Galaxy |

Changeset 3:ec3c4654eacc (2017-06-22)

Previous changeset 2:70206002b220 (2017-05-19) Next changeset 4:01151a09513f (2017-07-10)

Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/qiime/ commit a831282140ce160035a4ce984f48cc20198ed0a1

modified:
assign_taxonomy.xml
generate_test_data.sh
macros.xml

added:
test-data/assign_taxonomy/mothur_id_to_taxonomy.txt
test-data/assign_taxonomy/mothur_repr_set_seqs.fasta
test-data/assign_taxonomy/sortmerna_input_seqs.fasta

removed:
test-data/assign_taxonomy/sortmerna_map.blast
test-data/assign_taxonomy/sortmerna_taxonomic_assignation.txt
test-data/assign_taxonomy/uclust_taxonomic_assignation.txt

diff -r 70206002b220 -r ec3c4654eacc assign_taxonomy.xml
--- a/assign_taxonomy.xml Fri May 19 04:09:30 2017 -0400
+++ b/assign_taxonomy.xml Thu Jun 22 06:57:54 2017 -0400

[

b'@@ -4,7 +4,7 @@\n <import>macros.xml</import>\n </macros>\n <expand macro="requirements">\n- <requirement type="package" version="2.0.2">rdptools</requirement>\n+ \n <requirement type="package" version="2.2.22">blast-legacy</requirement>\n <requirement type="package" version="2.3.4">vsearch</requirement>\n <requirement type="package" version="1.36.1">mothur</requirement>\n@@ -13,8 +13,10 @@\n <command detect_errors="aggressive"><![CDATA[\n assign_taxonomy.py\n --input_fasta_fp \'$input_fasta_fp\'\n- #if $id_to_taxonomy_fp\n- --id_to_taxonomy_fp \'$id_to_taxonomy_fp\'\n+ #if $id_to_taxonomy_condition.source_selector == \'history\'\n+ --id_to_taxonomy_fp \'$id_to_taxonomy_condition.id_to_taxonomy_fp\'\n+ #else if $id_to_taxonomy_condition.source_selector == \'cached\'\n+ --id_to_taxonomy_fp \'$id_to_taxonomy_condition.id_to_taxonomy_fp.fields.path\'\n #end if\n --assignment_method \'$methodcond.assignment_method\'\n #if $methodcond.assignment_method == "uclust"\n@@ -22,12 +24,18 @@\n --similarity \'$methodcond.similarity\'\n --uclust_max_accepts \'$methodcond.uclust_max_accepts\'\n #else if $methodcond.assignment_method == "rdp"\n- #if $methodcond.reference_seqs_fp\n- --reference_seqs_fp \'$methodcond.reference_seqs_fp\'\n+ #if $methodcond.references.source_selector == \'history\'\n+ --reference_seqs_fp \'$methodcond.references.reference_seqs_fp\'\n+ #else if $methodcond.references.source_selector == \'cached\'\n+ --reference_seqs_fp \'$methodcond.references.reference_seqs_fp.fields.path\'\n #end if\n --confidence \'$methodcond.confidence\'\n #else if $methodcond.assignment_method == "blast"\n- --reference_seqs_fp \'$methodcond.reference_seqs_fp\'\n+ #if $methodcond.references.source_selector == \'history\'\n+ --reference_seqs_fp \'$methodcond.references.reference_seqs_fp\'\n+ #else if $methodcond.references.source_selector == \'cached\'\n+ --reference_seqs_fp \'$methodcond.references.reference_seqs_fp.fields.path\'\n+ #end if\n --blast_e_value \'$methodcond.blast_e_value\'\n #else if $methodcond.assignment_method == "rtax"\n --read_1_seqs_fp \'$methodcond.read_1_seqs_fp\'\n@@ -38,6 +46,11 @@\n --amplicon_id_regex \'$methodcond.amplicon_id_regex\'\n --header_id_rege \'$methodcond.header_id_regex\'\n #else if $methodcond.assignment_method == "mothur"\n+ #if $methodcond.references.source_selector == \'history\'\n+ --reference_seqs_fp \'$methodcond.references.reference_seqs_fp\'\n+ #else if $methodcond.references.source_selector == \'cached\'\n+ --reference_seqs_fp \'$methodcond.references.reference_seqs_fp.fields.path\'\n+ #end if\n --confidence \'$methodcond.confidence\'\n #else if $methodcond.assignment_method == "sortmerna"\n --sortmerna_threads \\${GALAXY_SLOTS:-1}\n@@ -54,15 +67,32 @@\n ]]></command>\n <inputs>\n <param argument="--input_fasta_fp" type="data" format="fasta" label="Input fasta file" />\n- <param argument="--id_to_taxonomy_fp" label="Tab-delimited file mapping sequences to assigned taxonomy" type="data" format="tabular" help="Each assigned taxonomy is provided as a semicolon-separated list. For assignment with rdp, each assigned taxonomy must be exactly 6 levels deep" optional="True"/>\n+\n+ <conditional name="id_to_taxonomy_condition">\n+ <param name="source_selector" type="select" label="Do you want to use a taxonomy reference ?">\n+ '..b'tory" />\n+ <param name="id_to_taxonomy_fp" value="assign_taxonomy/mothur_id_to_taxonomy.txt"/>\n+ </conditional>\n+ <conditional name="methodcond">\n+ <param name="assignment_method" value="mothur"/>\n+ <conditional name="references">\n+ <param name="source_selector" value="history" />\n+ <param name="reference_seqs_fp" value="assign_taxonomy/mothur_ref_seq_set.fna" />\n+ </conditional>\n+ <param name="confidence" value="0.5"/>\n+ </conditional>\n+ <output name="tax_assignments">\n+ <assert_contents>\n+ <has_text text="X67228" />\n+ <has_text text="Rhizobium" />\n+ <has_text text="EF503697" />\n+ </assert_contents>\n+ </output>\n+ </test>\n+ \n+ <test>\n+ <param name="input_fasta_fp" value="assign_taxonomy/mothur_repr_set_seqs.fasta"/>\n+ <conditional name="id_to_taxonomy_condition">\n+ <param name="source_selector" value="history" />\n+ <param name="id_to_taxonomy_fp" value="assign_taxonomy/mothur_id_to_taxonomy.txt"/>\n+ </conditional>\n+ <conditional name="methodcond">\n+ <param name="assignment_method" value="blast"/>\n+ <conditional name="references">\n+ <param name="source_selector" value="history" />\n+ <param name="reference_seqs_fp" value="assign_taxonomy/mothur_ref_seq_set.fna" />\n+ </conditional>\n+ <param name="blast_e_value" value="0.001"/>\n+ </conditional>\n+ <output name="tax_assignments" md5="5ab8d28f67bcbf828937d222b2ab9c6e"/>\n+ <output name="log">\n+ <assert_contents>\n+ <has_text text="BlastTaxonAssigner" />\n+ <has_text text="inspected: 2" />\n+ </assert_contents>\n+ </output>\n+ </test>\n+ \n+ \n \n </tests>\n <help><![CDATA[\n'

diff -r 70206002b220 -r ec3c4654eacc generate_test_data.sh
--- a/generate_test_data.sh Fri May 19 04:09:30 2017 -0400
+++ b/generate_test_data.sh Thu Jun 22 06:57:54 2017 -0400

@@ -92,9 +92,32 @@
     --similarity '0.9' \
     --uclust_max_accepts '3' \
     -o assign_taxonomy_uclust
-cp assign_taxonomy_uclust/uclust_input_seqs_tax_assignments.txt 'test-data/assign_taxonomy/uclust_taxonomic_assignation.txt'
+ls assign_taxonomy_uclust
+md5sum 'assign_taxonomy_uclust/uclust_input_seqs_tax_assignments.txt'
rm -rf assign_taxonomy_uclust

