| Previous changeset 1:ae06af1118dc (2014-11-17) Next changeset 3:81f97e12e573 (2015-03-20) |
|
Commit message:
Uploaded |
|
modified:
test-data/tophat2_out3j.bed test-data/tophat2_out4j.bed tool_dependencies.xml tophat2_wrapper.xml |
|
added:
test-data/bowtie2/tophat_test.1.bt2 test-data/bowtie2/tophat_test.2.bt2 test-data/bowtie2/tophat_test.3.bt2 test-data/bowtie2/tophat_test.4.bt2 test-data/bowtie2/tophat_test.fa test-data/bowtie2/tophat_test.rev.1.bt2 test-data/bowtie2/tophat_test.rev.2.bt2 test-data/bowtie2_indices.loc tool_data_table_conf.xml.test |
| b |
| diff -r ae06af1118dc -r da1f39fe14bc test-data/bowtie2/tophat_test.1.bt2 |
| b |
| Binary file test-data/bowtie2/tophat_test.1.bt2 has changed |
| b |
| diff -r ae06af1118dc -r da1f39fe14bc test-data/bowtie2/tophat_test.2.bt2 |
| b |
| Binary file test-data/bowtie2/tophat_test.2.bt2 has changed |
| b |
| diff -r ae06af1118dc -r da1f39fe14bc test-data/bowtie2/tophat_test.3.bt2 |
| b |
| Binary file test-data/bowtie2/tophat_test.3.bt2 has changed |
| b |
| diff -r ae06af1118dc -r da1f39fe14bc test-data/bowtie2/tophat_test.4.bt2 |
| b |
| Binary file test-data/bowtie2/tophat_test.4.bt2 has changed |
| b |
| diff -r ae06af1118dc -r da1f39fe14bc test-data/bowtie2/tophat_test.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bowtie2/tophat_test.fa Thu Dec 18 13:56:31 2014 -0500 |
| b |
| @@ -0,0 +1,14 @@ +>test_chromosome +AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA +ACTACTATCTGACTAGACTGGAGGCGCTTGCGACTGAGCTAGGACGTGCC +ACTACGGGGATGACGACTAGGACTACGGACGGACTTAGAGCGTCAGATGC +AGCGACTGGACTATTTAGGACGATCGGACTGAGGAGGGCAGTAGGACGCT +ACGTATTTGGCGCGCGGCGCTACGGCTGAGCGTCGAGCTTGCGATACGCC +GTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA +AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG +ACTATTACTTTATTATCTTACTCGGACGTAGACGGATCGGCAACGGGACT +GTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA +AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG +TTTTCTACTTGAGACTGGGATCGAGGCGGACTTTTTAGGACGGGACTTGC +AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA +AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| b |
| diff -r ae06af1118dc -r da1f39fe14bc test-data/bowtie2/tophat_test.rev.1.bt2 |
| b |
| Binary file test-data/bowtie2/tophat_test.rev.1.bt2 has changed |
| b |
| diff -r ae06af1118dc -r da1f39fe14bc test-data/bowtie2/tophat_test.rev.2.bt2 |
| b |
| Binary file test-data/bowtie2/tophat_test.rev.2.bt2 has changed |
| b |
| diff -r ae06af1118dc -r da1f39fe14bc test-data/bowtie2_indices.loc --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bowtie2_indices.loc Thu Dec 18 13:56:31 2014 -0500 |
| b |
| @@ -0,0 +1,1 @@ +tophat_test tophat_test tophat_test ${__HERE__}/bowtie2/tophat_test |
| b |
| diff -r ae06af1118dc -r da1f39fe14bc test-data/tophat2_out3j.bed --- a/test-data/tophat2_out3j.bed Mon Nov 17 11:23:41 2014 -0500 +++ b/test-data/tophat2_out3j.bed Thu Dec 18 13:56:31 2014 -0500 |
| b |
| @@ -1,3 +1,3 @@ track name=junctions description="TopHat junctions" -test_chromosome 177 400 JUNC00000001 27 + 177 400 255,0,0 2 73,50 0,173 -test_chromosome 350 550 JUNC00000002 26 + 350 550 255,0,0 2 50,50 0,150 +test_chromosome 180 400 JUNC00000001 19 + 180 400 255,0,0 2 70,50 0,170 +test_chromosome 350 550 JUNC00000002 23 + 350 550 255,0,0 2 50,50 0,150 |
| b |
| diff -r ae06af1118dc -r da1f39fe14bc test-data/tophat2_out4j.bed --- a/test-data/tophat2_out4j.bed Mon Nov 17 11:23:41 2014 -0500 +++ b/test-data/tophat2_out4j.bed Thu Dec 18 13:56:31 2014 -0500 |
| b |
| @@ -1,3 +1,3 @@ track name=junctions description="TopHat junctions" -test_chromosome 177 400 JUNC00000001 51 + 177 400 255,0,0 2 73,50 0,173 -test_chromosome 350 550 JUNC00000002 43 + 350 550 255,0,0 2 50,50 0,150 +test_chromosome 177 400 JUNC00000001 44 + 177 400 255,0,0 2 73,50 0,173 +test_chromosome 350 550 JUNC00000002 42 + 350 550 255,0,0 2 50,50 0,150 |
| b |
| diff -r ae06af1118dc -r da1f39fe14bc tool_data_table_conf.xml.test --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.test Thu Dec 18 13:56:31 2014 -0500 |
| b |
