| Previous changeset 7:0933ec7e03fd (2019-10-24) Next changeset 9:6b6453e9da44 (2019-11-08) |
|
Commit message:
Add missing zenodo link |
|
added:
glassgo_wrapper.xml |
| b |
| diff -r 0933ec7e03fd -r d8237aeeb694 glassgo_wrapper.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/glassgo_wrapper.xml Thu Oct 24 17:29:24 2019 -0400 |
| [ |
| b'@@ -0,0 +1,217 @@\n+<tool id="glassgo" name="GLASSgo" version="@VERSION@">\r\n+ <description>sRNA homolog finder</description>\r\n+ <macros>\r\n+ <import>glassgo_macros.xml</import>\r\n+ </macros>\r\n+ <expand macro="requirements"/>\r\n+ <command detect_errors="aggressive">\r\n+ <![CDATA[\r\n+ GLASSgo.py\r\n+ -t \\${GALAXY_SLOTS:-Z} \r\n+ -i ${input_data.input} \r\n+ -d ${input_data.database}\r\n+ #if str($search.cond_param_setup.param_setup) == "manual":\r\n+ -e ${search.cond_param_setup.evalue}\r\n+ -p ${search.cond_param_setup.identity}\r\n+ #end if\r\n+ -u ${additional_setting.upstream_region}\r\n+ #if str($search.cond_taxon_setup.taxon_setup) == "acclist":\r\n+ -g ${search.cond_taxon_setup.acclist}\r\n+ #end if\r\n+ -n 500\r\n+ -o $output\r\n+ ]]> \r\n+ </command>\r\n+ <inputs>\r\n+ <section name="input_data" title="Input" expanded="true">\r\n+ <param name="input" type="data" format="fasta" label="Query sRNA in FASTA" />\r\n+ <param name="database" type="select" display="radio" label="NCBI-nt database">\r\n+ <options from_file="blastdb.loc">\r\n+ <column name="name" index="1"/>\r\n+ <column name="value" index="2"/>\r\n+\t\t <filter type="regexp" value="nt_.*" column="0" />\r\n+ </options>\r\n+ </param>\r\n+ </section>\r\n+ <section name="search" title="Search Parameters" expanded="true">\r\n+ <conditional name="cond_taxon_setup">\r\n+ <param name="taxon_setup" type="select" label="Taxon Selection">\r\n+ <option value="global">global search</option>\r\n+ <option value="acc">accession list from user history</option>\r\n+ </param>\r\n+ <when value="acc">\r\n+ <param name="acclist" type="data" format="txt" label="Accession List" /> \r\n+ </when>\r\n+ </conditional>\r\n+ <conditional name="cond_param_setup">\r\n+ <param name="param_setup" type="select" display="radio" label="Parameter Setup">\r\n+ <option value="automatic">automatic</option>\r\n+ <option value="manual">manual</option>\r\n+ </param>\r\n+ <when value="manual">\r\n+ <param name="evalue" type="float" value="1.0" label="Maximum allowed E-Value" />\r\n+ <param name="identity" type="integer" value="52" label="Minimum allowed identity [%]" /> \r\n+ <conditional name="cond_clust_setup">\r\n+ <param name="clust_setup" type="select" display="radio" label="Structure-based clustering">\r\n+ <option value="off">off</option>\r\n+ <option value="on">on</option>\r\n+ </param>\r\n+ <when value="on">\r\n+ <section name="clustering" title="Structure-based Clustering" expanded="true">\r\n+ <conditional name="conditional_filtering_setup">\r\n+ <param name="filtering_setup" type="select" display="radio" label="Structure-based filtering">\r\n+ <option value="automatic">automatic</option>\r\n+ <option value="manual">manual</option>\r\n+ </param>\r\n+ <when value="manual">\r\n+ <param name="filtering" type="integer" value="2" label="manual value for filtering" /> \r\n+ </when>\r\n+ </conditional>\r\n+ </section>\r\n+ '..b'dition, the FASTA header (e.g. start position) for each GLASSgo hit will be updated (if upstream region is activated), whereas \r\n+ the upstream region is additionally mentioned like -UTR-REGION-100nt:1002422-1002521-. You can find further