+assign_taxonomy.py \
+    --input_fasta_fp 'test-data/assign_taxonomy/mothur_repr_set_seqs.fasta' \
+    --id_to_taxonomy_fp 'test-data/assign_taxonomy/mothur_id_to_taxonomy.txt' \
+    --assignment_method 'mothur' \
+    --reference_seqs_fp 'test-data/assign_taxonomy/mothur_ref_seq_set.fna' \
+    --confidence '0.5' \
+    -o assign_taxonomy_mothur
+ls assign_taxonomy_mothur
+md5sum 'assign_taxonomy_mothur/mothur_repr_set_seqs_tax_assignments.txt'
+rm -rf assign_taxonomy_mothur
+
+assign_taxonomy.py \
+    --input_fasta_fp 'test-data/assign_taxonomy/mothur_repr_set_seqs.fasta' \
+    --id_to_taxonomy_fp 'test-data/assign_taxonomy/mothur_id_to_taxonomy.txt' \
+    --assignment_method 'mothur' \
+    --reference_seqs_fp 'test-data/assign_taxonomy/mothur_ref_seq_set.fna' \
+    --blast_e_value '0.001' \
+    -o assign_taxonomy_blast
+ls assign_taxonomy_blast
+md5sum 'assign_taxonomy_blast/mothur_repr_set_seqs_tax_assignments.txt'
+rm -rf assign_taxonomy_blast
+
#assign_taxonomy.py \
#    --input_fasta_fp 'test-data/assign_taxonomy/rdp_input_seqs.fasta' \
#    --id_to_taxonomy_fp 'test-data/assign_taxonomy/rdp_id_to_taxonomy.txt' \
@@ -116,14 +139,6 @@
#    -o assign_taxonomy_rtax
#ls assign_taxonomy_rtax

-#assign_taxonomy.py \
-#    --input_fasta_fp 'test-data/assign_taxonomy/mothur_ref_seq_set.fna' \
-#    --id_to_taxonomy_fp 'test-data/assign_taxonomy/mothur_id_to_taxonomy.txt' \
-#    --assignment_method 'mothur' \
-#    --confidence 0.5  \
-#    -o assign_taxonomy_mothur
-#ls assign_taxonomy_mothur
-
assign_taxonomy.py \
     --input_fasta_fp 'test-data/assign_taxonomy/mothur_ref_seq_set.fna' \
     --assignment_method 'sortmerna' \
@@ -133,8 +148,9 @@
     --sortmerna_coverage "0.9" \
     --sortmerna_best_N_alignments "5" \
     -o assign_taxonomy_sortmerna
-cp assign_taxonomy_sortmerna/sortmerna_map.blast 'test-data/assign_taxonomy/sortmerna_map.blast'
-cp assign_taxonomy_sortmerna/mothur_ref_seq_set_tax_assignments.txt 'test-data/assign_taxonomy/sortmerna_taxonomic_assignation.txt'
+ls assign_taxonomy_sortmerna
+md5sum 'assign_taxonomy_sortmerna/mothur_ref_seq_set_tax_assignments.txt'
+md5sum 'assign_taxonomy_sortmerna/sortmerna_map.blast'
rm -rf assign_taxonomy_sortmerna

#beta_diversity
@@ -1105,22 +1121,3 @@
cp validate_mapping_file_output/*.log 'test-data/validate_mapping_file/map.tsv.log'
cp validate_mapping_file_output/*corrected.txt 'test-data/validate_mapping_file/map.tsv_corrected.txt'
rm -rf validate_mapping_file_output
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-

diff -r 70206002b220 -r ec3c4654eacc macros.xml
--- a/macros.xml Fri May 19 04:09:30 2017 -0400
+++ b/macros.xml Thu Jun 22 06:57:54 2017 -0400

