| Previous changeset 3:039547ad8fb8 (2016-12-16) Next changeset 5:9c0d4ec99ba9 (2018-09-27) |
|
Commit message:
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/segemehl commit b193689f9f30ce65a77be2d2c00929e3335a7d82 |
|
modified:
segemehl.xml test-data/testmap.sam |
|
added:
test-data/testmap2.sam |
|
removed:
tool_dependencies.xml |
| b |
| diff -r 039547ad8fb8 -r db367d012fa3 segemehl.xml --- a/segemehl.xml Fri Dec 16 07:37:24 2016 -0500 +++ b/segemehl.xml Wed Jul 26 15:32:09 2017 -0400 |
| [ |
| b'@@ -1,61 +1,59 @@\n-<tool id="segemehl" name="segemehl" version="0.2.0">\n- <description>based short read aligner</description>\n- <requirements>\n- <requirement type="package" version="0.2.0">segemehl</requirement>\n- </requirements>\n- <stdio>\n- <regex match="Exit forced"\n+<tool id="segemehl" name="segemehl" version="0.2.0.3">\n+ <description>short read mapping with gaps</description>\n+ <requirements>\n+ <requirement type="package" version="0.2.0">segemehl</requirement>\n+ </requirements>\n+ <stdio>\n+ <regex match="Exit forced"\n source="both"\n level="fatal"\n description="Execution halted." />\n- </stdio>\n- <command>\n-<![CDATA[\n+ </stdio>\n+ <command>\n+ <![CDATA[\n ## prepare segemehl index if no reference genome is supplied\n #if $refGenomeSource.genomeSource == "history":\n mkdir ./temp_index/ &&\n-\t #set $temp_index = \'./temp_index/temp.idx\'\n-\t segemehl.x -x $temp_index -d $refGenomeSource.own_reference_genome &&\n+ #set $temp_index = \'./temp_index/temp.idx\'\n+ segemehl.x -x $temp_index -d $refGenomeSource.own_reference_genome &&\n #else:\n #set $temp_index = $refGenomeSource.index.fields.index_path\n #end if\n-\n-\n+ \n ## execute segemehl\n- segemehl.x\n-\n+ segemehl.x\n+ \n ## number of threads\n- -t "\\${GALAXY_SLOTS:-12}"\n-\n+ -t "\\${GALAXY_SLOTS:-12}"\n+ \n #if $refGenomeSource.genomeSource == "history":\n-\t -d $refGenomeSource.own_reference_genome\n+ -d $refGenomeSource.own_reference_genome\n #else:\n -d ${refGenomeSource.index.fields.db_path}\n #end if\n-\n+ \n -i $temp_index\n-\n+ \n ## check for single/pair-end\n #if str( $library.type ) == "single":\n #set $query_list = list()\n- ## prepare inputs\n- #for $fastq in $library.input_query:\n- $query_list.append(\'%s\' % $fastq )\n- #end for\n- -q "#echo \' \'.join( $query_list )#"\n+ ## prepare inputs\n+ #for $fastq in $library.input_query:\n+ $query_list.append(\'%s\' % $fastq )\n+ #end for\n+ -q "#echo \' \'.join( $query_list )#"\n #else\n- ## prepare inputs\n-\n+ ## prepare inputs \n #set $mate1 = list()\n #set $mate2 = list()\n #for $mate_pair in $library.mate_list:\n $mate1.append( str($mate_pair.first_strand_query) )\n $mate2.append( str($mate_pair.second_strand_query) )\n #end for\n-\n+ \n -q #echo \',\'.join($mate1)\n -p #echo \',\'.join($mate2)\n-\n+ \n -I $library.maxinsertsize\n #end if\n -m $minsize\n@@ -67,105 +65,128 @@\n #if str( $prime3 ).strip():\n -Q "$prime3"\n #end if\n- $polyA\n- $autoclip\n- $hardclip\n- $order\n-\t$splits\n+ $polyA\n+ $autoclip\n+ $hardclip\n+ $order\n #if $maxout:\n --maxout $maxout\n #end if\n+ #if