information about the GLASSgo results in the output help \r\n+ section. (0 == no consideration). \r\n+\r\n+\r\n+**Output Description**\r\n+\r\n+The output of GLASSgo is a file in multi-FASTA format where the input sequence (query) is followed by the identified homologs. If no homologs could be found, only the input sequence is shown. In the following the output format will be discussed using two examples. Both examples show a partial result of GLASSgo applying EcpR1. In the first example,the upstream region was turned off while the value for the upstream region was set to 100 nt for the second. For this very reason, the headers as well as the sequence sizes are unequal.\r\n+\r\n+The following header shows the Accession number of the respective genome followed by the genomic coordinates of the proposed sRNA homolog (no upstream region included).\r\n+\r\n+>CP013051.1:1422247-1422417 Sinorhizobium americanum CCGM7, complete genome-p.c.VAL:80.75%-taxID:1408224\r\n+AAAGGAAGTGAGACTTCCACGATCGATCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCTTCCGACATCCGCGGATTCCTCGTGCCGCAGTCGGAGCCAGCCGACCCCCTTTCAAAACGCCGCTTCAAAAGAGGCGGCGTTT\r\n+\r\n+In contrast, the next header shows the genomic coordinates of the combined upstream region (100nt) and the proposed sRNA. The exact coordinates of the upstream region are given later in the header (UPSTREAM-REGION-100nt:1422147-1422246).\r\n+\r\n+>CP013051.1:1422147-1422417 Sinorhizobium americanum CCGM7, complete genome-UPSTREAM-REGION-100nt:1422147-1422246-p.c.VAL:80.75%-taxID:1408224\r\n+ATTTGTCCGAATACGAGACAGAATTAACCAAACGCCGAGCAACCCGCTTCGGCGATTAAGAATTCGTTGATTTTTTTTTATTTTCAAGCAATGCTGATATAAAGGAAGTGAGACTTCCACGATCGATCGGTTACCCCATGATGCTCAGGTCCGCCGCATCTCCTGGGTCGTGGGGTCGGTCGGCTGGCTTCCGACATCCGCGGATTCCTCGTGCCGCAGTCGGAGCCAGCCGACCCCCTTTCAAAACGCCGCTTCAAAAGAGGCGGCGTTT\r\n+\r\n+Both examples contain the name of the genome entry and a pairwise similarity value of p.c.Val:80.75% (query vs. GLASSgo hit ) as well as their corresponding taxonomic number taxID:1408224. \r\n+\r\n+]]>\r\n+ </help>\r\n+ <citations>\r\n+ <citation type="bibtex">\r\n+ @article{10.3389/fgene.2018.00124,\r\n+ author={Lott, Steffen C. and Sch\xc3\xa4fer, Richard A. and Mann, Martin and Backofen, Rolf and Hess, Wolfgang R. and Vo\xc3\x9f, Bj\xc3\xb6rn and Georg, Jens}, \r\n+ title={GLASSgo \xe2\x80\x93 Automated and Reliable Detection of sRNA Homologs From a Single Input Sequence}, \r\n+ journal={Frontiers in Genetics}, \r\n+ volume={9}, \r\n+ pages={124}, \r\n+ year={2018}, \r\n+ url={https://www.frontiersin.org/article/10.3389/fgene.2018.00124}, \r\n+ doi={10.3389/fgene.2018.00124}\r\n+ }\r\n+ </citation>\r\n+ <citation type="bibtex">\r\n+ @article{Raden-2018-websrv,\r\n+ author = {Raden, Martin and Ali, Syed M and Alkhnbashi, Omer S and Busch, Anke and Costa, Fabrizio and Davis, Jason A and Eggenhofer, Florian and Gelhausen, \r\n+ Rick and Georg, Jens and Heyne, Steffen and Hiller, Michael and Kundu, Kousik and Kleinkauf, Robert and Lott, Steffen C and Mohamed, Mostafa M and Mattheis, \r\n+ Alexander and Miladi, Milad and Richter, Andreas S and Will, Sebastian and Wolff, Joachim and Wright, Patrick R and Backofen, Rolf},\r\n+ title = {{Freiburg} {RNA} {tools}: a central online resource for {RNA}-focused research and teaching},\r\n+ journal = {Nucleic Acids Research},\r\n+ volume = {46},\r\n+ number = {W1},\r\n+ pages = {W25-W29},\r\n+ year = {2018},\r\n+ doi = {10.1093/nar/gky329}\r\n+ }\r\n+ </citation>\r\n+ </citations>\r\n+\r\n+\r\n+</tool>\r\n' |