@@ -29,6 +29,22 @@
             </when>
         </conditional>
     </xml>
+    <xml name="assign_taxonomy_reference_source">
+        <conditional name="references">
+            <param name="source_selector" type="select" label="Select a reference sequence file from">
+                <option value="cached">The local cache</option>
+                <option value="history">The active history</option>
+            </param>
+            <when value="cached">
+                <param argument="--reference_seqs_fp" label="Reference sequences either used to generate a blast database (Blast) or used as training sequences for the selected classifier (RDP, Mothur)" type="select">
+                    <options from_data_table="qiime_rep_set"/>
+                </param>
+            </when>
+            <when value="history">
+                <param argument="--reference_seqs_fp" type="data" format="fasta" label="Reference sequences to search against"/>
+            </when>
+        </conditional>
+    </xml>
     <xml name="pick_otus_similarity">
         <param argument="--similarity" type="float" value="0.97" label="Sequence similarity threshold"/>
     </xml>

diff -r 70206002b220 -r ec3c4654eacc test-data/assign_taxonomy/mothur_id_to_taxonomy.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/assign_taxonomy/mothur_id_to_taxonomy.txt Thu Jun 22 06:57:54 2017 -0400

@@ -0,0 +1,7 @@
+X67228 Bacteria;Proteobacteria;Alphaproteobacteria;Rhizobiales;Rhizobiaceae;Rhizobium
+X73443 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiaceae;Clostridium
+AB004750 Bacteria;Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae;Enterobacter
+xxxxxx Bacteria;Proteobacteria;Gammaproteobacteria;Pseudomonadales;Pseudomonadaceae;Pseudomonas
+AB004748 Bacteria;Proteobacteria;Gammaproteobacteria;Enterobacteriales;Enterobacteriaceae;Enterobacter
+AB000278 Bacteria;Proteobacteria;Gammaproteobacteria;Vibrionales;Vibrionaceae;Photobacterium
+AB000390 Bacteria;Proteobacteria;Gammaproteobacteria;Vibrionales;Vibrionaceae;Vibrio

diff -r 70206002b220 -r ec3c4654eacc test-data/assign_taxonomy/mothur_repr_set_seqs.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/assign_taxonomy/mothur_repr_set_seqs.fasta Thu Jun 22 06:57:54 2017 -0400

@@ -0,0 +1,4 @@
+>X67228 some description
+aacgaacgctggcggcaggcttaacacatgcaagtcgaacgctccgcaaggagagtggcagacgggtgagtaacgcgtgggaatctacccaaccctgcggaatagctctgggaaactggaattaataccgcatacgccctacgggggaaagatttatcggggatggatgagcccgcgttggattagctagttggtggggtaaaggcctaccaaggcgacgatccatagctggtctgagaggatgatcagccacattgggactgagacacggcccaaa
+>EF503697
+TAAAATGACTAGCCTGCGAGTCACGCCGTAAGGCGTGGCATACAGGCTCAGTAACACGTAGTCAACATGCCCAAAGGACGTGGATAACCTCGGGAAACTGAGGATAAACCGCGATAGGCCAAGGTTTCTGGAATGAGCTATGGCCGAAATCTATATGGCCTTTGGATTGGACTGCGGCCGATCAGGCTGTTGGTGAGGTAATGGCCCACCAAACCTGTAACCGGTACGGGCTTTGAGAGAAGTAGCCCGGAGATGGGCACTGAGACAAGGGCCCAGGCCCTATGGGGCGCAGCAGGCGCGAAACCTCTGCAATAGGCGAAAGCCTGACAGGGTTACTCTGAGTGATGCCCGCTAAGGGTATCTTTTGGCACCTCTAAAAATGGTGCAGAATAAGGGGTGGGCAAGTCTGGTGTCAGCCGCCGCGGTAATACCAGCACCCCGAGTTGTCGGGACGATTATTGGGCCTAAAGCATCCGTAGCCTGTTCTGCAAGTCCTCCGTTAAATCCACCTGCTCAACGGATGGGCTGCGGAGGATACCGCAGAGCTAGGAGGCGGGAGAGGCAAACGGTACTCAGTGGGTAGGGGTAAAATCCATTGATCTACTGAAGACCACCAGTGGCGAAGGCGGTTTGCCAGAACGCGCTCGACGGTGAGGGATGAAAGCTGGGGGAGCAAACCGGATTAGATACCCGGGGTAGTCCCAGCTGTAAACGGATGCAGACTCGGGTGATGGGGTTGGCTTCCGGCCCAACCCCAATTGCCCCCAGGCGAAGCCCGTTAAGATCTTGCCGCCCTGTCAGATGTCAGGGCCGCCAATACTCGAAACCTTAAAAGGAAATTGGGCGCGGGAAAAGTCACCAAAAGGGGGTTGAAACCCTGCGGGTTATATATTGTAAACC

