| Previous changeset 2:c0f7b58b4ce4 (2019-11-28) Next changeset 4:d4bea99366f9 (2024-03-20) |
|
Commit message:
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/obitools commit 5d3c7a7b3f7d687bb03ef7993ddf1a6507d655bd" |
|
modified:
macros.xml obiuniq.xml test-data/output_ngsfilter_error_3.fastq test-data/output_ngsfilter_unidentified.fastq test-data/output_obisort.fastq |
|
added:
test-data/illuminapairedend.output.fastq.gz test-data/output_ngsfilter_error_3.fastq.gz test-data/output_obiannotate.fasta.gz test-data/output_obiclean_advanced.fasta.gz test-data/output_obigrep_predicat.fasta.gz test-data/output_obiuniq.fasta.gz test-data/output_obiuniq_family.fasta.gz test-data/wolf_small.F.fastq.gz test-data/wolf_small.R.fastq.gz |
| b |
| diff -r c0f7b58b4ce4 -r ec215ed98831 macros.xml --- a/macros.xml Thu Nov 28 15:52:27 2019 -0500 +++ b/macros.xml Mon May 10 19:34:29 2021 +0000 |
| [ |
| @@ -6,7 +6,8 @@ </requirements> </xml> - <token name="@TOOL_VERSION@">1.2.11</token> + <token name="@TOOL_VERSION@">1.2.13</token> + <token name="@PROFILE@">21.01</token> <xml name="stdio"> <stdio> @@ -14,6 +15,80 @@ </stdio> </xml> + <token name="@INPUT_FORMATS@">fastqsanger,fastqsanger.gz,fastqsolexa,fastqsolexa.gz,fasta,fasta.gz</token> + <token name="@GUNZIP_INPUT@"><![CDATA[ + #if $input.ext.endswith(".gz") + gunzip -c '$input' > input && + #else + ln -s '$input' input && + #end if + ]]></token> + <token name="@GZIP_OUTPUT@"><![CDATA[ + #if $input.ext.endswith(".gz") + | gzip -c + #end if + ]]></token> + + <!-- generate galaxy.json to determine output format + - by default same as input + - if out_format can be specified + - fasta/fastq depending on $out_format (if != "") + - or fasta if the tool does not support choosing the output format, e.g. obiuniq which always outputs fasta + - gz if $input is zipped + + A list of outputs to include in the json can be given by + setting a variable $outputs = [...] listing pairs of output names and the actual output + (defaults to [("output", $output)]) + --> + <token name="@GENERATE_GALAXY_JSON@"><![CDATA[ + #import json + + #try: + #silent $outputs[0] + #except + #set outputs = [("output", $output)] + #end try + + #if $input.ext.startswith("fastq") + #set ext = "fastqsanger" + #else if $input.ext.startswith("fasta") + #set ext = "fasta" + #end if + + #try + #if $out_format == "fasta" + #set ext = "fasta" + #else if $out_format == "fastq" + #set ext = "fastqsanger" + #end if + #except + #set ext = "fasta" + #end try + + #if $input.ext.endswith(".gz") + #set ext = ext + ".gz" + #end if + + #set gxy_json = {} + #for oname, o in $outputs + #silent gxy_json[oname] = {"ext": ext} + #end for + && echo '${json.dumps(gxy_json)}' >> galaxy.json + ]]></token> + + <token name="@OUT_FORMAT@"><![CDATA[ + #if $out_format + --${out_format}-output + #end if + ]]></token> + + <xml name="out_format_macro"> + <param name="out_format" type="select" optional="true" label="Output data type" help="For FASTA/Q the the default output type is the same as the input type"> + <option value="fasta">fasta</option> + <option value="fastq">fastq</option> + </param> + </xml> + <token name="@OBITOOLS_LINK@"> <![CDATA[ -------- @@ -105,15 +180,43 @@ <option value="taxid">taxid</option> </xml> - <xml name="inputtype"> - <option value="--genbank">genbank</option> - <option value="--embl">embl</option> - <option value="--sanger">sanger</option> - <option value="--solexa">solexa</option> - <option value="--ecopcr">ecopcr</option> - <option value="--ecopcrdb">ecopcrdb</option> - <option value="--fasta" selected="true">fasta</option> + <xml name="input_format_options_macro"> + <section name="input_format_options" title="Input format options" expanded="false"> + <param name="options_inputtype" type="select" optional="true" label="Specify the input datatype" help="default: determine automatically (should only be necessay for non FASTA/FASTQ datasets)"> + <option value="--genbank">genbank</option> + <option value="--embl">embl</option> + <option value="--sanger">sanger</option> + <option value="--solexa">solexa</option> + <option value="--ecopcr">ecopcr</option> + <option value="--ecopcrdb">ecopcrdb</option> + <option value="--fasta">fasta (including obitools fasta extentions)</option> + <option value="--raw-fasta">raw fasta (more tolerant format variant)</option> + </param> + <param name="options_seqtype" type="select" optional="true" label="Specify the sequence datatype" > + <option value="--nuc">nucleic</option> + <option value="--prot">protein</option> + </param> + </section> </xml> + + <token name="@INPUT_FORMAT@"><![CDATA[ + #if $input_format_options.options_inputtype + $input_format_options.options_inputtype + #else + #if $input.ext.startswith("fasta") + --fasta + #else if $input.ext.startswith("fastqsolexa") + ## input file is in fastq nucleic format produced by solexa sequencer + --solexa + #else + ## input file is in sanger fastq nucleic format (standard fastq) + --sanger + #end if + #end if + #if $input_format_options.options_seqtype + $input_format_options.options_seqtype + #end if + ]]></token> <xml name="sanitizer"> <sanitizer invalid_char="test"> |
