| Next changeset 1:5a2cb67ef742 (2024-04-22) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cnvkit commit e927b17a345b18c1b51dc1b112db5129278dcd22 |
|
added:
breaks.xml macros.xml test-data/access-excludes.bed test-data/capture.antitarget.bed test-data/capture.bed test-data/capture.split.bed test-data/capture.target.bed test-data/excludes.bed test-data/excludes_1.bed test-data/fasta_indexes.loc test-data/gene-breaks.txt test-data/gene-sex.txt test-data/gene_genemetrics.txt test-data/gene_segmetrics.cns test-data/genome.fasta test-data/genome.fasta.fai test-data/multible_capture.antitarget.bed test-data/normal.antitargetcoverage.cnn test-data/normal.bam test-data/normal.bam.bai test-data/normal.targetcoverage.cnn test-data/ref-tas.cnn test-data/reference.antitarget-tmp.bed test-data/reference.cnn test-data/reference.cnn.1 test-data/reference.cnn.2 test-data/reference.target-tmp.bed test-data/sample-diagram.pdf test-data/sample-heatmap.png test-data/sample-scatter.pdf test-data/sample-scatter.png test-data/sample.cnr test-data/sample.cns test-data/sample.targetcoverage.cnn test-data/test.targetcoverage.cnn test-data/tumor-diagram.pdf test-data/tumor-heatmap.png test-data/tumor-scatter.pdf test-data/tumor-scatter.png test-data/tumor.antitargetcoverage.cnn test-data/tumor.bam test-data/tumor.bam.bai test-data/tumor.bintest.cns test-data/tumor.call.cns test-data/tumor.cnr test-data/tumor.cns test-data/tumor.targetcoverage.cnn test-data/tumor_1.bam tool-data/fasta_indexes.loc.sample tool_data_table_conf.xml.sample tool_data_table_conf.xml.test |
| b |
| diff -r 000000000000 -r ef9a50eb20ce breaks.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/breaks.xml Fri Sep 29 15:45:16 2023 +0000 |
| [ |
| @@ -0,0 +1,52 @@ +<tool id="cnvkit_breaks" name="CNVkit Breaks" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="21.05"> + <description>List the targeted genes with segmentaion breakpoint</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="xrefs"/> + <expand macro="creators_and_zahra"/> + <expand macro="requirements"/> + <command detect_errors="exit_code"><![CDATA[ + ln -s '$input_filename_file' ./sample.cnr && + ln -s '$input_segment_file' ./sample.cns && + cnvkit.py breaks + ./sample.cnr + ./sample.cns + --output gene-breaks.txt + #if $min_probes + --min-probes $min_probes + #end if + ]]></command> + <inputs> + <param name="input_filename_file" type="data" format="tabular" label="Bin-Level log2 Ratios/Coverages cnr file" help="The output of the CNVkit fix" /> + <param name="input_segment_file" type="data" format="tabular" label="CN segmentation calls cnn file" help="The output of the CNVkit segment" /> + <param argument="--min-probes" optional="true" type="integer" label="Minimum propes" value="1" help="Minimum number of covered probes to label a gene" /> + </inputs> + <outputs> + <data name="gene_breaks" format="text" label="${tool.name} on ${on_string}:genes with copy number breakpoints" from_work_dir="gene-breaks.txt" /> + </outputs> + <tests> + <test expect_num_outputs="1"> + <param name="input_filename_file" ftype="tabular" value="sample.cnr" /> + <param name="input_segment_file" ftype="tabular" value="sample.cns" /> + <param name="min_probes" value="1" /> + <output name="gene_breaks"> + <assert_contents><has_text text="chromosome"/></assert_contents> + </output> + </test> + </tests> + <help><![CDATA[ + + Identify genes in which: + (I) an unbalanced fusion or other structural rearrangement breakpoint occured + (II) CNV calling is simply difficult due to an inconsistent copy number signal + + The breaks output is a text table of tab-separated values, which is amenable to further processing by + scripts and standard Unix tools such as grep, sort, cut and awk. + ]]></help> + <expand macro="citations" /> +</tool> + + + + |
| b |
| diff -r 000000000000 -r ef9a50eb20ce macros.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Fri Sep 29 15:45:16 2023 +0000 |
| b |
| b'@@ -0,0 +1,256 @@\n+<macros>\n+ <token name="@VERSION_SUFFIX@">0.1</token>\n+ <token name="@TOOL_VERSION@">0.9.10</token>\n+ <xml name="requirements">\n+ <requirements>\n+ <requirement type="package" version="@TOOL_VERSION@">cnvkit</requirement>\n+ <requirement type="package" version="1.0.2">scikit-learn</requirement>\n+ </requirements>\n+ </xml>\n+ <xml name="reference_interface">\n+ <conditional name="reference_source">\n+ <param name="ref_selector" type="select" label="Choose the source for the reference genome">\n+ <option value="cached">Locally cached</option>\n+ <option value="history">History</option>\n+ </param>\n+ <when value="cached">\n+ <param argument="--fasta" optional="true" type="select" label="Reference genome">\n+ <options from_data_table="fasta_indexes">\n+ <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file" />\n+ </options>\n+ </param>\n+ </when>\n+ <when value="history">\n+ <param argument="--fasta" type="data" optional="true" format="fasta" label="Reference" help="Reference sequence" />\n+ </when>\n+ </conditional>\n+ </xml>\n+ <xml name="xrefs">\n+ <xrefs>\n+ <xref type="bio.tools">cnvkit</xref>\n+ </xrefs>\n+ </xml>\n+ <xml name="creators">\n+ <creator>\n+ <person givenName="Khaled" familyName="Jum\'ah" url="https://github.com/khaled196" />\n+ <person givenName="Bj\xc3\xb6rn" familyName="Gr\xc3\xbcning" url="https://github.com/bgruening" />\n+ <person givenName="Katarzyna" familyName="Kamieniecka" url="https://github.com/kkamieniecka" />\n+ <person givenName="Krzysztof" familyName="Poterlowicz" url="https://github.com/poterlowicz-lab" />\n+ <organization name="poterlowicz-lab" url="https://github.com/poterlowicz-lab" />\n+ </creator>\n+ </xml>\n+ <xml name="creators_and_zahra">\n+ <creator>\n+ <person givenName="Khaled" familyName="Jum\'ah" url="https://github.com/khaled196" />\n+ <person givenName="Bj\xc3\xb6rn" familyName="Gr\xc3\xbcning" url="https://github.com/bgruening" />\n+ <person givenName="Katarzyna" familyName="Kamieniecka" url="https://github.com/kkamieniecka" />\n+ <person givenName="zahra" familyName="Karimi" url="https://github.com/zahraK20" />\n+ <person givenName="Krzysztof" familyName="Poterlowicz" url="https://github.com/poterlowicz-lab" />\n+ <organization name="poterlowicz-lab" url="https://github.com/poterlowicz-lab" />\n+ </creator>\n+ </xml>\n+ <xml name="shared">\n+ <param argument="--method" type="select" label="Select the sequencing method of the input files" help="">\n+ <option value="hybrid" selected="True">hybridization capture </option>\n+ <option value="amplicon">targeted amplicon sequencing </option>\n+ <option value="wgs">whole genome sequencing </option>\n+ </param>\n+ <param argument="--segment-method" type="select" label="Method used in the \'segment\' step" help="">\n+ <option value="cbs" selected="True">Circular Binary Segmentation CBS</option>\n+ <option value="flasso">Fused lasso, hybrid flasso</option>\n+ <option value="haar">a pure-Python implementation of HaarSeg, a wavelet-based method. Very fast and performs reasonably well on small panels, but tends to over-segment large datasets., hybrid haar</option>\n+ <option value="none">simply calculate the weighted mean log2 value of each chromosome arm. Useful for testing or debugging, or as a baseline for benchmarking other methods., hybrid none</option>\n+ <option value="hmm">experimental \xe2\x80\x93 a 3-state Hidden Mar'..b'ime than the simpler hmm method., hybrid hmm-tumor</option>\n+ <option value="hmm-germline">experimental \xe2\x80\x93 a 3-state HMM with fixed amplitude for the loss, neutral, and gain states corresponding to absolute copy numbers of 1, 2, and 3. Suitable for germline samples and single-cell sequencing of samples with mostly-diploid genomes that are not overly aneuploid., hybrid hmm-germline</option>\n+ </param>\n+ <param argument="--threshold" optional="true" type="integer" label="Significance threshold" min="1" help="To accept breakpoints during segmentation. For HMM methods, this is the smoothing window size"/>\n+ <param argument="--drop-low-coverage" type="boolean" checked="false" truevalue="--drop-low-coverage" falsevalue="" label="Drop very-low-coverage bins before segmentation" help="To avoid false-positive deletions in poor-quality tumor samples"/>\n+ <param argument="--drop-outliers" optional="true" type="integer" label="Drop outliers" min="1" value="10" help=""/>\n+ <param argument="--smooth-cbs" type="boolean" checked="false" truevalue="--smooth-cbs" falsevalue="" label="Perform an additional smoothing before CBS segmentations" help=""/>\n+ </xml>\n+ <xml name="sample_sex_condition">\n+ <conditional name="Sample_sex">\n+ <param name="sex" type="select" label="Sample sex availabel" help="">\n+ <option value="no" selected="True">Sample sex unknown</option>\n+ <option value="yes">Select sample sex</option>\n+ </param>\n+ <when value="yes">\n+ <expand macro="sample_sex" />\n+ </when>\n+ <when value="no">\n+ </when>\n+ </conditional>\n+ </xml>\n+ <xml name="genemetrics_segmetrics_statistics">\n+ <param argument="--mean" type="boolean" checked="true" truevalue="--mean" falsevalue="" label="Mean log2-ratio" help="" />\n+ <param argument="--median" type="boolean" checked="false" truevalue="--median" falsevalue="" label="Median" help="" /> \n+ <param argument="--mode" type="boolean" checked="false" truevalue="--mode" falsevalue="" label="mode" help="peak density of log2 ratios" />\n+ <param argument="--ttest" type="boolean" checked="false" truevalue="--ttest" falsevalue="" label="One-sample t-test" help="bin log2 ratios versus 0.0" />\n+ <param argument="--stdev" type="boolean" checked="false" truevalue="--stdev" falsevalue="" label="Standard deviation" help="" />\n+ <param argument="--sem" type="boolean" checked="false" truevalue="--sem" falsevalue="" label="Standard error of the mean" help="" />\n+ <param argument="--mad" type="boolean" checked="false" truevalue="--mad" falsevalue="" label="Median absolute deviation" help="" />\n+ <param argument="--mse" type="boolean" checked="false" truevalue="--mse" falsevalue="" label="mean squared error" help="" />\n+ <param argument="--iqr" type="boolean" checked="false" truevalue="--iqr" falsevalue="" label="Inter-quartile range" help="" />\n+ <param argument="--bivar" type="boolean" checked="false" truevalue="--bivar" falsevalue="" label="Tukeys biweight midvariance" help="" />\n+ <param argument="--ci" type="boolean" checked="false" truevalue="--ci" falsevalue="" label="confidence interval" help="" />\n+ <param argument="--pi" type="boolean" checked="false" truevalue="--pi" falsevalue="" label="prediction interval" help="" />\n+ <param argument="--alpha" type="boolean" checked="false" truevalue="--alpha" falsevalue="" label="alpha" help="" />\n+ <param argument="--bootstrap" type="boolean" checked="false" truevalue="--bootstrap" falsevalue="" label="estimate confidence interval" help="number of bootstrp interations" />\n+ </xml>\n+ <xml name="citations">\n+ <citations>\n+ <citation type="doi">10.1371/journal.pcbi.1004873</citation>\n+ </citations>\n+ </xml>\n+</macros>\n' |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/capture.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/capture.bed Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,37 @@ +chrM 576 647 +chrM 647 1601 +chrM 1601 1670 +chrM 1670 3229 +chrM 3229 3304 +chrM 3306 4262 +chrM 4262 4331 +chrM 4328 4400 +chrM 4401 4469 +chrM 4469 5511 +chrM 5511 5579 +chrM 5586 5655 +chrM 5656 5729 +chrM 5760 5826 +chrM 5825 5891 +chrM 5903 7445 +chrM 7445 7514 +chrM 7517 7585 +chrM 7585 8269 +chrM 8294 8364 +chrM 8365 8572 +chrM 8526 9207 +chrM 9206 9990 +chrM 9990 10058 +chrM 10058 10404 +chrM 10404 10469 +chrM 10469 10766 +chrM 10759 12137 +chrM 12137 12206 +chrM 12206 12265 +chrM 12265 12336 +chrM 12336 14148 +chrM 14148 14673 +chrM 14673 14742 +chrM 14746 15887 +chrM 15887 15953 +chrM 15955 16023 |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/capture.split.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/capture.split.bed Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,37 @@ +chrM 576 647 - +chrM 647 1601 - +chrM 1601 1670 - +chrM 1670 3229 - +chrM 3229 3304 - +chrM 3306 4262 - +chrM 4262 4331 - +chrM 4328 4400 - +chrM 4401 4469 - +chrM 4469 5511 - +chrM 5511 5579 - +chrM 5586 5655 - +chrM 5656 5729 - +chrM 5760 5826 - +chrM 5825 5891 - +chrM 5903 7445 - +chrM 7445 7514 - +chrM 7517 7585 - +chrM 7585 8269 - +chrM 8294 8364 - +chrM 8365 8572 - +chrM 8526 9207 - +chrM 9206 9990 - +chrM 9990 10058 - +chrM 10058 10404 - +chrM 10404 10469 - +chrM 10469 10766 - +chrM 10759 12137 - +chrM 12137 12206 - +chrM 12206 12265 - +chrM 12265 12336 - +chrM 12336 14148 - +chrM 14148 14673 - +chrM 14673 14742 - +chrM 14746 15887 - +chrM 15887 15953 - +chrM 15955 16023 - |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/capture.target.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/capture.target.bed Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,12 @@ +chrM 576 3304 - +chrM 3306 4400 - +chrM 4401 5579 - +chrM 5586 5655 - +chrM 5656 5729 - +chrM 5760 5891 - +chrM 5903 7514 - +chrM 7517 8269 - +chrM 8294 8364 - +chrM 8365 14742 - +chrM 14746 15953 - +chrM 15955 16023 - |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/fasta_indexes.loc --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fasta_indexes.loc Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,26 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Samtools indexed sequences data files. You will need +#to create these data files and then create a fasta_indexes.