):\n @FASTQ_GZ_OPTION@\n #end if\n #else\n \'$singlePaired.input1\'\n- #if str($singlePaired.sPaired) == "paired"\n+ #if str($singlePaired.sPaired) == \'paired\':\n \'$singlePaired.input2\'\n #end if\n \n- #if $singlePaired.input1.is_of_type("fastq.gz", "fastqsanger.gz"):\n+ #if $singlePaired.input1.is_of_type(\'fastq.gz\', \'fastqsanger.gz\'):\n @FASTQ_GZ_OPTION@\n #end if\n #end if\n \n --outSAMtype BAM SortedByCoordinate\n \n- ## Handle difference between indices with/without annotations\n- #if str($refGenomeSource.geneSource) == \'indexed\':\n- #if str($refGenomeSource.GTFconditional.GTFselect) == \'without-gtf\':\n- #if $refGenomeSource.GTFconditional.sjdbGTFfile:\n- --sjdbOverhang \'$refGenomeSource.GTFconditional.sjdbOverhang\'\n- --sjdbGTFfile \'${refGenomeSource.GTFconditional.sjdbGTFfile}\'\n- #if str($refGenomeSource.GTFconditional.sjdbGTFfile.ext) == \'gff3\':\n- --sjdbGTFtagExonParentTranscript Parent\n- #end if\n+ ## Two pass mode\n+ --twopassMode ${twopass.twopassMode} ${twopass.twopass_read_subset}\n+ #for $sj_input in $twopass.sj_precalculated:\n+ \'$sj_input\'\n+ #end for\n+ #if str($twopass.twopassMode) != \'None\':\n+ #if str($refGenomeSource.GTFconditional.GTFselect) == \'with-gtf\':\n+ #if not '..b': Number of reported alignments that contain the query in the current record.\n- HI: Query hit index, indicating the alignment record is the i-th one stored in SAM\n- AS: Local alignment score (paired for paired-end reads)\n- nM: Number of mismatches per (paired) alignment\n+STAR-Fusion_ can use the chimeric junctions output of STAR as input, but you\n+need to enable **chimeric alignment detection** by STAR for that dataset to be\n+generated. Hence, be sure to select:\n \n-The All option includes the Standard attributes, plus the following four::\n+**Report chimeric alignments?**: `As separate tabular "Junctions" output (Junctions)`.\n+\n+In addition, for best results it is recommended_ that you\n+\n+- use **2-pass mapping** for more sensitive novel splice junction discovery\n \n- NM: Edit distance to the reference, including ambiguous bases but excluding clipping\n- MD: String for mismatching positions\n- jM: Intron motifs for all junctions\n- jI: Start and end of introns for all junctions\n+- under *BAM output format specification*,\n+ **Read alignment tags to include in the BAM output**: select `XS` as an\n+ additional tag to generate (this is the equivalent of using\n+ `--outSAMstrandField intronMotif` on the command line)\n \n-**STAR-Fusion**\n+- under *Algorithmic settings*, **Configure seed, alignment and limits options**:\n+ `use parameters suggested for STAR-Fusion`.\n \n-STAR-Fusion_ is used to identify candidate fusion transcripts. The recommended_ parameters for running\n-STAR prior to STAR-Fusion can be pre-selected.\n+*Cufflinks*\n \n-**Attributions**\n-\n-rna_star - see the web site at rna_star_\n+.. class:: infomark\n \n-For details, please see the rna_starMS_\n-"STAR: ultrafast universal RNA-seq aligner"\n-A. Dobin et al, Bioinformatics 2012; doi: 10.1093/bioinformatics/bts635\n+ Cufflinks is not considered to be the best tool for use downstream of STAR\n+ anymore. Consider using *Stringtie* instead, which also should pose no\n+ compatibility issues.\n \n-Galaxy_ (that\'s what you are using right now!) for gluing everything together\n-\n-Most of the work for this wrapper XML is Jeremy Goecks\' original STAR wrapper\n+To avoid compatibility issues with Cufflinks you should:\n \n-Minor tweaks to output names to suit our downstream purposes, toolshed automated dependencies\n-and odds and ends of other code and documentation comprising this tool was\n-written by Ross Lazarus and that part is licensed_ the same way as other rgenetics artefacts\n+- select **XS** as a *Read alignment tag to include in the BAM output* if (and\n+ only if) your sequenced reads come from