str( $splitreads.splits ) == "splits":\n+ --splits\n+ --minsplicecover $splitreads.minsplicecover\n+ --minfragscore $splitreads.minfragscore\n+ --minfraglen $splitreads.minfraglen\n+ --splicescorescale $splitreads.splicescorescale\n+ #end if\n+ -M $maxinterval\n+ -E $evalue\n+ -D $differences\n -s\n-\n- --minsplicecover $minsplicecover\n- --minfragscore $minfragscore\n- --minfraglen $minfraglen\n- --splicescorescale $splicescorescale\n-\n -o \'$segemehl_out\'\n-]]>\n- </command>\n- <inputs>\n- <conditional name="refGenomeSource">\n- <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins'..b' <data format="sam" name="segemehl_out" label="Read alignments on ${on_string}"/>\n- </outputs>\n- <tests>\n- <test>\n-\t<param name="genomeSource" value="history" />\n- <param name="own_reference_genome" value="chr1.fa" />\n-\t<param name="library" value="single" />\n-\t<param name="input_query" value="test.fastq" />\t\n-\t<param name="splits" value="true" />\n- <output name="segemehl_out" file="testmap.sam" lines_diff="2" />\n- </test>\n- </tests>\n- <help>\n-<![CDATA[\n+ help="Report only if this value x score is larger than next best spliced alignment (--splicescorescale)" />\n+ <param name="sevalue" type="float" min="0" value="50.000000" label="max split evalue" help="(--maxsplitevalue)"/>\n+ </when>\n+ <when value="nosplit">\n+ </when> \n+ </conditional>\n+ \n+ <param name="minsize" type="integer" value="12" min="1" label="Minimum size of queries" help="(-m)" />\n+ <param name="maxout" type="integer" min="0" value="0" optional="True" \n+ label="Maximum number of alignments that will be reported" help="(--maxout)" />\n+ <param name="accuracy" type="integer" value="85" min="1" max="100" label="Min percentage of matches per read in semi-global alignment" help="(-A)" />\n+ <param name="hitstrategy" type="select" label="Hits to report?" help="(-H)">\n+ <option value="1">report only best scoring hits</option>\n+ <option value="0">report all scoring hits</option>\n+ </param>\n+ <param name="prime5" type="text" label="add 5\' adapter" help="default: none (-Q)" />\n+ <param name="prime3" type="text" label="add 3\' adapter" help="default: none (-P)"/>\n+ <param name="polyA" type="boolean" truevalue="--polyA" falsevalue="" checked="false" label="Clip polyA tail" help="(-T)"/>\n+ <param name="autoclip" type="boolean" truevalue="--autoclip" falsevalue="" checked="false" label="Autoclip unknown 3prime adapter" help="(-Y)"/>\n+ <param name="hardclip" type="boolean" truevalue="--hardclip" falsevalue="" checked="false" label="Enable hard clipping" help="(-C)"/>\n+ <param name="order" type="boolean" truevalue="--order" falsevalue="" checked="false" label="Sorts the output by chromsome and position" help="(-O)"/>\n+ <param name="differences" type="integer" min="0" value="1" label="search seeds initially with n differences" help="(--differences)"/>\n+ <param name="evalue" type="float" min="0" value="5.000000" label="max evalue" help="(--evalue)"/>\n+ <param name="maxinterval" type="integer" min="1" value="100" label="maximum width of a suffix array