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The fasta_indexes.loc +#file has this format (white space characters are TAB characters): +# +# <unique_build_id> <dbkey> <display_name> <file_base_path> +# +#So, for example, if you had hg19 Canonical indexed stored in +# +# /depot/data2/galaxy/hg19/sam/, +# +#then the fasta_indexes.loc entry would look like this: +# +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /depot/data2/galaxy/hg19/sam/hg19canon.fa +# +#and your /depot/data2/galaxy/hg19/sam/ directory +#would contain hg19canon.fa and hg19canon.fa.fai files. +# +#Your fasta_indexes.loc file should include an entry per line for +#each index set you have stored. The file in the path does actually +#exist, but it should never be directly used. Instead, the name serves +#as a prefix for the index file. For example: +# +test_buildid hg17 test_displayname ${__HERE__}/genome.fasta |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/gene-breaks.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gene-breaks.txt Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,1 @@ +gene chromosome location change probes_left probes_right |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/gene-sex.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gene-sex.txt Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,2 @@ +sample sex X_logratio Y_logratio +./sample.cnr Female NA NA |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/gene_genemetrics.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gene_genemetrics.txt Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,1 @@ +gene chromosome start end log2 |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/gene_segmetrics.cns --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gene_segmetrics.cns Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,2 @@ +chromosome start end gene log2 depth probes weight iqr +chrM 848 16023 - -1.39012 2.05471 54 42.33 1.01226 |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/genome.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/genome.fasta Fri Sep 29 15:45:16 2023 +0000 |
| b |
| b'@@ -0,0 +1,333 @@\n+>chrM\n+NNNCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCAT\n+TTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTG\n+GAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATT\n+CTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACCTACTA\n+AAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATAACAATTGAAT\n+GTCTGCACAGCCGCTTTCCACACAGACATCATAACAAAAAATTTCCACCA\n+AACCCCCCCCTCCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGC\n+CAAACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAAT\n+TTTATCTTTAGGCGGTATGCACTTTTAACAGTCACCCCCCAACTAACACA\n+TTATTTTCCCCTCCCACTCCCATACTACTAATCTCATCAATACAACCCCC\n+GCCCATCCTACCCAGCACACACACACCGCTGCTAACCCCATACCCCGAAC\n+CAACCAAACCCCAAAGACACCCCCCACAGTTTATGTAGCTTACCTCCTCA\n+AAGCAATACACTGAAAATGTTTAGACGGGCTCACATCACCCCATAAACAA\n+ATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACACATGC\n+AAGCATCCCCGTTCCAGTGAGTTCACCCTCTAAATCACCACGATCAAAAG\n+GGACAAGCATCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCC\n+ACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGT\n+TTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACC\n+GCGGTCACACGATTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTT\n+TAGATCACCCCCTCCCCAATAAAGCTAAAACTCACCTGAGTTGTAAAAAA\n+CTCCAGTTGACACAAAATAGACTACGAAAGTGGCTTTAACATATCTGAAC\n+ACACAATAGCTAAGACCCAAACTGGGATTAGATACCCCACTATGCTTAGC\n+CCTAAACCTCAACAGTTAAATCAACAAAACTGCTCGCCAGAACACTACGA\n+GCCACAGCTTAAAACTCAAAGGACCTGGCGGTGCTTCATATCCCTCTAGA\n+GGAGCCTGTTCTGTAATCGATAAACCCCGATCAACCTCACCACCTCTTGC\n+TCAGCCTATATACCGCCATCTTCAGCAAACCCTGATGAAGGCTACAAAGT\n+AAGCGCAAGTACCCACGTAAAGACGTTAGGTCAAGGTGTAGCCCATGAGG\n+TGGCAAGAAATGGGCTACATTTTCTACCCCAGAAAACTACGATAGCCCTT\n+ATGAAACTTAAGGGTCGAAGGTGGATTTAGCAGTAAACTGAGAGTAGAGT\n+GCTTAGTTGAACAGGGCCCTGAAGCGCGTACACACCGCCCGTCACCCTCC\n+TCAAGTATACTTCAAAGGACATTTAACTAAAACCCCTACGCATTTATATA\n+GAGGAGACAAGTCGTAACATGGTAAGTGTACTGGAAAGTGCACTTGGACG\n+AACCAGAGTGTAGCTTAACACAAAGCACCCAACTTACACTTAGGAGATTT\n+CAACTTAACTTGACCGCTCTGAGCTAAACCTAGCCCCAAACCCACTCCAC\n+CTTACTACCAGACAACCTTAGCCAAACCATTTACCCAAATAAAGTATAGG\n+CGATAGAAATTGAAACCTGGCGCAATAGATATAGTACCGCAAGGGAAAGA\n+TGAAAAATTATAACCAAGCATAATATAGCAAGGACTAACCCCTATACCTT\n+CTGCATAATGAATTAACTAGAAATAACTTTGCAAGGAGAGCCAAAGCTAA\n+GACCCCCGAAACCAGACGAGCTACCTAAGAACAGCTAAAAGAGCACACCC\n+GTCTATGTAGCAAAATAGTGGGAAGATTTATAGGTAGAGGCGACAAACCT\n+ACCGAGCCTGGTGATAGCTGGTTGTCCAAGATAGAATCTTAGTTCAACTT\n+TAAATTTGCCCACAGAACCCTCTAAATCCCCTTGTAAATTTAACTGTTAG\n+TCCAAAGAGGAACAGCTCTTTGGACACTAGGAAAAAACCTTGTAGAGAGA\n+GTAAAAAATTTAACACCCATAGTAGGCCTAAAAGCAGCCACCAATTAAGA\n+AAGCGTTCAAGCTCAACACCCACTACCTAAAAAATCCCAAACATATAACT\n+GAACTCCTCACACCCAATTGGACCAATCTATCACCCTATAGAAGAACTAA\n+TGTTAGTATAAGTAACATGAAAACATTCTCCTCCGCATAAGCCTGCGTCA\n+GATCAAAACACTGAACTGACAATTAACAGCCCAATATCTACAATCAACCA\n+ACAAGTCATTATTACCCTCACTGTCAACCCAACACAGGCATGCTCATAAG\n+GAAAGGTTAAAAAAAGTAAAAGGAACTCGGCAAACCTTACCCCGCCTGTT\n+TACCAAAAACATCACCTCTAGCATCACCAGTATTAGAGGCACCGCCTGCC\n+CAGTGACACATGTTTAACGGCCGCGGTACCCTAACCGTGCAaaggtagca\n+taatcacttgttccttaaatagggacctgtatgaatggctccacgagggt\n+tcagctgtctcttacttttaaccagtgaaattgacctgcccgtgaagagg\n+cgggcatgacacagcaagacgagaagaccctatggagctttaatttaTTA\n+ATGCAAACAGTACCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCA\n+TTAAAAATTTCGGTTGGGGCGACCTCGGAGCAGAACCCAACCTCCGAGCA\n+GTACATGCTAAGACTTCACCAGTCAAAGCGAACTACTATACTCAATTGAT\n+CCAATAACTTGACCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATC\n+CTATTCTAGAGTCCATATCAACAATAGGGTTTACGACCTCGATGTTGGAT\n+CAGGACATCCCGATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGA\n+TTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTT\n+CTATCTACTTCAAATTCCTCCCTGTACGAAAGGACAAGAGAAATAAGGCC\n+TACTTCACAAAGCGCCTTCCCCCGTAAATGATATCATCTCAACTTAGTAT\n+TATACCCACACCCACCCAAGAACAGGGTTTgttaagatggcagagcccgg\n+taatcgcataaaacttaaaactttacagtcagaggttcaattcctcttct\n+taacaacaTACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAA\n+TCGCAATGGCATTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATA\n+CAACTACGCAAAGGCCCCAACGTTGTAGGCCCCTACGGGCTACTACAACC\n+CTTCGCTGACGCCATAAAACTCTTCACCAAAGAGCCCCTAAAACCCGCCA\n+CATCTACCATCACCCTCTACATCACCGCCCCGACCTTAGCTCTCACCATC\n+GCTCTTCTACTATGAACCCCCCTCCCCATACCCAACCCCCTGGTCAACCT\n+CAACCTAGGCCTCCTATTTATTCTAGCCACCTCTAGCCTAGCCGTTTACT\n+CAATCCTCTGATCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGC\n+GCACTGCGAGCAGTAGCCCAAACAATCTCATATGAAGTCACCCTAGCCAT\n+CATTCTACTATCAACATTACTAATAAGTGGCTCCTTTAACCTCTCCACCC\n+TTATCACAACACAAGAACACC'..b'TTAGTTACCGCTAACAACCTATT\n+CCAACTGTTCATCGGCTGAGAGGGCGTAGGAATTATATCCTTCTTGCTCA\n+TCAGTTGATGATACGCCCGAGCAGATGCCAACACAGCAGCCATTCAAGCA\n+GTCCTATACAACCGTATCGGCGATATCGGTTTCATCCTCGCCTTAGCATG\n+ATTTATCCTACACTCCAACTCATGAGACCCACAACAAATAGCCCTTCTAA\n+ACGCTAATCCAAGCCTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCA\n+GGCAAATCAGCCCAATTAGGTCTCCACCCCTGACTCCCCTCAGCCATAGA\n+AGGCCCCACCCCAGTCTCAGCCCTACTCCACTCAAGCACTATAGTTGTAG\n+CAGGAATCTTCTTACTCATCCGCTTCCACCCCCTAGCAGAAAATAGCCCA\n+CTAATCCAAACTCTAACACTATGCTTAGGCGCTATCACCACTCTGTTCGC\n+AGCAGTCTGCGCCCTTACACAAAATGACATCAAAAAAATCGTAGCCTTCT\n+CCACTTCAAGTCAACTAGGACTCATAATAGTTACAATCGGCATCAACCAA\n+CCACACCTAGCATTCCTGCACATCTGTACCCACGCCTTCTTCAAAGCCAT\n+ACTATTTATGTGCTCCGGGTCCATCATCCACAACCTTAACAATGAACAAG\n+ATATTCGAAAAATAGGAGGACTACTCAAAACCATACCTCTCACTTCAACC\n+TCCCTCACCATTGGCAGCCTAGCATTAGCAGGAATACCTTTCCTCACAGG\n+TTTCTACTCCAAAGACCACATCATCGAAACCGCAAACATATCATACACAA\n+ACGCCTGAGCCCTATCTATTACTCTCATCGCTACCTCCCTGACAAGCGCC\n+TATAGCACTCGAATAATTCTTCTCACCCTAACAGGTCAACCTCGCTTCCC\n+CACCCTTACTAACATTAACGAAAATAACCCCACCCTACTAAACCCCATTA\n+AACGCCTGGCAGCCGGAAGCCTATTCGCAGGATTTCTCATTACTAACAAC\n+ATTTCCCCCGCATCCCCCTTCCAAACAACAATCCCCCTCTACCTAAAACT\n+CACAGCCCTCGCTGTCACTTTCCTAGGACTTCTAACAGCCCTAGACCTCA\n+ACTACCTAACCAACAAACTTAAAATAAAATCCCCACTATGCACATTTTAT\n+TTCTCCAACATACTCGGATTCTACCCTAGCATCACACACCGCACAATCCC\n+CTATCTAGGCCTTCTTACGAGCCAAAACCTGCCCCTACTCCTCCTAGACC\n+TAACCTGACTAGAAAAGCTATTACCTAAAACAATTTCACAGCACCAAATC\n+TCCACCTCCATCATCACCTCAACCCAAAAAGGCATAATTAAACTTTACTT\n+CCTCTCTTTCTTCTTCCCACTCATCCTAACCCTACTCCTAATCACATAAC\n+CTATTCCCCCGAGCAATCTCAATTACAATATATACACCAACAAACAATGT\n+TCAACCAGTAACCACTACTAATCAACGCCCATAATCATACAAAGCCCCCG\n+CACCAATAGGATCCTCCCGAATCAACCCTGACCCCTCTCCTTCATAAATT\n+ATTCAGCTTCCTACACTATTAAAGTTTACCACAACCACCACCCCATCATA\n+CTCTTTCACCCACAGCACCAATCCTACCTCCATCGCTAACCCCACTAAAA\n+CACTCACCAAGACCTCAACCCCTGACCCCCATGCCTCAGGATACTCCTCA\n+ATAGCCATCGCTGTAGTATATCCAAAGACAACCATCATTCCCCCTAAATA\n+AATTAAAAAAACTATTAAACCCATATAACCTCCCCCAAAATTCAGAATAA\n+TAACACACCCGACCACACCGCTAACAATCAGTACTAAACCCCCATAAATA\n+GGAGAAGGCTTAGAAGAAAACCCCACAAACCCCATTACTAAACCCACACT\n+CAACAGAAACAAAGCATACATCATTATTCTCGCACGGACTACAACCACGA\n+CCAATGATATGAAAAACCATCGTTGTATTTCAACTACAAGAACACCAATG\n+ACCCCAATACGCAAAATTAACCCCCTAATAAAATTAATTAACCACTCATT\n+CATCGACCTCCCCACCCCATCCAACATCTCCGCATGATGAAACTTCGGCT\n+CACTCCTTGGCGCCTGCCTGATCCTCCAAATCACCACAGGACTATTCCTA\n+GCCATACACTACTCACCAGACGCCTCAACCGCCTTTTCATCAATCGCCCA\n+CATCACTCGAGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCA\n+ATGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGC\n+CTATATTACGGATCATTTCTCTACTCAGAAACCTGAAACATCGGCATTAT\n+CCTCCTGCTTGCAACTATAGCAACAGCCTTCATAGGCTATGTCCTCCCGT\n+GAGGCCAAATATCATTCTGAGGGGCCACAGTAATTACAAACTTACTATCC\n+GCCATCCCATACATTGGGACAGACCTAGTTCAATGAATCTGAGGAGGCTA\n+CTCAGTAGACAGTCCCACCCTCACACGATTCTTTACCTTTCACTTCATCT\n+TACCCTTCATTATTGCAGCCCTAGCAGCACTCCACCTCCTATTCTTGCAC\n+GAAACGGGATCAAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAAT\n+CACCTTCCACCCTTACTACACAATCAAAGACGCCCTCGGCTTACTTCTCT\n+TCCTTCTCTCCTTAATGACATTAACACTATTCTCACCAGACCTCCTAGGC\n+GACCCAGACAATTATACCCTAGCCAACCCCTTAAACACCCCTCCCCACAT\n+CAAGCCCGAATGATATTTCCTATTCGCCTACACAATTCTCCGATCCGTCC\n+CTAACAAACTAGGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTA\n+GCAATAATCCCCATCCTCCATATATCCAAACAACAAAGCATAATATTTCG\n+CCCACTAAGCCAATCACTTTATTGACTCCTAGCCGCAGACCTCCTCATTC\n+TAACCTGAATCGGAGGACAACCAGTAAGCTACCCTTTTACCATCATTGGA\n+CAAGTAGCATCCGTACTATACTTCACAACAATCCTAATCCTAATACCAAC\n+TATCTCCCTAATTGAAAACAAAATACTCAAATGGGCCTGTCCTTGTAGTA\n+TAAACTAATACACCAGTCTTGTAAACCGGAGACGAAAACCTTTTTCCAAG\n+GACAAATCAGAGAAAAAGTCTTTAACTCCACCATTAGCACCCAAAGCTAA\n+GATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGG\n+TACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTAC\n+ATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCA\n+CCTGTAGTACATAAAAACCCAACCCACATCAAACCCCCCCCCCCCATGCT\n+TACAAGCAAGTACAGCAATCAACCTTCAACTATCACACATCAACTGCAAC\n+TCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTT\n+AACAGTACATAGTACATAAAGTCATTTACCGTACATAGCACATTACAGTC\n+AAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTG\n+ACCACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCT\n+CGCTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGAC\n+ATCTGGTTCCTACTTCAGGGCCATAAAGCCTAAATAGCCCACACGTTCCC\n+CTTAAATAAGACATCACGATG\n' |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/genome.fasta.fai --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/genome.fasta.fai Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,1 @@ +chrM 16571 6 50 51 |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/normal.antitargetcoverage.cnn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/normal.antitargetcoverage.cnn Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,1 @@ +chromosome start end gene log2 |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/normal.bam |
| b |
| Binary file test-data/normal.bam has changed |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/normal.bam.bai |
| b |
| Binary file test-data/normal.bam.bai has changed |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/normal.targetcoverage.cnn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/normal.targetcoverage.cnn Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,62 @@ +chromosome start end gene depth log2 +chrM 576 848 - 493.485 8.94686 +chrM 848 1121 - 22.4469 4.48844 +chrM 1121 1394 - 4.59341 2.19956 +chrM 1394 1667 - 11.022 3.46231 +chrM 1667 1940 - 7.45055 2.89735 +chrM 1940 2212 - 1.36029 0.443919 +chrM 2212 2485 - 10.6081 3.40709 +chrM 2485 2758 - 31.7436 4.98839 +chrM 2758 3031 - 5.35531 2.42097 +chrM 3031 3304 - 7.55678 2.91777 +chrM 3306 3579 - 10.9817 3.45703 +chrM 3579 3853 - 12.719 3.66891 +chrM 3853 4126 - 7.17949 2.84388 +chrM 4126 4400 - 1.65693 0.728516 +chrM 4401 4695 - 5.18707 2.37492 +chrM 4695 4990 - 17.7458 4.1494 +chrM 4990 5284 - 5.94218 2.57099 +chrM 5284 5579 - 20.8136 4.37945 +chrM 5586 5655 - 9.37681 3.2291 +chrM 5656 5729 - 4.76712 2.25312 +chrM 5760 5891 - 10.5954 3.40537 +chrM 5903 6171 - 13.8097 3.78761 +chrM 6171 6440 - 13.5353 3.75866 +chrM 6440 6708 - 11.3657 3.50661 +chrM 6708 6977 - 7.80669 2.96471 +chrM 6977 7245 - 15.3321 3.93848 +chrM 7245 7514 - 2.52045 1.33368 +chrM 7517 7767 - 8.152 3.02715 +chrM 7767 8018 - 19.2311 4.26537 +chrM 8018 8269 - 6.7251 2.74956 +chrM 8294 8364 - 0 -20 +chrM 8365 8630 - 2.89811 1.53511 +chrM 8630 8896 - 7.87594 2.97745 +chrM 8896 9162 - 13.5451 3.7597 +chrM 9162 9427 - 9.68302 3.27546 +chrM 9427 9693 - 3.43233 1.77919 +chrM 9693 9959 - 5.87594 2.55482 +chrM 9959 10224 - 3.59623 1.84648 +chrM 10224 10490 - 2.99624 1.58315 +chrM 10490 10756 - 7.1015 2.82812 +chrM 10756 11022 - 4.00376 2.00136 +chrM 11022 11287 - 11.2377 3.49028 +chrM 11287 11553 - 10.2932 3.36362 +chrM 11553 11819 - 11.109 3.47366 +chrM 11819 12084 - 11.1509 3.47909 +chrM 12084 12350 - 10.1353 3.34132 +chrM 12350 12616 - 9.23684 3.2074 +chrM 12616 12882 - 9.39474 3.23185 +chrM 12882 13147 - 15.834 3.98495 +chrM 13147 13413 - 8.90226 3.15417 +chrM 13413 13679 - 12.218 3.61094 +chrM 13679 13944 - 4.30943 2.1075 +chrM 13944 14210 - 8.87218 3.14929 +chrM 14210 14476 - 9.2218 3.20505 +chrM 14476 14742 - 33.8872 5.08267 +chrM 14746 14987 - 28.1369 4.81439 +chrM 14987 15228 - 14.2531 3.83321 +chrM 15228 15470 - 9.3719 3.22834 +chrM 15470 15711 - 11.2946 3.49756 +chrM 15711 15953 - 6.29752 