an unstranded library prep\n+- *not* select the *jM* and *jI* tags for inclusion\n+- keep the **HI** tag selected and\n+- select *HI tag values should be* **zero-based**\n+- exclude **All alignments across non-canonical junctions** under *Output\n+ filter criteria -> Exclude the following records from the BAM output*\n+\n+-----\n \n-.. _licensed: http://creativecommons.org/licenses/by-nc-nd/3.0/\n+Attribution\n+\n+Minor tweaks to output names to suit downstream purposes, toolshed automated\n+dependencies and odds and ends of other code and documentation comprising\n+this tool were originally written by Ross Lazarus and have been licensed under\n+the creative commons\n+`BY-NC_ND 3.0 license <http://creativecommons.org/licenses/by-nc-nd/3.0/>`__.\n+\n+.. _STAR: https://github.com/alexdobin/STAR\n .. _STAR-Fusion: https://github.com/STAR-Fusion/STAR-Fusion\n-.. _recommended: https://github.com/STAR-Fusion/STAR-Fusion/wiki#alternatively-running-star-yourself-and-then-running-star-fusion-using-the-existing-outputs\n-.. _rna_star: https://github.com/alexdobin/STAR\n-.. _rna_starMS: http://bioinformatics.oxfordjournals.org/content/29/1/15.full\n-.. _Galaxy: http://getgalaxy.org\n- </help>\n+.. _recommended: https://github.com/STAR-Fusion/STAR-Fusion/wiki#alternatively-kickstart-mode-running-star-yourself-and-then-running-star-fusion-using-the-existing-outputs\n+ ]]></help>\n <expand macro="citations"/>\n </tool>\n' |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/41737_R1.fastq.sub240k.gz |
| b |
| Binary file test-data/41737_R1.fastq.sub240k.gz has changed |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/41737_R2.fastq.sub240k.gz |
| b |
| Binary file test-data/41737_R2.fastq.sub240k.gz has changed |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/737K-august-2016.small.txt.gz |
| b |
| Binary file test-data/737K-august-2016.small.txt.gz has changed |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/SNORD83B.22.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/SNORD83B.22.fa Thu Aug 15 01:54:13 2019 -0400 |
| b |
| @@ -0,0 +1,17 @@ +>22 dna:chromosome chromosome:GRCh38:22:39313740:50818468:1 REF +CACACTCAAAGCAGCAAACAGCCCAGCAAGGCCAGACTGGGAATTTCCTCATCTCAGGAC +TTCAAAGCCAGTGTGAAAGGACTGCCAACACCCTCTCCTTCCTTTCCTCTCCCACCACAG +GGCCACCAGCGTCTGTGGCCTTGGATCCTCCCTCTACAAGAGCCCCCCCATGACAAGTCA +GGACCTGCCTCACCTTGCGGAGGGTGAGCACCCGCTTCTTGGTTCCCACCACACAGCCTT +TCAGCATGACAAAGTCATTGGTCACTTCACCATAGTGGACAAAGCCACCCTGGAAAACGA +GCATCGGATCAGCACAGGCCCAGGAGGGGATTGTCGTGCAGATGACCCCTCCAGGTTCAG +GCCCTCCCTGACCACAGGGCTGTTCTCAGAAGGAAGGCAACAAGGAACGGTTCCGCAGTC +TGTCTCGGGCGCTGTGCCCAGCGCACATTCCAGGCCTCATCACTGAACAGCTGAGCCTGA +GACCCCACTTCTCACCAGCCAACCCCGACGAGTGGACTCAGATGACAACATGCCACTTAC +AAGGGACACAGCTAGGTGTTGTGTTGGCTTCAGTTAACGATCCTGCTAGCAGCCCCTAGG +AAGCAGCCTATCCCCAAAAGCACGAGGCCTGGGATGGCCTCACAGAGCAGAACACCCATT +ACTTACCAGAGGGTTGATGCTCTTGTCAGATAGGTCATAGTCAGTGGAGGCATTGTTCTT +GATCAGCTTGCCGTCCTTGATAAGGTAGCCCTGGCCAATCTTATAAATCTGAATGAACAA +GAAGGGTGTAAGGCTGGGGCATTAGGGACAAATAACCCAGACATGCCAGTGTGCTGACCT +GCAAAGCACGCTAGAAGGCAGCTGAGGCCTCAGTCCCAGTCACAGCGTATCCCAAGGTCA +GAGCAAAAAGCTGGCTGGCCCTCCAGGTTCCTTTCTGTAAGGCGGCTGGGCTAAAACTAA \ No newline at end of file |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/SNORD83B.22.gtf --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/SNORD83B.22.gtf Thu Aug 15 01:54:13 2019 -0400 |
| b |