interval, i.e. a query seed will be omitted if it matches more than n times" help="(--maxinterval)"/>\n+ </inputs>\n+ <outputs>\n+ <data format="sam" name="segemehl_out" label="Read alignments on ${on_string}"/>\n+ </outputs>\n+ <tests>\n+ <test>\n+ <param name="genomeSource" value="history" />\n+ <param name="own_reference_genome" value="chr1.fa" />\n+ <param name="library" value="single" />\n+ <param name="input_query" value="test.fastq" /> \n+ <param name="splits" value="nosplit" />\n+ <output name="segemehl_out" file="testmap.sam" lines_diff="2" />\n+ </test>\n+ <test>\n+ <param name="genomeSource" value="history" />\n+ <param name="own_reference_genome" value="chr1.fa" />\n+ <param name="library" value="single" />\n+ <param name="input_query" value="test.fastq" /> \n+ <param name="splits" value="splits" />\n+\t <param name="minsplicecover" value="40" />\n+ <output name="segemehl_out" file="testmap2.sam" lines_diff="2" />\n+ </test>\n+ </tests>\n+ <help>\n+ <![CDATA[\n \n .. class:: infomark\n \n@@ -181,9 +202,9 @@\n .. _Segemehl: http://www.bioinf.uni-leipzig.de/Software/segemehl/\n \n \n-]]>\n- </help>\n- <citations>\n- <citation type="doi">10.1371/journal.pcbi.1000502</citation>\n- </citations>\n+ ]]>\n+ </help>\n+ <citations>\n+ <citation type="doi">10.1371/journal.pcbi.1000502</citation>\n+ </citations>\n </tool>\n' |
| b |
| diff -r 039547ad8fb8 -r db367d012fa3 test-data/testmap.sam --- a/test-data/testmap.sam Fri Dec 16 07:37:24 2016 -0500 +++ b/test-data/testmap.sam Wed Jul 26 15:32:09 2017 -0400 |
| [ |
| @@ -1,9 +1,7 @@ @HD VN:1.0 @SQ SN:TestChromosomeForGalaxy LN:3459 -@PG ID:segemehl VN:0.2.0-$Rev: 418 $ ($Date: 2015-01-05 05:17:35 -0500 (Mon, 05 Jan 2015) $) CL:segemehl.x -i chr1.idx -d chr1.fa -q test.fastq -S -m 12 -A 85 -H 1 --minsplicecover 80 --minfragscore 18 --minfraglen 20 --splicescorescale 1.0 +@PG ID:segemehl VN:0.2.0-$Rev: 418 $ ($Date: 2015-01-05 05:17:35 -0500 (Mon, 05 Jan 2015) $) CL:segemehl.x -t 2 -d test-data/chr1.fa -i test-data/chr1.idx -q test-data/test.fastq -m 12 -A 85 -H 1 -M 100 -E 5.0 -D 1 -s -o testout.sam 10.516 HWI-EAS100R:1:1:550:1622/1 0 TestChromosomeForGalaxy 182 255 70M * 0 0 CATGTACTGTTAAAGCGTGCGTTTATTTCAAACATTAATGAAATTTGCAGAACCCAAACTAAAGAGAGAG 3MIa!,$)8EA)!1>tMJ{:2WrL`s|`gg{]'0+Op!6RxNw;V)XKV#Go5}b!`_V]A?!F>{LM(z NM:i:0 MD:Z:70 NH:i:1 XI:i:0 XA:Z:Q 10.2869 HWI-EAS100R:1:1:1698:585/1 0 TestChromosomeForGalaxy 661 255 70M * 0 0 AACCATGCATAAAAGGGGTTCGCCGTTCTCGGAGAGCCACAGAGCCCGGGCCACAGGCAGCTCCTTGCCA Q-a;@)*!F]Za^4!P*B?&!!No!^76b+X[6eOgr1$3:-Ywg;!Vzj!`=+e>YV|ok_z!D<2+jx NM:i:0 MD:Z:70 NH:i:1 XI:i:0 XA:Z:Q 10.2085 HWI-EAS100R:1:1:32:109/2 0 TestChromosomeForGalaxy 1021 255 70M * 0 0 GGGAATTCACCTCAAGAACATCCAAAGTGTGAAGGTGAAGTCCCCCGGACCCCACTGCGCCCAAACCGAA V:e@~!I\GQ>>]?)