2.65478 +chrM 15955 16023 - 4.13235 2.04696 |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/ref-tas.cnn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/ref-tas.cnn Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,62 @@ +chromosome start end gene log2 depth spread +chrM 576 848 - 3.256 91.9926 4.82735 +chrM 848 1121 - 0.884565 5.9011 1.31146 +chrM 1121 1394 - -0.165367 1.4359 0.245173 +chrM 1394 1667 - 0.909286 3.78022 1.34811 +chrM 1667 1940 - 0 1.80586 0 +chrM 1940 2212 - -2.82466 0.0404412 4.18784 +chrM 2212 2485 - -0.0642305 1.65201 0.0952281 +chrM 2485 2758 - 0.01695 4.0696 0.0251301 +chrM 2758 3031 - -0.315323 0.717949 0.467498 +chrM 3031 3304 - 0.157569 1.33333 0.233612 +chrM 3306 3579 - -0.387402 0.626374 0.574362 +chrM 3579 3853 - 0 2.30292 0 +chrM 3853 4126 - 0.202715 2.74359 0.300545 +chrM 4126 4400 - -0.259225 0.748175 0.384327 +chrM 4401 4695 - -0.0877248 0.94898 0.130061 +chrM 4695 4990 - 0.16791 5.01695 0.248943 +chrM 4990 5284 - -0.25963 1.73129 0.384927 +chrM 5284 5579 - 0.810516 5.97966 1.20167 +chrM 5586 5655 - -10.4795 0 15.5369 +chrM 5656 5729 - 0 0 0 +chrM 5760 5891 - 0.415822 1.79389 0.616498 +chrM 5903 6171 - 0.131623 2.15299 0.195144 +chrM 6171 6440 - 0 2.02974 0 +chrM 6440 6708 - -0.0963015 1.51493 0.142777 +chrM 6708 6977 - 0 2.03717 0 +chrM 6977 7245 - 0.40989 3.05597 0.607703 +chrM 7245 7514 - -0.047091 1.24907 0.0698171 +chrM 7517 7767 - 0.271996 1.944 0.403261 +chrM 7767 8018 - 0.07072 2.24701 0.104849 +chrM 8018 8269 - -0.415822 1.00797 0.616498 +chrM 8294 8364 - -10.0057 0 14.8345 +chrM 8365 8630 - 0 1.0717 0 +chrM 8630 8896 - 0.485791 2.07895 0.720233 +chrM 8896 9162 - 0.280695 3.66165 0.416158 +chrM 9162 9427 - 0.563397 3.60755 0.835292 +chrM 9427 9693 - -0.195679 0.808271 0.290114 +chrM 9693 9959 - 0 2.07143 0 +chrM 9959 10224 - -4.10122 0.00377358 6.08048 +chrM 10224 10490 - -0.248445 1.44361 0.368345 +chrM 10490 10756 - -0.0920355 1.82331 0.136452 +chrM 10756 11022 - -0.51737 1.12406 0.767054 +chrM 11022 11287 - 0.26621 4.27925 0.394683 +chrM 11287 11553 - 0.350607 2.93609 0.519809 +chrM 11553 11819 - -0.0341651 1.06015 0.0506531 +chrM 11819 12084 - 0.590516 2.40377 0.875498 +chrM 12084 12350 - -1.0261 0.736842 1.5213 +chrM 12350 12616 - -0.64663 0.736842 0.958694 +chrM 12616 12882 - 0.295587 2.48872 0.438237 +chrM 12882 13147 - 0.50247 4.50943 0.744962 +chrM 13147 13413 - -0.322016 1.47368 0.477422 +chrM 13413 13679 - 0.356127 2.95865 0.527993 +chrM 13679 13944 - -0.0012925 1.64906 0.00191626 +chrM 13944 14210 - -0.865739 0.890977 1.28355 +chrM 14210 14476 - -0.4233 2.21053 0.627585 +chrM 14476 14742 - 0.598181 4.45489 0.886863 +chrM 14746 14987 - 1.03347 8.14523 1.53222 +chrM 14987 15228 - 0.355932 2.48133 0.527704 +chrM 15228 15470 - 0 1.11157 0 +chrM 15470 15711 - 0.393765 3.9751 0.583796 +chrM 15711 15953 - -0.312504 0.809917 0.463318 +chrM 15955 16023 - 0 0 0 |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/reference.cnn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/reference.cnn Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,62 @@ +chromosome start end gene log2 depth gc rmask spread +chrM 576 848 - 2.75864 493.485 0.444853 4.08996 +chrM 848 1121 - 0.525695 22.4469 0.428571 0.779395 +chrM 1121 1394 - -0.84681 4.59341 0.483516 1.25548 +chrM 1394 1667 - 0.38341 11.022 0.450549 0.568444 +chrM 1667 1940 - -0.04005 7.45055 0.406593 0.0593781 +chrM 1940 2212 - -1.22672 1.36029 0.411765 1.81873 +chrM 2212 2485 - 0.21482 10.6081 0.388278 0.318492 +chrM 2485 2758 - 0.64779 31.7436 0.479853 0.960413 +chrM 2758 3031 - -0.27752 5.35531 0.457875 0.411451 +chrM 3031 3304 - 0.359575 7.55678 0.424908 0.533106 +chrM 3306 3579 - 0.03537 10.9817 0.509158 0.0524396 +chrM 3579 3853 - 0.026615 12.719 0.485401 0.0394594 +chrM 3853 4126 - 0 7.17949 0.450549 0 +chrM 4126 4400 - -0.485607 1.65693 0.423358 0.719961 +chrM 4401 4695 - -0.343535 5.18707 0.442177 0.509325 +chrM 4695 4990 - 0.603865 17.7458 0.427119 0.89529 +chrM 4990 5284 - -0.43303 5.94218 0.428571 0.64201 +chrM 5284 5579 - 0.5605 20.8136 0.410169 0.830997 +chrM 5586 5655 - -0.008305 9.37681 0.449275 0.012313 +chrM 5656 5729 - -0.462405 4.76712 0.410959 0.685562 +chrM 5760 5891 - 0.02536 10.5954 0.442748 0.0375987 +chrM 5903 6171 - 0.008305 13.8097 0.473881 0.012313 +chrM 6171 6440 - 0.19261 13.5353 0.498141 0.285564 +chrM 6440 6708 - 0 11.3657 0.470149 0 +chrM 6708 6977 - -0.132195 7.80669 0.457249 0.195992 +chrM 6977 7245 - 0.107015 15.3321 0.458955 0.15866 +chrM 7245 7514 - -0.50723 2.52045 0.420074 0.752019 +chrM 7517 7767 - 0.316705 8.152 0.372 0.469547 +chrM 7767 8018 - 0.49084 19.2311 0.501992 0.727719 +chrM 8018 8269 - -0.371965 6.7251 0.446215 0.551475 +chrM 8294 8364 - -11.0488 0 0.342857 16.381 +chrM 8365 8630 - -0.331755 2.89811 0.426415 0.49186 +chrM 8630 8896 - 0.13461 7.87594 0.406015 0.199573 +chrM 8896 9162 - -0.03223 13.5451 0.466165 0.0477842 +chrM 9162 9427 - -0.31024 9.68302 0.498113 0.459962 +chrM 9427 9693 - -0.712625 3.43233 0.466165 1.05654 +chrM 9693 9959 - -0.272205 5.87594 0.443609 0.403571 +chrM 9959 10224 - -0.26954 3.59623 0.377358 0.39962 +chrM 10224 10490 - -0.09971 2.99624 0.349624 0.14783 +chrM 10490 10756 - -0.241135 7.1015 0.43985 0.357507 +chrM 10756 11022 - -0.2582 4.00376 0.424812 0.382807 +chrM 11022 11287 - 0.01037 11.2377 0.430189 0.0153746 +chrM 11287 11553 - 0.06726 10.2932 0.443609 0.0997197 +chrM 11553 11819 - 0 11.109 0.466165 0 +chrM 11819 12084 - 0.28666 11.1509 0.441509 0.425002 +chrM 12084 12350 - 0.40266 10.1353 0.417293 0.596984 +chrM 12350 12616 - 0 9.23684 0.428571 0 +chrM 12616 12882 - 0.16725 9.39474 0.406015 0.247965 +chrM 12882 13147 - 0.13976 15.834 0.520755 0.207208 +chrM 13147 13413 - -0.026615 8.90226 0.432331 0.0394594 +chrM 13413 13679 - 0.00138 12.218 0.462406 0.00204599 +chrM 13679 13944 - -0.82452 4.30943 0.467925 1.22243 +chrM 13944 14210 - 0.317015 8.87218 0.413534 0.470006 +chrM 14210 14476 - -0.24388 9.2218 0.477444 0.361576 +chrM 14476 14742 - 0.87922 33.8872 0.383459 1.30353 +chrM 14746 14987 - 0.43224 28.1369 0.481328 0.640839 +chrM 14987 15228 - 0.289845 14.2531 0.46888 0.429724 +chrM 15228 15470 - -0.008065 9.3719 0.466942 0.0119572 +chrM 15470 15711 - 0.01195 11.2946 0.46473 0.0177171 +chrM 15711 15953 - -0.03537 6.29752 0.404959 0.0524396 +chrM 15955 16023 - 0 4.13235 0.323529 0 |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/reference.cnn.1 --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/reference.cnn.1 Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,62 @@ +chromosome start end gene log2 depth gc rmask spread +chrM 576 848 - 2.75864 493.485 0.444853 4.08996 +chrM 848 1121 - 0.525695 22.4469 0.428571 0.779395 +chrM 1121 1394 - -0.84681 4.59341 0.483516 1.25548 +chrM 1394 1667 - 0.38341 11.022 0.450549 0.568444 +chrM 1667 1940 - -0.04005 7.45055 0.406593 0.0593781 +chrM 