| b |
| diff -r c0f7b58b4ce4 -r ec215ed98831 obiuniq.xml --- a/obiuniq.xml Thu Nov 28 15:52:27 2019 -0500 +++ b/obiuniq.xml Mon May 10 19:34:29 2021 +0000 |
| [ |
| @@ -1,92 +1,86 @@ -<tool id="obi_uniq" name="obiuniq" version="@TOOL_VERSION@"> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements"/> - <expand macro="stdio"/> -<command> - - <![CDATA[ - - obiuniq - #if str( $options_attribute) == "merge" - -m '$options_uniq' - #else - -c '$options_uniq' - #end if - ${mid} - ${prefix} - '$input' > '$output' - - ]]> - -</command> - -<inputs> - <param name="input" type="data" format="fasta,fastq" label="Input sequences file" /> - <param name="options_uniq" type="select" label="Attribute to merge" > - <expand macro="attributes"/> - </param> - <param name="options_attribute" type="select" label="Use specific option" > - <option value="merge" selected="true">merge</option> - <option value="category_attribute">category_attribute</option> - </param> - <param name="mid" type="boolean" checked="false" truevalue="-i" falsevalue="" label="Add a merged attribute containing the list of sequence record ids merged within this group" /> - <param name="prefix" type="boolean" checked="false" truevalue="-p" falsevalue="" label="Dereplicate through a prefix matching" /> -</inputs> -<outputs> - <data format="fasta" name="output" label="output.fasta with ${tool.name} on ${on_string}" /> -</outputs> - -<tests> - <test> - <param name="input" value="output_ngsfilter_error_3.fastq" /> - <param name="options_uniq" value="sample" /> - <param name="options_attribute" value="merge" /> - <param name="mid" value="False" /> - <param name="prefix" value="False" /> - <output name="output" file="output_obiuniq.fasta" ftype="fasta"/> - </test> - <test> - <param name="input" value="output_ngsfilter_error_3.fastq" /> - <param name="options_uniq" value="family" /> - <param name="options_attribute" value="category_attribute" /> - <param name="mid" value="True" /> - <param name="prefix" value="True" /> - <output name="output" file="output_obiuniq_family.fasta" ftype="fasta"/> - </test> - -</tests> -<help><![CDATA[ - -.. class:: infomark - -**What it does** - -The obiuniq command is in some way analog to the standard Unix uniq -c command. - -Instead of working text line by text line as the standard Unix tool, the processing is done on sequence records. - -A sequence record is a complex object composed of an identifier, a set of attributes (key=value), a definition, and the sequence itself. - -The obiuniq command groups together sequence records. Then, for each group, a sequence record is printed. - -A group is defined by the sequence and optionally by the values of a set of attributes specified with the -c option. - -As the identifier, the set of attributes (key=value) and the definition of the sequence records that are grouped together may be different, two options (-m and -i) allow refining how these parts of the records are reported. - -\* By default, only attributes with identical values within a group of sequence records are kept. - -\* A count attribute is set to the total number of sequence records for each group. - -\* For each attribute specified by the -m option, a new attribute whose key is prefixed by merged_ is created. These new attributes contain the number of times each value occurs within the group of sequence records. - - -@OBITOOLS_LINK@ - - - -]]> -</help> -<expand macro="citation" /> -</tool> +<tool id="obi_uniq" name="obiuniq" version="@TOOL_VERSION@" profile="@PROFILE@"> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + <command><![CDATA[ + @GUNZIP_INPUT@ + + obiuniq + --without-progress-bar + #if str( $options_attribute) == "merge" + -m '$options_uniq' + #else + -c '$options_uniq' + #end if + ${mid} + ${prefix} + @INPUT_FORMAT@ + input + @GZIP_OUTPUT@ + > '$output' + @GENERATE_GALAXY_JSON@ + ]]></command> + <inputs> + <param name="input" type="data" format="@INPUT_FORMATS@" label="Input sequences file" /> + <param name="options_uniq" type="select" label="Attribute to merge" > + <expand macro="attributes"/> + </param> + <param name="options_attribute" type="select" label="Use specific option" > + <option value="merge" selected="true">merge</option> + <option value="category_attribute">category_attribute</option> + </param> + <param name="mid" type="boolean" checked="false" truevalue="-i" falsevalue="" label="Add a merged attribute containing the list of sequence record ids merged within this group" /> + <param name="prefix" type="boolean" checked="false" truevalue="-p" falsevalue="" label="Dereplicate through a prefix matching" /> + <expand macro="input_format_options_macro"/> + </inputs> + <outputs> + <data