| @@ -0,0 +1,6 @@ +<tables> + <table name="tophat2_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="${__HERE__}/test-data/bowtie2_indices.loc" /> + </table> +</tables> |
| b |
| diff -r ae06af1118dc -r da1f39fe14bc tool_dependencies.xml --- a/tool_dependencies.xml Mon Nov 17 11:23:41 2014 -0500 +++ b/tool_dependencies.xml Thu Dec 18 13:56:31 2014 -0500 |
| b |
| @@ -1,12 +1,12 @@ <?xml version="1.0"?> <tool_dependency> <package name="bowtie2" version="2.1.0"> - <repository changeset_revision="017a00c265f1" name="package_bowtie2_2_1_0" owner="devteam" prior_installation_required="False" toolshed="http://toolshed.g2.bx.psu.edu" /> + <repository changeset_revision="017a00c265f1" name="package_bowtie2_2_1_0" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" /> </package> <package name="samtools" version="0.1.18"> - <repository changeset_revision="171cd8bc208d" name="package_samtools_0_1_18" owner="devteam" prior_installation_required="False" toolshed="http://toolshed.g2.bx.psu.edu" /> + <repository changeset_revision="171cd8bc208d" name="package_samtools_0_1_18" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" /> </package> <package name="tophat2" version="2.0.9"> - <repository changeset_revision="8549fd545473" name="package_tophat2_2_0_9" owner="devteam" prior_installation_required="False" toolshed="http://toolshed.g2.bx.psu.edu" /> + <repository changeset_revision="8549fd545473" name="package_tophat2_2_0_9" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" /> </package> </tool_dependency> |
| b |
| diff -r ae06af1118dc -r da1f39fe14bc tophat2_wrapper.xml --- a/tophat2_wrapper.xml Mon Nov 17 11:23:41 2014 -0500 +++ b/tophat2_wrapper.xml Thu Dec 18 13:56:31 2014 -0500 |
| b |
| b'@@ -1,4 +1,4 @@\n-<tool id="tophat2" name="Tophat2" version="0.6">\n+<tool id="tophat2" name="Tophat2" version="0.7">\n <!-- Wrapper compatible with Tophat version 2.0.0+ -->\n <description>Gapped-read mapper for RNA-seq data</description>\n <version_command>tophat2 --version</version_command>\n@@ -111,7 +111,7 @@\n #end if\n \n ## Set index path, inputs and parameters specific to paired data.\n- #if $singlePaired.sPaired == "paired"\n+ #if $singlePaired.sPaired != "single"\n -r $singlePaired.mate_inner_distance\n --mate-std-dev=$singlePaired.mate_std_dev\n \n@@ -119,9 +119,13 @@\n --no-discordant\n #end if\n \n- ${index_path} $singlePaired.input1 $singlePaired.input2\n+ #if $singlePaired.sPaired == "paired"\n+ ${index_path} "$singlePaired.input1" "$singlePaired.input2"\n+ #else\n+ ${index_path} "$singlePaired.input.forward" "$singlePaired.input.reverse"\n+ #end if\n #else\n- ${index_path} $singlePaired.input1\n+ ${index_path} "$singlePaired.input1"\n #end if\n </command>\n \n@@ -129,7 +133,8 @@\n <conditional name="singlePaired">\n <param name="sPaired" type="select" label="Is this library mate-paired?">\n <option value="single">Single-end</option>\n- <option value="paired">Paired-end</option>\n+ <option value="paired">Paired-end (as individual datasets)</option>\n+ <option value="paired_collection">Paired-end (as collection)</option>\n </param>\n <when value="single">\n <param format="fastqsanger" name="input1" type="data" label="RNA-Seq FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33"/>\n@@ -137,13 +142,11 @@\n <when value="paired">\n <param format="fastqsanger" name="input1" type="data" label="RNA-Seq FASTQ file, forward reads" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" />\n <param format="fastqsanger" name="input2" type="data" label="RNA-Seq FASTQ file, reverse reads" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" />\n- <param name="mate_inner_distance" type="integer" value="300" label="Mean Inner Distance between Mate Pairs" />\n- <param name="mate_std_dev" type="integer" value="20" label="Std. Dev for Distance between Mate Pairs" help="The standard deviation for the distribution on inner distances between mate pairs."/>\n- <!