| @@ -0,0 +1,8 @@ +#!genome-build GRCh38.p12 +#!genome-version GRCh38 +#!genome-date 2013-12 +#!genome-build-accession NCBI:GCA_000001405.27 +#!genebuild-last-updated 2018-11 +22 ensembl gene 39313819 39313911 . - . gene_id "ENSG00000209480"; gene_version "1"; gene_name "SNORD83B"; gene_source "ensembl"; gene_biotype "snoRNA"; +22 ensembl transcript 39313819 39313911 . - . gene_id "ENSG00000209480"; gene_version "1"; transcript_id "ENST00000386745"; transcript_version "1"; gene_name "SNORD83B"; gene_source "ensembl"; gene_biotype "snoRNA"; transcript_name "SNORD83B-201"; transcript_source "ensembl"; transcript_biotype "snoRNA"; tag "basic"; transcript_support_level "NA"; +22 ensembl exon 39313819 39313911 . - . gene_id "ENSG00000209480"; gene_version "1"; transcript_id "ENST00000386745"; transcript_version "1"; exon_number "1"; gene_name "SNORD83B"; gene_source "ensembl"; gene_biotype "snoRNA"; transcript_name "SNORD83B-201"; transcript_source "ensembl"; transcript_biotype "snoRNA"; exon_id "ENSE00001501751"; exon_version "1"; tag "basic"; transcript_support_level "NA"; |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/rnastar_index2_versioned.loc --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnastar_index2_versioned.loc Thu Aug 15 01:54:13 2019 -0400 |
| b |
| @@ -0,0 +1,4 @@ +##STAR versioned indexes +#build_id dbkey display_name path with_gene_model version +000 ? test_index ${__HERE__}/test-cache/tophat-test 0 2.7.1a +001 ? test_index2 ${__HERE__}/test-cache/tophat-test 1 2.7.1a |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/rnastar_test.log --- a/test-data/rnastar_test.log Thu Mar 14 16:12:38 2019 -0400 +++ b/test-data/rnastar_test.log Thu Aug 15 01:54:13 2019 -0400 |
| b |
| @@ -1,7 +1,7 @@ - Started job on | Mar 01 15:54:22 - Started mapping on | Mar 01 15:54:25 - Finished on | Mar 01 15:54:25 - Mapping speed, Million of reads per hour | inf + Started job on | .* + Started mapping on | .* + Finished on | .* + Mapping speed, Million of reads per hour | .* Number of input reads | 100 Average input read length | 75 |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/rnastar_test2.log --- a/test-data/rnastar_test2.log Thu Mar 14 16:12:38 2019 -0400 +++ b/test-data/rnastar_test2.log Thu Aug 15 01:54:13 2019 -0400 |
| b |
| @@ -1,7 +1,7 @@ - Started job on | Mar 01 15:53:05 - Started mapping on | Mar 01 15:53:08 - Finished on | Mar 01 15:53:08 - Mapping speed, Million of reads per hour | inf + Started job on | .* + Started mapping on | .* + Finished on | .* + Mapping speed, Million of reads per hour | .* Number of input reads | 100 Average input read length | 75 |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/rnastar_test2_mapped_reads.bam |
| b |
| Binary file test-data/rnastar_test2_mapped_reads.bam has changed |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/rnastar_test_mapped_reads.bam |
| b |
| Binary file test-data/rnastar_test_mapped_reads.bam has changed |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/rnastar_test_mapped_reads_twopass.bam |
| b |
| Binary file test-data/rnastar_test_mapped_reads_twopass.bam has changed |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/rnastar_test_transcriptome_mapped_reads.bam |
| b |
| Binary file test-data/rnastar_test_transcriptome_mapped_reads.bam has changed |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/rnastar_test_twopass.log --- a/test-data/rnastar_test_twopass.log Thu Mar 14 16:12:38 2019 -0400 +++ b/test-data/rnastar_test_twopass.log Thu Aug 15 01:54:13 2019 -0400 |
| b |
| @@ -1,7 +1,7 @@ - Started job on | Feb 12 11:19:46 - Started mapping on | Feb 12 11:20:03 - Finished on | Feb 12 11:20:03 - Mapping speed, Million of reads per hour | inf + Started job on | .* + Started mapping on | .* + Finished on | .* + Mapping speed, Million of reads per hour | .* Number of input reads | 100 Average input read length | 75 |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/test-cache/tophat-test/Genome |
| b |
| Binary file test-data/test-cache/tophat-test/Genome has changed |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/test-cache/tophat-test/SA |
| b |
| Binary file test-data/test-cache/tophat-test/SA has changed |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/test-cache/tophat-test/SAindex |
| b |