1940 2212 - -1.22672 1.36029 0.411765 1.81873 +chrM 2212 2485 - 0.21482 10.6081 0.388278 0.318492 +chrM 2485 2758 - 0.64779 31.7436 0.479853 0.960413 +chrM 2758 3031 - -0.27752 5.35531 0.457875 0.411451 +chrM 3031 3304 - 0.359575 7.55678 0.424908 0.533106 +chrM 3306 3579 - 0.03537 10.9817 0.509158 0.0524396 +chrM 3579 3853 - 0.026615 12.719 0.485401 0.0394594 +chrM 3853 4126 - 0 7.17949 0.450549 0 +chrM 4126 4400 - -0.485607 1.65693 0.423358 0.719961 +chrM 4401 4695 - -0.343535 5.18707 0.442177 0.509325 +chrM 4695 4990 - 0.603865 17.7458 0.427119 0.89529 +chrM 4990 5284 - -0.43303 5.94218 0.428571 0.64201 +chrM 5284 5579 - 0.5605 20.8136 0.410169 0.830997 +chrM 5586 5655 - -0.008305 9.37681 0.449275 0.012313 +chrM 5656 5729 - -0.462405 4.76712 0.410959 0.685562 +chrM 5760 5891 - 0.02536 10.5954 0.442748 0.0375987 +chrM 5903 6171 - 0.008305 13.8097 0.473881 0.012313 +chrM 6171 6440 - 0.19261 13.5353 0.498141 0.285564 +chrM 6440 6708 - 0 11.3657 0.470149 0 +chrM 6708 6977 - -0.132195 7.80669 0.457249 0.195992 +chrM 6977 7245 - 0.107015 15.3321 0.458955 0.15866 +chrM 7245 7514 - -0.50723 2.52045 0.420074 0.752019 +chrM 7517 7767 - 0.316705 8.152 0.372 0.469547 +chrM 7767 8018 - 0.49084 19.2311 0.501992 0.727719 +chrM 8018 8269 - -0.371965 6.7251 0.446215 0.551475 +chrM 8294 8364 - -11.0488 0 0.342857 16.381 +chrM 8365 8630 - -0.331755 2.89811 0.426415 0.49186 +chrM 8630 8896 - 0.13461 7.87594 0.406015 0.199573 +chrM 8896 9162 - -0.03223 13.5451 0.466165 0.0477842 +chrM 9162 9427 - -0.31024 9.68302 0.498113 0.459962 +chrM 9427 9693 - -0.712625 3.43233 0.466165 1.05654 +chrM 9693 9959 - -0.272205 5.87594 0.443609 0.403571 +chrM 9959 10224 - -0.26954 3.59623 0.377358 0.39962 +chrM 10224 10490 - -0.09971 2.99624 0.349624 0.14783 +chrM 10490 10756 - -0.241135 7.1015 0.43985 0.357507 +chrM 10756 11022 - -0.2582 4.00376 0.424812 0.382807 +chrM 11022 11287 - 0.01037 11.2377 0.430189 0.0153746 +chrM 11287 11553 - 0.06726 10.2932 0.443609 0.0997197 +chrM 11553 11819 - 0 11.109 0.466165 0 +chrM 11819 12084 - 0.28666 11.1509 0.441509 0.425002 +chrM 12084 12350 - 0.40266 10.1353 0.417293 0.596984 +chrM 12350 12616 - 0 9.23684 0.428571 0 +chrM 12616 12882 - 0.16725 9.39474 0.406015 0.247965 +chrM 12882 13147 - 0.13976 15.834 0.520755 0.207208 +chrM 13147 13413 - -0.026615 8.90226 0.432331 0.0394594 +chrM 13413 13679 - 0.00138 12.218 0.462406 0.00204599 +chrM 13679 13944 - -0.82452 4.30943 0.467925 1.22243 +chrM 13944 14210 - 0.317015 8.87218 0.413534 0.470006 +chrM 14210 14476 - -0.24388 9.2218 0.477444 0.361576 +chrM 14476 14742 - 0.87922 33.8872 0.383459 1.30353 +chrM 14746 14987 - 0.43224 28.1369 0.481328 0.640839 +chrM 14987 15228 - 0.289845 14.2531 0.46888 0.429724 +chrM 15228 15470 - -0.008065 9.3719 0.466942 0.0119572 +chrM 15470 15711 - 0.01195 11.2946 0.46473 0.0177171 +chrM 15711 15953 - -0.03537 6.29752 0.404959 0.0524396 +chrM 15955 16023 - 0 4.13235 0.323529 0 |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/reference.cnn.2 --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/reference.cnn.2 Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,62 @@ +chromosome start end gene log2 depth spread +chrM 576 848 - 3.09865 493.485 4.59406 +chrM 848 1121 - 0.49908 22.4469 0.739936 +chrM 1121 1394 - -0.516145 4.59341 0.765237 +chrM 1394 1667 - 0.24243 11.022 0.359427 +chrM 1667 1940 - -0.16725 7.45055 0.247965 +chrM 1940 2212 - -1.38174 1.36029 2.04857 +chrM 2212 2485 - 0.08762 10.6081 0.129905 +chrM 2485 2758 - 0.65974 31.7436 0.978131 +chrM 2758 3031 - -0.403685 5.35531 0.598503 +chrM 3031 3304 - 0.131495 7.55678 0.194954 +chrM 3306 3579 - 0.401125 10.9817 0.594708 +chrM 3579 3853 - 0.25737 12.719 0.381577 +chrM 3853 4126 - 0 7.17949 0 +chrM 4126 4400 - -1.09463 1.65693 1.62289 +chrM 4401 4695 - -0.271425 5.18707 0.402415 +chrM 4695 4990 - 0.32592 17.7458 0.483209 +chrM 4990 5284 - -0.46781 5.94218 0.693575 +chrM 5284 5579 - 0.575175 20.8136 0.852754 +chrM 5586 5655 - 0 9.37681 0 +chrM 5656 5729 - -0.24822 4.76712 0.368011 +chrM 5760 5891 - 0.327905 10.5954 0.486152 +chrM 5903 6171 - 0.19112 13.8097 0.283355 +chrM 6171 6440 - 0.45739 13.5353 0.678126 +chrM 6440 6708 - 0 11.3657 0 +chrM 6708 6977 - -0.121345 7.80669 0.179906 +chrM 6977 7245 - 0.215935 15.3321 0.320145 +chrM 7245 7514 - -0.846735 2.52045 1.25537 +chrM 7517 7767 - -0.100975 8.152 0.149706 +chrM 7767 8018 - 0.710745 19.2311 1.05375 +chrM 8018 8269 - -0.327905 6.7251 0.486152 +chrM 8294 8364 - -11.6145 0 17.2197 +chrM 8365 8630 - -0.559835 2.89811 0.830011 +chrM 8630 8896 - 0 7.87594 0 +chrM 8896 9162 - 0.126545 13.5451 0.187616 +chrM 9162 9427 - 0 9.68302 0 +chrM 9427 9693 - -0.59913 3.43233 0.88827 +chrM 9693 9959 - -0.204945 5.87594 0.303851 +chrM 9959 10224 - -0.69093 3.59623 1.02437 +chrM 10224 10490 - -0.69078 2.99624 1.02415 +chrM 10490 10756 - -0.163025 7.1015 0.241701 +chrM 10756 11022 - -0.601845 4.00376 0.892295 +chrM 11022 11287 - 0.07448 11.2377 0.110424 +chrM 11287 11553 - 0.07811 10.2932 0.115806 +chrM 11553 11819 - 0.12266 11.109 0.181856 +chrM 11819 12084 - 0.25082 11.1509 0.371866 +chrM 12084 12350 - 0 10.1353 0 +chrM 12350 12616 - 0 9.23684 0 +chrM 12616 12882 - 0.13357 9.39474 0.198031 +chrM 12882 13147 - 0.41539 15.834 0.615857 +chrM 13147 13413 - -0.171695 8.90226 0.254555 +chrM 13413 13679 - 0.16774 12.218 0.248691 +chrM 13679 13944 - -0.61691 4.30943 0.914631 +chrM 13944 14210 - -0.096015 8.87218 0.142352 +chrM 14210 14476 - -0.146255 9.2218 0.216838 +chrM 14476 14742 - 0.926785 33.8872 1.37405 +chrM 14746 14987 - 0.792645 28.1369 1.17518 +chrM 14987 15228 - 0.179775 14.2531 0.266534 +chrM 15228 15470 - 0 9.3719 0 +chrM 15470 15711 - 0 11.2946 0 +chrM 15711 15953 - -0.131495 6.29752 0.194954 +chrM 15955 16023 - -0.10308 4.13235 0.152826 |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/reference.target-tmp.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/reference.target-tmp.bed Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,61 @@ +chrM 576 848 - +chrM 848 1121 - +chrM 1121 1394 - +chrM 1394 1667 - +chrM 1667 1940 - +chrM 1940 2212 - +chrM 2212 2485 - +chrM 2485 2758 - +chrM 2758 3031 - +chrM 3031 3304 - +chrM 3306 3579 - +chrM 3579 3853 - +chrM 3853 4126 - +chrM 4126 4400 - +chrM 4401 4695 - +chrM 4695 4990 - +chrM 4990 5284 - +chrM 5284 5579 - +chrM 5586 5655 - +chrM 5656 5729 - +chrM 5760 5891 - +chrM 5903 6171 - +chrM 6171 6440 - +chrM 6440 6708 - +chrM 6708 6977 - +chrM 6977 7245 - +chrM 7245 7514 - +chrM 7517 7767 - +chrM 7767 8018 - +chrM 8018 8269 - +chrM 8294 8364 - +chrM 8365 8630 - +chrM 8630 8896 - +chrM 8896 9162 - +chrM 9162 9427 - +chrM 9427 9693 - +chrM 9693 9959 - +chrM 9959 10224 - +chrM 10224 10490 - +chrM 10490 10756 - +chrM 10756 11022 - +chrM 11022 11287 - +chrM 11287 11553 - +chrM 11553 11819 - +chrM 11819 12084 - +chrM 12084 12350 - +chrM 12350 12616 - +chrM 12616 12882 - +chrM 12882 13147 - +chrM 13147 13413 - +chrM 13413 13679 - +chrM 13679 13944 - +chrM 13944 14210 - +chrM 14210 14476 - +chrM 14476 14742 - +chrM 14746 14987 - +chrM 14987 15228 - +chrM 15228 15470 - +chrM 15470 15711 - +chrM 15711 15953 - +chrM 15955 16023 - |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/sample-diagram.pdf --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample-diagram.pdf Fri Sep 29 15:45:16 2023 +0000 |