-- Discordant pairs. -->\n- <param name="report_discordant_pairs" type="select" label="Report discordant pair alignments?">\n- <option value="No">No</option>\n- <option selected="True" value="Yes">Yes</option>\n- </param>\n+ <expand macro="paired_parameters" />\n+ </when>\n+ <when value="paired_collection">\n+ <param format="fastqsanger" name="input" type="data_collection" collection_type="paired" label="RNA-Seq FASTQ paired reads" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" />\n+ <expand macro="paired_parameters" />\n </when>\n </conditional>\n <expand macro="refGenomeSourceConditional">\n@@ -293,6 +296,15 @@\n \n <macros>\n <import>tophat_macros.xml</import>\n+ <xml name="paired_parameters">\n+ <param name="mate_inner_distance" type="integer" value="300" label="Mean Inner Distance between Mate Pairs" />\n+ <param name="mate_std_dev" type="integer" value="20" label="Std. Dev for Distance between Mate Pairs" help="The standard deviation for the distribution on inner distances between mate pairs."/>\n+ <!-- Discordant pairs. -->\n+ <param name="report_discordant_pairs" type="selec'..b'earch" value="Yes" />\n- <param name="b2_settings" value="No" />\n- <!-- Fusion search params -->\n- <param name="do_search" value="Yes" /> \n- <param name="anchor_len" value="21" />\n- <param name="min_dist" value="10000021" />\n- <param name="read_mismatches" value="3" />\n- <param name="multireads" value="4" />\n- <param name="multipairs" value="5" />\n- <param name="ignore_chromosomes" value="chrM"/>\n- <param name="specReadGroup" value="No" />\n+ <conditional name="params">\n+ <param name="settingsType" value="full"/>\n+ <param name="library_type" value="FR Unstranded"/>\n+ <param name="read_mismatches" value="5"/>\n+ <!-- Error: the read mismatches (5) and the read gap length (2) should be less than or equal to the read edit dist (2) -->\n+ <param name="read_edit_dist" value="5" />\n+ <param name="bowtie_n" value="Yes"/>\n+ <param name="mate_std_dev" value="20"/>\n+ <param name="anchor_length" value="8"/>\n+ <param name="splice_mismatches" value="0"/>\n+ <param name="min_intron_length" value="70"/>\n+ <param name="max_intron_length" value="500000"/>\n+ <param name="max_multihits" value="40"/>\n+ <param name="min_segment_intron" value="50" />\n+ <param name="max_segment_intron" value="500000" />\n+ <param name="seg_mismatches" value="2"/>\n+ <param name="seg_length" value="25"/>\n+ <conditional name="indel_search">\n+ <param name="allow_indel_search" value="No"/>\n+ </conditional>\n+ <conditional name="own_junctions">\n+ <param name="use_junctions" value="Yes" />\n+ <conditional name="gene_model_ann">\n+ <param name="use_annotations" value="No" />\n+ </conditional>\n+ <conditional name="raw_juncs">\n+ <param name="use_juncs" value="No" />\n+ </conditional>\n+ <conditional name="no_novel_juncs">\n+ <param name="no_novel_juncs" value="No" />\n+ </conditional>\n+ </conditional>\n+ <conditional name="coverage_search">\n+ <param name="use_search" value="No" />\n+ </conditional>\n+ <param name="microexon_search" value="Yes" />\n+ <conditional name="bowtie2_settings">\n+ <param name="b2_settings" value="No" />\n+ </conditional>\n+ <!-- Fusion search params -->\n+ <conditional name="fusion_search">\n+ <param name="do_search" value="Yes" /> \n+ <param name="anchor_len" value="21" />\n+ <param name="min_dist" value="10000021" />\n+ <param name="read_mismatches" value="3" />\n+ <param name="multireads" value="4" />\n+ <param name="multipairs" value="5" />\n+ <param name="ignore_chromosomes" value="chrM"/>\n+ </conditional>\n+ </conditional>\n+ <conditional name="readGroup">\n+ <param name="specReadGroup" value="No" />\n+ </conditional>\n <output name="junctions" file="tophat2_out4j.bed" />\n <output name="accepted_hits" file="tophat_out4h.bam" compare="sim_size" />\n </test>\n </tests>\n-\n <help>\n **Tophat Overview**\n \n@@ -524,4 +598,7 @@\n --min-segment-intron The minimum intron length that may be found during split-segment search. The default is 50.\n --max-segment-intron The maximum intron length that may be found during split-segment search. The default is 500000.\n </help>\n+ <citations>\n+ <citation type="doi">10.1186/gb-2013-14-4-r36</citation>\n+ </citations>\n </tool>\n' |