-qpe!nVI4IJ+4!wE{YoSsVrr~P;PnY/.!a;~!S"n+J#St-g!lQdGA9; NM:i:0 MD:Z:70 NH:i:1 XI:i:0 XA:Z:Q -10.2869 HWI-EAS100R:1:1:1698:585/2 0 TestChromosomeForGalaxy 1321 255 43M * 0 0 CGACTGGAGCTGTTGGTCAGAAATACTGGCGTCTGCCCCCTAA btOb!D1"=hSm"'G_#I{b!!l#6JQ&iq4A`F%Uug!x!'h NM:i:0 MD:Z:43 NH:i:1 XI:i:0 XL:i:2 XA:Z:Q XX:i:1 XY:i:43 XQ:i:0 XC:Z:TestChromosomeForGalaxy XV:i:2123 XT:i:32 -10.2869 HWI-EAS100R:1:1:1698:585/2 0 TestChromosomeForGalaxy 2123 255 27M * 0 0 TGGCAAATCCAACTGACCAGAAGGAAG 7o<%qCKQEtM)!bP>!."DvsX9T}= NM:i:0 MD:Z:27 NH:i:1 XI:i:0 XL:i:2 XA:Z:Q XX:i:44 XY:i:70 XQ:i:1 XP:Z:TestChromosomeForGalaxy XU:i:1363 XS:i:64 10.516 HWI-EAS100R:1:1:550:1623/1 0 TestChromosomeForGalaxy 182 255 70M * 0 0 CATGTACTGTTAAAGCGTGCGTTTATTTCAAACATTAATGAAATTTGCAGAACCCAAACTAAAGAGAGAG 3MIa!,$)8EA)!1>tMJ{:2WrL`s|`gg{]'0+Op!6RxNw;V)XKV#Go5}b!`_V]A?!F>{LM(z NM:i:0 MD:Z:70 NH:i:1 XI:i:0 XA:Z:Q |
| b |
| diff -r 039547ad8fb8 -r db367d012fa3 test-data/testmap2.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/testmap2.sam Wed Jul 26 15:32:09 2017 -0400 |
| [ |
| @@ -0,0 +1,9 @@ +@HD VN:1.0 +@SQ SN:TestChromosomeForGalaxy LN:3459 +@PG ID:segemehl VN:0.2.0-$Rev: 418 $ ($Date: 2015-01-05 05:17:35 -0500 (Mon, 05 Jan 2015) $) CL:segemehl.x -t 2 -d test-data/chr1.fa -i test-data/chr1.idx -q test-data/test.fastq -m 12 -A 85 -H 1 -M 100 -E 5.0 -D 1 -s --splits --minsplicecover 40 -o testout2.sam +10.516 HWI-EAS100R:1:1:550:1622/1 0 TestChromosomeForGalaxy 182 255 70M * 0 0 CATGTACTGTTAAAGCGTGCGTTTATTTCAAACATTAATGAAATTTGCAGAACCCAAACTAAAGAGAGAG 3MIa!,$)8EA)!1>tMJ{:2WrL`s|`gg{]'0+Op!6RxNw;V)XKV#Go5}b!`_V]A?!F>{LM(z NM:i:0 MD:Z:70 NH:i:1 XI:i:0 XA:Z:Q +10.2869 HWI-EAS100R:1:1:1698:585/1 0 TestChromosomeForGalaxy 661 255 70M * 0 0 AACCATGCATAAAAGGGGTTCGCCGTTCTCGGAGAGCCACAGAGCCCGGGCCACAGGCAGCTCCTTGCCA Q-a;@)*!F]Za^4!P*B?&!!No!^76b+X[6eOgr1$3:-Ywg;!Vzj!`=+e>YV|ok_z!D<2+jx NM:i:0 MD:Z:70 NH:i:1 XI:i:0 XA:Z:Q +10.2085 HWI-EAS100R:1:1:32:109/2 0 TestChromosomeForGalaxy 1021 255 70M * 0 0 GGGAATTCACCTCAAGAACATCCAAAGTGTGAAGGTGAAGTCCCCCGGACCCCACTGCGCCCAAACCGAA V:e@~!I\GQ>>]?)-qpe!nVI4IJ+4!wE{YoSsVrr~P;PnY/.!a;~!S"n+J#St-g!lQdGA9; NM:i:0 MD:Z:70 NH:i:1 XI:i:0 XA:Z:Q +10.2869 HWI-EAS100R:1:1:1698:585/2 0 TestChromosomeForGalaxy 1321 255 43M * 0 0 CGACTGGAGCTGTTGGTCAGAAATACTGGCGTCTGCCCCCTAA btOb!D1"=hSm"'G_#I{b!!l#6JQ&iq4A`F%Uug!x!'h NM:i:0 MD:Z:43 NH:i:1 XI:i:0 XL:i:2 XA:Z:Q XX:i:1 XY:i:43 XQ:i:0 XC:Z:TestChromosomeForGalaxy XV:i:2123 XT:i:32 +10.2869 HWI-EAS100R:1:1:1698:585/2 0 TestChromosomeForGalaxy 2123 255 27M * 0 0 TGGCAAATCCAACTGACCAGAAGGAAG 7o<%qCKQEtM)!bP>!."DvsX9T}= NM:i:0 MD:Z:27 NH:i:1 XI:i:0 XL:i:2 XA:Z:Q XX:i:44 XY:i:70 XQ:i:1 XP:Z:TestChromosomeForGalaxy XU:i:1363 XS:i:64 +10.516 HWI-EAS100R:1:1:550:1623/1 0 TestChromosomeForGalaxy 182 255 70M * 0 0 CATGTACTGTTAAAGCGTGCGTTTATTTCAAACATTAATGAAATTTGCAGAACCCAAACTAAAGAGAGAG 3MIa!,$)8EA)!1>tMJ{:2WrL`s|`gg{]'0+Op!6RxNw;V)XKV#Go5}b!`_V]A?!F>{LM(z NM:i:0 MD:Z:70 NH:i:1 XI:i:0 XA:Z:Q |
| b |
| diff -r 039547ad8fb8 -r db367d012fa3 tool_dependencies.xml --- a/tool_dependencies.xml Fri Dec 16 07:37:24 2016 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| b |
| @@ -1,6 +0,0 @@ -<?xml version="1.0"?> -<tool_dependency> - <package name="segemehl" version="0.2.0"> - <repository changeset_revision="11cce9ae6cc6" name="package_segemehl_0_2_0" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> - </package> -</tool_dependency> |