| [ |
| @@ -0,0 +1,86 @@ +%PDF-1.4 +%���� ReportLab Generated PDF document http://www.reportlab.com +1 0 obj +<< +/F1 2 0 R /F2 3 0 R /F3 4 0 R /F4 5 0 R +>> +endobj +2 0 obj +<< +/BaseFont /Helvetica /Encoding /WinAnsiEncoding /Name /F1 /Subtype /Type1 /Type /Font +>> +endobj +3 0 obj +<< +/BaseFont /Times-Roman /Encoding /WinAnsiEncoding /Name /F2 /Subtype /Type1 /Type /Font +>> +endobj +4 0 obj +<< +/BaseFont /Helvetica-Bold /Encoding /WinAnsiEncoding /Name /F3 /Subtype /Type1 /Type /Font +>> +endobj +5 0 obj +<< +/BaseFont /Times-BoldItalic /Encoding /WinAnsiEncoding /Name /F4 /Subtype /Type1 /Type /Font +>> +endobj +6 0 obj +<< +/Contents 10 0 R /MediaBox [ 0 0 792 612 ] /Parent 9 0 R /Resources << +/Font 1 0 R /ProcSet [ /PDF /Text /ImageB /ImageC /ImageI ] +>> /Rotate 0 /Trans << + +>> + /Type /Page +>> +endobj +7 0 obj +<< +/PageMode /UseNone /Pages 9 0 R /Type /Catalog +>> +endobj +8 0 obj +<< +/Author (anonymous) /CreationDate (D:20230926163110+00'00') /Creator (ReportLab PDF Library - www.reportlab.com) /Keywords () /ModDate (D:20230926163110+00'00') /Producer (ReportLab PDF Library - www.reportlab.com) + /Subject (unspecified) /Title (untitled) /Trapped /False +>> +endobj +9 0 obj +<< +/Count 1 /Kids [ 6 0 R ] /Type /Pages +>> +endobj +10 0 obj +<< +/Filter [ /ASCII85Decode /FlateDecode ] /Length 5015 +>> +stream +Gau0G9<TX#&`2DPd7]9`j!pD=p,3OO6=Bn_*F]TiJIlB>,Q[H0q9#nD^?K]V'8/i3mjWImr2=8[BA*Fd;>^Cj&)6gB]C"4bV2]_HpXbC8QgNVlgMbr^I/cO2-XT4;j,]g`rbq`0*WGruj\L@1m4Y7'LVLO0d<MG57cQ5S2>&=:^@)TPNJ]m?[&Y;,K'rH[_.$)b/S.Q]:Oh#Gn\ph:rpfAWgHY`2iO^1\\\7lPHhWB1qM3)j-S,#&WG\6t?8LI<Y[uMPq#,(0/];uOc!([ijHsURbk@bgml.(+YtAjt'4*h.BYW,;n$fK-5.6l\Kfn,OO0<0EAf#4(H/lb'8'sN<:fB':mSYcn:+HL<CVW%f9i>@]<b8JB9U]#K1=s+D`&_Q\C#!0R]9F-;/QQH0nt&G8F%hh-8@7!9A^Ed%!h/P%XA(?WnlfU_*;5a$%pC1HN@]F6\I9C/.i3/tfI<XP?AuN5XcnucXI/`I@>nR[+ebH9?U<Ig;=$Z7KM<A;j#F85;<f3j`eujqUg$N4O!RDrBe"?9k9eE*V%Vb.,E>o9m\FB_Ta;7oGUQF^$6$pnSSp>V)F22IOlr4=er4fmVMp]U1a.4K?jT-=]8XYEFqbqI,#P3?&p?f5l86]nZ6(T,+3W<k:di*n.L%%71_LcgQpXqq)il^m`"ktL7;)!ECc%G$3+j;UJ0\2i+#4l1;So5,@ZXt^E/'pZ:^h[ZdOK\20W>b=C]Y?;:^7BU;A3`L6b9eV0R%IL*'P$7VdXqV1l9R38`Mf@-<1]G>tUXlBu-DSb8t[@n)>lDDZZWj<83YZ`67!PYqm6(_Q%i^E879_)"!_IUd@t0<p*4Uer6FO46A^i;gGX=8l.S56A@p,2&<.tfm#-4"=unp;<c9CU]SIC1`UD3K,1-?+D$@55KJAMdXpHI(Mca9<jF<YSJ7.*ZC376:0:U:O!uDacXf4?Ei15M.%Vs*jJ%h@U5b!D4$=LC0fB@p1!/H0SqH+_'e(#Y8CD4g*l:O%]a)*OQm@EiG1OO$AekVl;P=IqV:.9aBJaBuLn0c.Yi0B;BQ;BA6Ys+:^"1VG=?qI8%G7-F.`(Vkl3==4d%H'uW<#_drp:Q0i!"k+8KgBi\W\f@+#^dRH;'m,1#&2]$u%hiK#o_=)_4tV1s?5hK+6RDMINJl^?-&9qNGU[1^Lc_d%Fho[@'9A;RJqYG;B0LBnb;\R%,b4OgLM2,ZmspS2q+:J-/PC1!m>W"L;RF@L"jKKt,"e)QhRN*c\WV@/md@9[+8Z!XXUL\tK,+LgmiQVAdKrfSaLi%RQW]N"m*>qpK/0D<WksR@T$lCn3D-.]n\2;El7E%2A\aE%:6g].:iB$',gd;^ZaBZ5ok_,jd9g[Qfci":FicT-fgsAqHO"T3sP$o(YX#Qjbt$dq6D:^_WI6$tfbT<DHa+(KTL0:.G;rQpf4i"hR.Dp;\1&r-O/Yp*U@mM@%=eJ4,Uq-8^K#_0s-Ja[tE";r`0:9W28T`Uj3?Q_Re]EZWIIfu?*rLh;l&VE)!f?3@fF:W`iF"NOhD9#ropXl@]-[Ni]N]Lp'\896acp#-@IdHrIfCaUQ-:5/m@4u_Za$k?h1A<b<R(E<?->bL2?ojlu3J1Cdj3(%B9hNm*d,tKcDN1=#S%3Yoq\MM!n&Z=ip1e?79&oZ"EG(rdN+!`gMS&jP,5f8^cp+?KT<.Z_$E&DC8BehJj\0TED"V=8g\j1mB(3(Bjc+qAEEeL)oRuG>F0U"p9_,b_=<mV3IioGVUb6U\Y4)1Mo9Yif4ckN(*]]05K71,pm!Aor$>`M(d(9TVu+)lbM7>d.!N"k2iI/&jurgL_b_Appq*-R?430^)r:q#Z,-DQ^")D8Z(%:"a<(^=/um%)!NUHspHMs<Po,Z)SfIn&a$oFW@##&U[/NaNJVS<ZNc8'ks,S@f5(5s_,B(V^jp(>)-fa\8$f-sSHBZkOYl/nd-]=hoL)efYR5b6?fnJQMD>\rhS-Fi<jm`$P;2h^Ad+fV\mB@gc4@qHulpO.q[l_e?TFkgL-=Bs?tadMAU7D1bK"N!=Q8T*?/BB,,j+e7^g]QW4n0V\X^OeS)nK-Y_a+nCs9_>Sd)_q-3;q3uH)sX"h%EA#ofRN:AsBm:/CH+Ubq+)jCc!SLsE]7pV/mRP!RF!F!!A;p+eaQkJa)V!Ef>[SK-P/0VP>ahe]heY>!f&%ZY_`1]A'R<*qYhB8[L\[:)!b3Q2L/.%X<0h]_0,-r;,JSD*Cjb']T/Br9"fiSBlYaVVH\Dr^cZ.E9"ZRg&\cW6G9r%5Q1R;1'V/b641#/^jUNu>ea.6Q3s&Utp6BH/+9h-c)ds4J<Q.CCJG(1D7J/0Aui@$r^TLFc0'&HU1\7/#f'+eNNj;S*!7Mm7#O6(`!u`HBcAQER^!S66%>1E9Sm_QV1lZ+TM9_=G.f_0$%=nS/YfjO.ngK<D[dAd$MQ-%*R$leqZuV;OcS*#rhE]'HL</Br#R/31L%q2J+)iF0&n>?Z@#2YO`J#0Y6:<XB?Xh_"#`2hk:X]SN1+j4V;`2'a@l3/df^aQ2[s&q2kn>65u4=D]?P]R?\"FPYnH:A5?"lfi@]i+aaXLf'88bdPXBFk7(gd4^YL4Xgii]csdf/V5Fp0T>%EXrAAV,f.=V.*#4oEQ%L![&(4Tdo\ft]#!rJs'DhT_FA))Xf\n_VD?b/2].9?:Y&X+R`NAqPU7KSBah1+hI`\TU!FP=Aj9?S(O4>MK4>DJfEMg5Rt,l;_fMsrJQ*N0nY#1P9;s:12).-p4u,Jd)p<ni&%h,:_9Tcs3-L!N.qIdM+n0;(Ef\Qb53TSons*fhJE>=r_"^7_i@"cPVCDOF`sm2;oSae'FbhWT_2@/t[>j-ff+"#ho!;%b(,jC65S[0-))").AdA@%Suf.s[]bN'AW)7rU[<qYfl_pYU&:-d[a1K;S^>+KbdOjjm(1#2.R-!bZBTYn8;#C`)-7h;fYo&\fKlU#eF*^C4jU"1]BZoBNjCn]R;0j0`RcCoF#)I`TpK%D=H\st.n$OUT,Ui>dEpB#nNkb9Q9h-79ho0>mqRbtk")@%]ADZu2*Fl,=@rCe^"SuC).)i!f+"$7Sk0E@9?)8%eijM_DK$Y=h-cZ2duC23hl2W:<Ffq4Fk7(gAiQBd'Xa[AfhbRMD.@kIFbAf)UP(5*YJq+_jFOnr@HO`(DK)sNl%p"Vn+P9e.]VWR8)(d;>^"q2Bcm&@l:=lY68WVjg7]`m>rPk`:![q"$4n%m[ST9]_bFOB]5Fh]jf.kpPdPF-E)4E`g:k_QY.%P'`-tKfQ?$mB#SBp;D&8hfXrAolh<+fla24_o+=6C/[b=XNLomh,DD3p)jr'J0cE)'`0Z8j^380s,?$>%3Biq"JCD;#J(.4&s$*+f>RMWO&]"p/umh)a)q6Q5l.hqfdg<S[?N-K`Kp)g&oTH.@:StWDqJ+@Kla(KLWL+A)cmOH4>g7,3mJ"X1&n+OkM]lX/qra,c5Y.i$PDuGEqd3PWYJ//fti_'MW/P^\r0NaUc^dGgKOjrYnj=;"9#Q^H-?eJhl0JnoqJ?ZEOY51`sa1@I7jBP--A#hp2?[4pB*%ph[T4(bNNb2A26*au93kJ9#>OB&H;O'7>-LA)hq4\I*$!Q$6Q8g.Zp8g3\)AEFneu6/X'fKe[3R?tj.qhe>p<iT4H;UYdkZf(%P5<J9)B'>G9Nq(r2Ti.JWP0]L-7h$:0ATL61=RSW$6L-(,1bg*JReq'V;a"[A2QiFA\)2N7)p?MiNlT.$0SBFX-^Lt$$5"<F8Cb@M3un`1b3t5/?gGr<$0*)A&`r_Af[/2@I&O?H7Kj"%K#,LZG[W#=K]Ae$Y_O9=+$R*f\S4%f7So`p$u'@->M`Ko(?Q<X+O2OY<t\$>-?l.eJ)Q?3Voa6_DRiLS)1/o<u_5TVtqlgD),.tYGPC=cKT_c=5>A2DUk#I3+!)M6TP#^5"$m=i%+cF'V[&Q_?8k6<^<t2%CF32p]N7kW<n9)(kR>'ZuGPS"d?Q'X*@_KljG!&L^X'Pao$0=i?Qj43Yh?J$6):+ZA2Z:_84$LG<7@NfoK`b(4$(;M);YMn,`)6KYVhI5XDUUX5[t;14oJR12n]`=<c:9_e+K9!2W8uMT;\%'WanJO**F?eXr\iRhtDpL<lTYc(SWTpCS!lnS1SA#hes63WM;`D$.b.9W%p@BqUu0\?pgrR+RsC#Vf'V*n2o.dD",J8o5%GA<lVFq[$$A:fNg-Br1J//W+8o/7frm3W]UEJj9`D;F`4Q;WG9uYYIS"BZq7,3TO+;CH.6s+f(k"cD#G,'ked[e)h3Cjt%+;\(r"+e:G#&]`ZdG8"&9gcY\9Pr2_64bg1`icMT.>36gp3^p*W/Rnu&Y[hBD;cX9*&r)laMSNkSS`:HJ`!IJ->-EtfhdKBPrM46ar-^YQCkiI$(%_\6*FJ@BA$"EO1ZbVTVE\0t\e%l3Y>ad\SQ<p12&C[WWKPPo"0O^O/MG3fCZSigJl:fXCOZL+^n>=LF/R5<^K+#EYm,`i03kMu]Yg35CeEgV?(Uj#kjV*42%/p=n3kqm!^!;*Yi32`.$R"g6d/jqB^U<RNLO370AEO+4I+`eg"`ninFhscBpKb";kG9!-g3N8n_ff@9_6mQjY[H9>MHK@d(Muj1\-knER,#Y5$ZtfGS-;Z3Z-WQW]9m;`h-Fj)5k-H2>MscCX"B;/&^i6Z^5Mn)AD]h3$ek%na`Rd&7@`D4J;[(PD1X!WSTbQKLqBf:\4CjM@;lhM]'4/:f&JfEMn\AF#oB>^Rh[Q;+4i/N[(e5-\=?r4k&@lK](Fs%N-./!jWa"'M9B&QAJ:Eb*1'Q`*9aoFEo]jYNm!P_*EQ[0bj2boF(AtI,]KK_g8-#b[Bs.2E(^*bdKTU71/]lsB4tclgiaY$rRX:3r[51:m,+;3AqXNCs"fpqX4S7>3do$#G,m^\(^HYPY"\3;YC!\W*<SI9&,(g.Gm2@m$T7t7Y@)ePjki;:>'-D'?J_8,%,'L1U]8@@)ig/Dq0r>!O$B5uC]Ci0rr@?n,n'~>endstream +endobj +xref +0 11 +0000000000 65535 f +0000000073 00000 n +0000000134 00000 n +0000000241 00000 n +0000000350 00000 n +0000000462 00000 n +0000000576 00000 n +0000000770 00000 n +0000000838 00000 n +0000001134 00000 n +0000001193 00000 n +trailer +<< +/ID +[<15c688b429b296967ca578fba4f1e94c><15c688b429b296967ca578fba4f1e94c>] +% ReportLab generated PDF document -- digest (http://www.reportlab.com) + +/Info 8 0 R +/Root 7 0 R +/Size 11 +>> +startxref +6300 +%%EOF |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/sample-heatmap.png |