| Binary file test-data/test-cache/tophat-test/SAindex has changed |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/test-cache/tophat-test/chrLength.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-cache/tophat-test/chrLength.txt Thu Aug 15 01:54:13 2019 -0400 |
| b |
| @@ -0,0 +1,1 @@ +650 |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/test-cache/tophat-test/chrName.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-cache/tophat-test/chrName.txt Thu Aug 15 01:54:13 2019 -0400 |
| b |
| @@ -0,0 +1,1 @@ +test_chromosome |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/test-cache/tophat-test/chrNameLength.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-cache/tophat-test/chrNameLength.txt Thu Aug 15 01:54:13 2019 -0400 |
| b |
| @@ -0,0 +1,1 @@ +test_chromosome 650 |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/test-cache/tophat-test/chrStart.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-cache/tophat-test/chrStart.txt Thu Aug 15 01:54:13 2019 -0400 |
| b |
| @@ -0,0 +1,2 @@ +0 +262144 |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/test-cache/tophat-test/genomeParameters.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-cache/tophat-test/genomeParameters.txt Thu Aug 15 01:54:13 2019 -0400 |
| b |
| @@ -0,0 +1,16 @@ +### STAR --runMode genomeGenerate --genomeDir test-cache/tophat_test/ --genomeFastaFiles tophat_test.fa --genomeSAindexNbases 5 +### GstrandBit 32 +versionGenome 2.7.1a +genomeFastaFiles tophat_test.fa +genomeSAindexNbases 5 +genomeChrBinNbits 18 +genomeSAsparseD 1 +sjdbOverhang 0 +sjdbFileChrStartEnd - +sjdbGTFfile - +sjdbGTFchrPrefix - +sjdbGTFfeatureExon exon +sjdbGTFtagExonParentTranscript transcript_id +sjdbGTFtagExonParentGene gene_id +sjdbInsertSave Basic +genomeFileSizes 262144 5366 |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e test-data/test3.chimjunc.tabular --- a/test-data/test3.chimjunc.tabular Thu Mar 14 16:12:38 2019 -0400 +++ b/test-data/test3.chimjunc.tabular Thu Aug 15 01:54:13 2019 -0400 |
| b |
| @@ -1,24 +1,27 @@ -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_60 181 60M15S 241 60S15M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_62 183 58M17S 241 58S17M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_64 185 56M19S 241 56S19M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_66 187 54M21S 241 54S21M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_68 189 52M23S 241 52S23M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_70 191 50M25S 241 50S25M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_72 193 48M27S 241 48S27M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_74 195 46M29S 241 46S29M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_76 197 44M31S 241 44S31M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_78 199 42M33S 241 42S33M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_80 201 40M35S 241 40S35M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_82 203 38M37S 241 38S37M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_84 205 36M39S 241 36S39M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_86 207 34M41S 241 34S41M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_88 209 32M43S 241 32S43M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_90 211 30M45S 241 30S45M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_92 213 28M47S 241 28S47M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_94 215 26M49S 241 26S49M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_96 217 24M51S 241 24S51M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_98 219 22M53S 241 22S53M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_100 221 20M55S 241 20S55M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_102 223 18M57S 241 18S57M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_104 225 16M59S 241 16S59M -chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_106 227 14M61S 241 14S61M +chr_donorA