diff -r 70206002b220 -r ec3c4654eacc test-data/assign_taxonomy/sortmerna_input_seqs.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/assign_taxonomy/sortmerna_input_seqs.fasta Thu Jun 22 06:57:54 2017 -0400

@@ -0,0 +1,2 @@
+>X67228
+aacgaacgctggcggcaggcttaacacatgcaagtcgaacgctccgcaaggagagtggcagacgggtgagtaacgcgtgggaatctacccaaccctgcggaatagctctgggaaactggaattaataccgcatacgccctacgggggaaagatttatcggggatggatgagcccgcgttggattagctagttggtggggtaaaggcctaccaaggcgacgatccatagctggtctgagaggatgatcagccacattgggactgagacacggcccaaa

diff -r 70206002b220 -r ec3c4654eacc test-data/assign_taxonomy/sortmerna_map.blast
--- a/test-data/assign_taxonomy/sortmerna_map.blast Fri May 19 04:09:30 2017 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

@@ -1,28 +0,0 @@
-X67228 152350 98.6 277 4 0 1 277 22 298 5.76e-129 464 277M 100
-X67228 558499 97.1 275 8 0 1 275 2 276 1.05e-122 443 275M2S 99.3
-X67228 553706 97.5 277 7 0 1 277 1 277 4.7e-125 451 277M 100
-X67228 553981 95.7 277 12 0 1 277 2 278 1.55e-118 429 277M 100
-X67228 4423084 98.6 277 4 0 1 277 21 297 5.76e-129 464 277M 100
-X73443 179865 96.3 269 2 8 8 276 2 268 2.31e-114 415 7S3M1I28M1I3M1I7M1D8M1D20M1I26M1I115M1D54M 97.5
-X73443 181718 96 269 3 8 8 276 2 268 4.66e-113 411 7S3M1I28M1I3M1I7M1D8M1D20M1I26M1I115M1D54M 97.5
-X73443 193551 96.3 269 2 8 8 276 2 268 2.31e-114 415 7S3M1I28M1I3M1I7M1D8M1D21M1I26M1I114M1D54M 97.5
-X73443 212341 96.3 269 2 8 8 276 2 268 2.31e-114 415 7S3M1I28M1I3M1I7M1D8M1D21M1I26M1I114M1D54M 97.5
-X73443 175883 96 269 3 8 8 276 2 268 4.66e-113 411 7S3M1I28M1I3M1I7M1D8M1D21M1I26M1I114M1D54M 97.5
-AB004750 3888577 100 339 0 0 1 339 26 364 1.61e-166 588 339M 100
-AB004750 581782 97.6 339 8 0 1 339 27 365 4.36e-156 554 339M 100
-AB004750 1108679 97.9 339 7 0 1 339 26 364 2.16e-157 558 339M 100
-AB004750 1109844 97.9 339 7 0 1 339 26 364 2.16e-157 558 339M 100
-AB004750 4418165 99.7 339 1 0 1 339 28 366 3.25e-165 584 339M 100
-xxxxxx 1102995 97.5 361 8 1 1 361 22 383 2.94e-166 588 174M1D187M 100
-xxxxxx 340031 95.6 361 13 3 1 361 23 386 1.07e-158 562 169M3D192M 100
-xxxxxx 340031 95.6 361 13 3 1 361 23 386 1.07e-158 562 169M3D192M 100
-AB004748 581782 98 396 8 0 1 396 27 422 8.13e-186 653 396M 100
-AB004748 1108679 98.2 396 7 0 1 396 26 421 4.04e-187 657 396M 100
-AB004748 1109844 98.2 396 7 0 1 396 26 421 4.04e-187 657 396M 100
-AB004748 3888577 100 396 0 0 1 396 26 421 3.01e-196 687 396M 100
-AB004748 561327 97.5 396 10 0 1 396 1 396 3.3e-183 644 396M 100
-AB000278 554346 98.6 368 5 0 1 368 6 373 4e-175 617 368M 100
-AB000278 160928 97 368 7 4 1 368 33 400 2.94e-166 588 33M1D5M1I8M1I2M1D318M 100
-AB000390 4433053 98.1 317 6 0 1 317 13 329 3.2e-147 524 317M 100
-AB000390 19456 94.4 317 14 4 1 317 12 328 4.28e-132 474 77M2D4M2I234M 100
-AB000390 4432126 94.4 317 14 4 1 317 13 329 4.28e-132 474 77M2D4M2I234M 100