format="auto" name="output"/> + </outputs> + <tests> + <test> + <param name="input" value="output_ngsfilter_error_3.fastq" ftype="fastqsanger"/> + <param name="options_uniq" value="sample" /> + <param name="options_attribute" value="merge" /> + <param name="mid" value="False" /> + <param name="prefix" value="False" /> + <output name="output" file="output_obiuniq.fasta" ftype="fasta"/> + </test> + <test> + <param name="input" value="output_ngsfilter_error_3.fastq.gz" ftype="fastqsanger.gz"/> + <param name="options_uniq" value="family" /> + <param name="options_attribute" value="category_attribute" /> + <param name="mid" value="True" /> + <param name="prefix" value="True" /> + <output name="output" file="output_obiuniq_family.fasta.gz" ftype="fasta.gz" decompress="true"/> + </test> + </tests> + <help><![CDATA[ + .. class:: infomark + + **What it does** + + The obiuniq command is in some way analog to the standard Unix uniq -c command. + + Instead of working text line by text line as the standard Unix tool, the processing is done on sequence records. + + A sequence record is a complex object composed of an identifier, a set of attributes (key=value), a definition, and the sequence itself. + + The obiuniq command groups together sequence records. Then, for each group, a sequence record is printed. + + A group is defined by the sequence and optionally by the values of a set of attributes specified with the -c option. + + As the identifier, the set of attributes (key=value) and the definition of the sequence records that are grouped together may be different, two options (-m and -i) allow refining how these parts of the records are reported. + + \* By default, only attributes with identical values within a group of sequence records are kept. + + \* A count attribute is set to the total number of sequence records for each group. + + \* For each attribute specified by the -m option, a new attribute whose key is prefixed by merged_ is created. These new attributes contain the number of times each value occurs within the group of sequence records. + + + @OBITOOLS_LINK@ + ]]></help> + <expand macro="citation" /> +</tool> |
| b |
| diff -r c0f7b58b4ce4 -r ec215ed98831 test-data/illuminapairedend.output.fastq.gz |
| b |
| Binary file test-data/illuminapairedend.output.fastq.gz has changed |
| b |
| diff -r c0f7b58b4ce4 -r ec215ed98831 test-data/output_ngsfilter_error_3.fastq |
| b |
| Binary file test-data/output_ngsfilter_error_3.fastq has changed |
| b |
| diff -r c0f7b58b4ce4 -r ec215ed98831 test-data/output_ngsfilter_error_3.fastq.gz |
| b |
| Binary file test-data/output_ngsfilter_error_3.fastq.gz has changed |
| b |
| diff -r c0f7b58b4ce4 -r ec215ed98831 test-data/output_ngsfilter_unidentified.fastq |
| b |
| Binary file test-data/output_ngsfilter_unidentified.fastq has changed |
| b |
| diff -r c0f7b58b4ce4 -r ec215ed98831 test-data/output_obiannotate.fasta.gz |
| b |
| Binary file test-data/output_obiannotate.fasta.gz has changed |
| b |
| diff -r c0f7b58b4ce4 -r ec215ed98831 test-data/output_obiclean_advanced.fasta.gz |
| b |
| Binary file test-data/output_obiclean_advanced.fasta.gz has changed |
| b |
| diff -r c0f7b58b4ce4 -r ec215ed98831 test-data/output_obigrep_predicat.fasta.gz |
| b |
| Binary file test-data/output_obigrep_predicat.fasta.gz has changed |
| b |
| diff -r c0f7b58b4ce4 -r ec215ed98831 test-data/output_obisort.fastq --- a/test-data/output_obisort.fastq Thu Nov 28 15:52:27 2019 -0500 +++ b/test-data/output_obisort.fastq Mon May 10 19:34:29 2021 +0000 |
| b |
| b"@@ -1,172 +1,232 @@\n->HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/2_CONS_SUB_SUB_CMP count=64; merged_sample={'26a_F040644': 64}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=99; obiclean_headcount=1; seq_rank=5; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'h'}; obiclean_head=True; \n-ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca\n-gcctgaaactcaaaggacttggcggtgctttacatccct\n->HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/2_CONS_SUB_SUB count=61; merged_sample={'29a_F260619': 30, '15a_F730814': 31}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=100; obiclean_headcount=2; seq_rank=4; obiclean_samplecount=2; obiclean_status={'29a_F260619': 'h', '15a_F730814': 'h'}; obiclean_head=True; \n-ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat\n-agcttaaaactcaaaggacttggcggtgctttataccctt\n->HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/2_CONS_SUB_SUB count=46; merged_sample={'13a_F730603': 46}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=100; obiclean_headcount=1; seq_rank=8; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'h'}; obiclean_head=True; \n-ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat\n-agcttaaaactcaaaggacttggcggtgctttataccctt\n->HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS_SUB_SUB count=7; merged_sample={'29a_F260619': 