brkpt_donorA strand_donorA chr_acceptorB brkpt_acceptorB strand_acceptorB junction_type repeat_left_lenA repeat_right_lenB read_name start_alnA cigar_alnA start_alnB cigar_alnB num_chim_aln max_poss_aln_score non_chim_aln_score this_chim_aln_score bestall_chim_aln_score PEmerged_bool readgrp +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_60 181 60M15S 241 60S15M 1 75 59 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_62 183 58M17S 241 58S17M 1 75 57 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_64 185 56M19S 241 56S19M 1 75 55 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_66 187 54M21S 241 54S21M 1 75 53 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_68 189 52M23S 241 52S23M 1 75 51 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_70 191 50M25S 241 50S25M 1 75 49 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_72 193 48M27S 241 48S27M 1 75 47 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_74 195 46M29S 241 46S29M 1 75 45 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_76 197 44M31S 241 44S31M 1 75 43 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_78 199 42M33S 241 42S33M 1 75 41 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_80 201 40M35S 241 40S35M 1 75 39 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_82 203 38M37S 241 38S37M 1 75 37 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_84 205 36M39S 241 36S39M 1 75 38 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_86 207 34M41S 241 34S41M 1 75 40 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_88 209 32M43S 241 32S43M 1 75 42 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_90 211 30M45S 241 30S45M 1 75 44 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_92 213 28M47S 241 28S47M 1 75 46 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_94 215 26M49S 241 26S49M 1 75 48 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_96 217 24M51S 241 24S51M 1 75 50 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_98 219 22M53S 241 22S53M 1 75 52 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_100 221 20M55S 241 20S55M 1 75 54 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_102 223 18M57S 241 18S57M 1 75 56 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_104 225 16M59S 241 16S59M 1 75 58 72 72 0 +chr1 241 + chr2 240 + 0 0 0 test_chimeric_mRNA_106 227 14M61S 241 14S61M 1 75 60 72 72 0 +# 2.7.2a STAR --runThreadN 1 --genomeLoad NoSharedMemory --genomeDir tempstargenomedir @ --readFilesIn /tmp/tmpTNNe38/files/2/7/0/dataset_2700161e-e03d-4a50-9bc8-1508ff059881.dat --readFilesCommand zcat --outSAMtype BAM SortedByCoordinate --twopassMode None --quantMode - --outSAMstrandField intronMotif --outSAMattrIHstart 1 --outSAMattributes NH HI AS nM NM MD jM jI MC ch --outSAMprimaryFlag OneBestScore --outSAMmapqUnique 255 --outSAMunmapped Within --chimSegmentMin 12 --chimJunctionOverhangMin 12 --alignSJDBoverhangMin 10 --alignMatesGapMax 100000 --alignIntronMax 100000 --chimSegmentReadGapMax 3 --alignSJstitchMismatchNmax 5 -1 5 5 --peOverlapNbasesMin 12 --peOverlapMMp 0.1 --chimMultimapScoreRange 10 --chimMultimapNmax 10 --chimNonchimScoreDropMin 10 --outBAMsortingThreadN 1 --outBAMsortingBinsN 50 --limitBAMsortRAM 0 --chimOutType Junctions --chimOutJunctionFormat 1 +# Nreads 83 NreadsUnique 72 NreadsMulti 0 |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e tool-data/rnastar_index2.loc.sample --- a/tool-data/rnastar_index2.loc.sample Thu Mar 14 16:12:38 2019 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| b |