diff -r 70206002b220 -r ec3c4654eacc test-data/assign_taxonomy/sortmerna_taxonomic_assignation.txt
--- a/test-data/assign_taxonomy/sortmerna_taxonomic_assignation.txt Fri May 19 04:09:30 2017 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

@@ -1,8 +0,0 @@
-#OTU ID taxonomy confidence num hits
-AB004750 k__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__; s__ 0.60 5
-AB000390 k__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Vibrionales; f__Vibrionaceae 1.00 3
-xxxxxx k__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Alteromonadales; f__Alteromonadaceae; g__Marinobacter; s__ 1.00 3
-X67228 k__Bacteria; p__Proteobacteria; c__Alphaproteobacteria; o__Rhizobiales; f__Rhizobiaceae 0.60 5
-AB000278 k__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Vibrionales; f__Vibrionaceae; g__Photobacterium 1.00 2
-AB004748 k__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Enterobacteriales; f__Enterobacteriaceae; g__; s__ 0.60 5
-X73443 k__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Lachnospiraceae 1.00 5

diff -r 70206002b220 -r ec3c4654eacc test-data/assign_taxonomy/uclust_taxonomic_assignation.txt
--- a/test-data/assign_taxonomy/uclust_taxonomic_assignation.txt Fri May 19 04:09:30 2017 -0400
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

@@ -1,10 +0,0 @@
-11469739 k__Bacteria; p__OP9; c__JS1; o__SB-45; f__; g__; s__ 1.00 3
-11480235 k__Bacteria; p__OD1; c__; o__; f__; g__; s__ 1.00 1
-11460543 k__Bacteria; p__OP9; c__JS1; o__SB-45; f__; g__; s__ 1.00 3
-11460523 k__Bacteria; p__Proteobacteria; c__Deltaproteobacteria; o__Desulfobacterales; f__Desulfobulbaceae; g__; s__ 1.00 3
-11472286 k__Bacteria; p__WS5; c__; o__; f__; g__; s__ 1.00 1
-11458037 k__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Peptococcaceae; g__Desulfosporosinus; s__meridiei 1.00 3
-11472384 k__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Burkholderiaceae; g__Burkholderia; s__ 0.67 3
-11469752 k__Bacteria; p__TM7; c__TM7-1; o__; f__; g__; s__ 1.00 3
-11480408 k__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__; g__; s__ 1.00 3
-11468680 k__Bacteria; p__Proteobacteria; c__Betaproteobacteria; o__Burkholderiales; f__Burkholderiaceae; g__Burkholderia; s__ 1.00 3