7}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=4; obiclean_headcount=0; seq_rank=16; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; \n+@HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/2_CONS_SUB_SUB_CMP count=64; merged_sample={'26a_F040644': 64}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=99; obiclean_headcount=1; seq_rank=5; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'h'}; obiclean_head=True; \n+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n+@HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/2_CONS_SUB_SUB count=61; merged_sample={'29a_F260619': 30, '15a_F730814': 31}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=100; obiclean_headcount=2; seq_rank=4; obiclean_samplecount=2; obiclean_status={'29a_F260619': 'h', '15a_F730814': 'h'}; obiclean_head=True; \n+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n+@HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/2_CONS_SUB_SUB count=46; merged_sample={'13a_F730603': 46}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=100; obiclean_headcount=1; seq_rank=8; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'h'}; obiclean_head=True; \n+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n+@HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS_SUB_SUB count=7; merged_sample={'29a_F260619': 7}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=4; obiclean_headcount=0; seq_rank=16; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; \n tttt\n->HELIUM_000100422_612GNAAXX:7:89:10281:5930#0/2_CONS_SUB_SUB_CMP count=3; merged_sample={'29a_F260619': 3}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=6; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; \n-ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac\n-agcttaaaactcaaaggacttggcggtgctttataccctt\n->HELIUM_000100422_612GNAAXX:7:29:15520:18035#0/2_CONS_SUB_SUB count=2; merged_sample={'29a_F260619': 2}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=7; obiclean_sample"..b"M_000100422_612GNAAXX:7:10:9237:10532#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=51; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; \n+ttagccctaaacacaagtaattaatataacaaaataattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n+@HELIUM_000100422_612GNAAXX:7:7:11998:4462#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=52; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; \n+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtagtactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n+@HELIUM_000100422_612GNAAXX:7:111:18277:17779#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=53; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; \n+ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaatagcctgaaactcaaaggacttggcggtgctttacatccct\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n+@HELIUM_000100422_612GNAAXX:7:3:17077:6562#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=54; obiclean_samplecount=1; obiclean_status={'15a_F730814': 'i'}; obiclean_head=False; \n+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactgccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n+@HELIUM_000100422_612GNAAXX:7:19:4311:13343#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=55; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; \n+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactacgagcaacagcctgaaactcaaaggacttggcggtgctttacatccct\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n+@HELIUM_000100422_612GNAAXX:7:30:1800:7833#0/2_CONS_SUB_SUB count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=56; obiclean_samplecount=1; obiclean_status={'15a_F730814': 's'}; obiclean_head=True; \n+ttagccctaaacacaagacattaatataacgagattaatcgacagagtactaccggctatagcttaaaactcaaaggacttggcggtgctttataccctt\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n+@HELIUM_000100422_612GNAAXX:7:108:9222:18258#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=57; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'i'}; obiclean_head=False; \n+ctagccttaaacacaaatagttatgcagacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n+@HELIUM_000100422_612GNAAXX:7:38:3005:20881#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=58; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; \n+ttagccctaaacatgaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n" |
| b |
| diff -r c0f7b58b4ce4 -r ec215ed98831 test-data/output_obiuniq.fasta.gz |
| b |
| Binary file test-data/output_obiuniq.fasta.gz has changed |
| b |
| diff -r c0f7b58b4ce4 -r ec215ed98831 test-data/output_obiuniq_family.fasta.gz |
| b |
| Binary file test-data/output_obiuniq_family.fasta.gz has changed |
| b |
| diff -r c0f7b58b4ce4 -r ec215ed98831 test-data/wolf_small.F.fastq.gz |
| b |
| Binary file test-data/wolf_small.F.fastq.gz has changed |
| b |
| diff -r c0f7b58b4ce4 -r ec215ed98831 test-data/wolf_small.R.fastq.gz |
| b |
| Binary file test-data/wolf_small.R.fastq.gz has changed |