| @@ -1,23 +0,0 @@ -#This is a sample file distributed with Galaxy that enables tools -#to use a directory of rna-star indexed sequences data files. You will -#need to create these data files and then create a rnastar_index2.loc -#file similar to this one (store it in this directory) that points to -#the directories in which those files are stored. The rnastar_index2.loc -#file has this format (longer white space characters are TAB characters): -# -#<unique_build_id> <dbkey> <display_name> <file_base_path> <withGTF> -# -#The <with_gtf> column should be 1 or 0, indicating whether the index was made -#with an annotation (i.e., --sjdbGTFfile and --sjdbOverhang were used) or not, -#respecively. -# -#Note that STAR indices can become quite large. Consequently, it is only -#advisable to create indices with annotations if it's known ahead of time that -#(A) the annotations won't be frequently updated and (B) the read lengths used -#will also rarely vary. If either of these is not the case, it's advisable to -#create indices without annotations and then specify an annotation file and -#maximum read length (minus 1) when running STAR. -# -#hg19 hg19 hg19 full /mnt/galaxyIndices/genomes/hg19/rnastar 0 -#hg19Ensembl hg19Ensembl hg19 full with Ensembl annotation /mnt/galaxyIndices/genomes/hg19Ensembl/rnastar 1 - |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e tool-data/rnastar_index2_versioned.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/rnastar_index2_versioned.loc.sample Thu Aug 15 01:54:13 2019 -0400 |
| b |
| @@ -0,0 +1,26 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of rna-star indexed sequences data files. You will +#need to create these data files and then create a rnastar_index2.loc +#file similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The rnastar_index2.loc +#file has this format (longer white space characters are TAB characters): +# +#<unique_build_id> <dbkey> <display_name> <file_base_path> <with_gene_model> <version> +# +#The <with_gene_model> column should be 1 or 0, indicating whether the index +#was built with annotations (i.e., --sjdbGTFfile and --sjdbOverhang were used) +#or not. +# +#The <version> column indicates the STAR version that introduced the format of +#the index, i.e., the oldest STAR version that could make use of the index. +# +#Note that STAR indices can become quite large. Consequently, it is only +#advisable to create indices with annotations if it's known ahead of time that +#(A) the annotations won't be frequently updated and (B) the read lengths used +#will also rarely vary. If either of these is not the case, it's advisable to +#create indices without annotations and then specify an annotation file and +#maximum read length (minus 1) when running STAR. +# +#hg19 hg19 hg19 full /mnt/galaxyIndices/genomes/hg19/rnastar 0 2.7.1a +#hg19Ensembl hg19Ensembl hg19 full with Ensembl annotation /mnt/galaxyIndices/genomes/hg19Ensembl/rnastar 1 2.7.1a + |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e tool_data_table_conf.xml.sample --- a/tool_data_table_conf.xml.sample Thu Mar 14 16:12:38 2019 -0400 +++ b/tool_data_table_conf.xml.sample Thu Aug 15 01:54:13 2019 -0400 |
| b |
| @@ -1,7 +1,6 @@ -<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> <tables> - <table name="rnastar_index2" comment_char="#" allow_duplicate_entries="False"> - <columns>value, dbkey, name, path, with-gtf</columns> - <file path="tool-data/rnastar_index2.loc" /> + <table name="rnastar_index2_versioned" comment_char="#" allow_duplicate_entries="False"> + <columns>value, dbkey, name, path, with-gtf, version</columns> + <file path="tool-data/rnastar_index2_versioned.loc" /> </table> </tables> |
| b |
| diff -r 0a563fd2f22e -r d82339e37e8e tool_data_table_conf.xml.test --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.test Thu Aug 15 01:54:13 2019 -0400 |
| b |
| @@ -0,0 +1,7 @@ +<tables> + <!-- Location of rnastar indexes for testing --> + <table name="rnastar_index2_versioned" comment_char="#" allow_duplicate_entries="False"> + <columns>value, dbkey, name, path, with-gtf, version</columns> + <file path="${__HERE__}/test-data/rnastar_index2_versioned.loc" /> + </table> +</tables> |