| b |
| Binary file test-data/sample-heatmap.png has changed |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/sample-scatter.pdf |
| b |
| Binary file test-data/sample-scatter.pdf has changed |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/sample-scatter.png |
| b |
| Binary file test-data/sample-scatter.png has changed |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/sample.cnr --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample.cnr Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,55 @@ +chromosome start end gene depth log2 weight +chrM 848 1121 - 5.9011 -0.545691 0.408064 +chrM 1394 1667 - 3.78022 0.488494 0.663959 +chrM 1667 1940 - 1.80586 0.0200539 0.951602 +chrM 2212 2485 - 1.65201 -0.234816 0.863481 +chrM 2485 2758 - 4.0696 0.153636 0.124621 +chrM 2758 3031 - 0.717949 -1.35597 0.802412 +chrM 3031 3304 - 1.33333 0.385198 0.698993 +chrM 3306 3579 - 0.626374 -1.37983 0.9523 +chrM 3579 3853 - 2.30292 0.471839 0.953456 +chrM 3853 4126 - 2.74359 0.444955 0.954775 +chrM 4126 4400 - 0.748175 0.465611 0.488348 +chrM 4401 4695 - 0.94898 -0.583114 0.722949 +chrM 4695 4990 - 5.01695 1.13235 0.235104 +chrM 4990 5284 - 1.73129 0.209867 0.585461 +chrM 5284 5579 - 5.97966 1.18493 0.334994 +chrM 5586 5655 - 0 -21.0389 0.909906 +chrM 5656 5729 - 0 -19.8096 0.489546 +chrM 5760 5891 - 1.79389 0 0.933441 +chrM 5903 6171 - 2.15299 -0.0283011 0.954219 +chrM 6171 6440 - 2.02974 -0.212606 0.881048 +chrM 6440 6708 - 1.51493 -0.38297 0.954355 +chrM 6708 6977 - 2.03717 -0.317296 0.919868 +chrM 6977 7245 - 3.05597 -0.127011 0.931699 +chrM 7245 7514 - 1.24907 0.72831 0.445461 +chrM 7517 7767 - 1.944 0.680162 0.754313 +chrM 7767 8018 - 2.24701 -0.510836 0.476217 +chrM 8018 8269 - 1.00797 -0.663743 0.679122 +chrM 8365 8630 - 1.0717 0.28099 0.736364 +chrM 8630 8896 - 2.07895 -0.154606 0.918337 +chrM 8896 9162 - 3.66165 0.147562 0.952129 +chrM 9162 9427 - 3.60755 0.937798 0.763689 +chrM 9693 9959 - 2.07143 0.459741 0.807601 +chrM 9959 10224 - 0.00377358 -8.75948 0.810371 +chrM 10224 10490 - 1.44361 0.509209 0.934515 +chrM 10490 10756 - 1.82331 0.0655732 0.839154 +chrM 10756 11022 - 1.12406 0.238204 0.822297 +chrM 11022 11287 - 4.27925 1.20043 0.953885 +chrM 11287 11553 - 2.93609 0.224804 0.945234 +chrM 11553 11819 - 1.06015 -1.50066 0.954184 +chrM 11819 12084 - 2.40377 0.0920864 0.791533 +chrM 12084 12350 - 0.736842 -1.15941 0.633433 +chrM 12350 12616 - 0.736842 -1.25242 0.954184 +chrM 12616 12882 - 2.48872 -0.187246 0.898846 +chrM 12882 13147 - 4.50943 0.419127 0.915456 +chrM 13147 13413 - 1.47368 -0.730007 0.952782 +chrM 13413 13679 - 2.95865 -0.0213761 0.95418 +chrM 13944 14210 - 0.890977 -0.337011 0.755369 +chrM 14210 14476 - 2.21053 -0.0427224 0.83652 +chrM 14746 14987 - 8.14523 0.722701 0.582259 +chrM 14987 15228 - 2.48133 -0.105067 0.78567 +chrM 15228 15470 - 1.11157 -0.96567 0.951837 +chrM 15470 15711 - 3.9751 0.576278 0.951583 +chrM 15711 15953 - 0.809917 -1.38778 0.949491 +chrM 15955 16023 - 0 -21.1972 0.909384 |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/sample.cns --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample.cns Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,2 @@ +chromosome start end gene log2 depth probes weight +chrM 848 16023 - -1.39012 2.05471 54 42.33 |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/sample.targetcoverage.cnn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample.targetcoverage.cnn Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,38 @@ +chromosome start end gene depth log2 +chrM 576 647 - 96.2958 6.5894 +chrM 647 1601 - 22.022 4.46087 +chrM 1601 1670 - 3.10145 1.63294 +chrM 1670 3229 - 1.6068 0.68419 +chrM 3229 3304 - 1.57333 0.653824 +chrM 3306 4262 - 1.8295 0.871448 +chrM 4262 4331 - 0 -20 +chrM 4328 4400 - 0.0972222 -3.36257 +chrM 4401 4469 - 1.82353 0.866733 +chrM 4469 5511 - 3.54127 1.82427 +chrM 5511 5579 - 3.20588 1.68072 +chrM 5586 5655 - 0 -20 +chrM 5656 5729 - 0 -20 +chrM 5760 5826 - 1.06061 0.0848889 +chrM 5825 5891 - 2.5303 1.33931 +chrM 5903 7445 - 2.01297 1.00933 +chrM 7445 7514 - 1.85507 0.891476 +chrM 7517 7585 - 0.544118 -0.878009 +chrM 7585 8269 - 1.85088 0.888209 +chrM 8294 8364 - 0 -20 +chrM 8365 8572 - 0.623188 -0.68226 +chrM 8526 9207 - 2.88693 1.52954 +chrM 9206 9990 - 1.97194 0.979615 +chrM 9990 10058 - 0 -20 +chrM 10058 10404 - 1.11272 0.154086 +chrM 10404 10469 - 0 -20 +chrM 10469 10766 - 1.69024 0.757224 +chrM 10759 12137 - 2.3164 1.21188 +chrM 12137 12206 - 1.76812 0.822213 +chrM 12206 12265 - 0.152542 -2.71272 +chrM 12265 12336 - 0 -20 +chrM 12336 14148 - 2.15563 1.10811 +chrM 14148 14673 - 2.24762 1.1684 +chrM 14673 14742 - 8.5942 3.10336 +chrM 14746 15887 - 3.49167 1.80392 +chrM 15887 15953 - 0 -20 +chrM 15955 16023 - 0 -20 |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/test.targetcoverage.cnn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test.targetcoverage.cnn Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,62 @@ +chromosome start end gene depth log2 +chrM 576 848 - 91.9926 6.52345 +chrM 848 1121 - 5.9011 2.56098 +chrM 1121 1394 - 1.4359 0.521953 +chrM 1394 1667 - 3.78022 1.91847 +chrM 1667 1940 - 1.80586 0.852687 +chrM 1940 2212 - 0.0404412 -4.62803 +chrM 2212 2485 - 1.65201 0.724226 +chrM 2485 2758 - 4.0696 2.02489 +chrM 2758 3031 - 0.717949 -0.478047 +chrM 3031 3304 - 1.33333 0.415037 +chrM 3306 3579 - 0.626374 -0.674905 +chrM 3579 3853 - 2.30292 1.20346 +chrM 3853 4126 - 2.74359 1.45606 +chrM 4126 4400 - 0.748175 -0.418552 +chrM 4401 4695 - 0.94898 -0.075551 +chrM 4695 4990 - 5.01695 2.32681 +chrM 4990 5284 - 1.73129 0.79185 +chrM 5284 5579 - 5.97966 2.58006 +chrM 5586 5655 - 0 -20 +chrM 5656 5729 - 0 -20 +chrM 5760 5891 - 1.79389 0.843094 +chrM 5903 6171 - 2.15299 1.10634 +chrM 6171 6440 - 2.02974 1.02129 +chrM 6440 6708 - 1.51493 0.599247 +chrM 6708 6977 - 2.03717 1.02657 +chrM 6977 7245 - 3.05597 1.61163 +chrM 7245 7514 - 1.24907 0.320855 +chrM 7517 7767 - 1.944 0.959028 +chrM 7767 8018 - 2.24701 1.16801 +chrM 8018 8269 - 1.00797 0.01145 +chrM 8294 8364 - 0 -20 +chrM 8365 8630 - 1.0717 0.0998986 +chrM 8630 8896 - 2.07895 1.05585 +chrM 8896 9162 - 3.66165 1.8725 +chrM 9162 9427 - 3.60755 1.85102 +chrM 9427 9693 - 0.808271 -0.30709 +chrM 9693 9959 - 2.07143 1.05063 +chrM 9959 10224 - 0.00377358 -8.04985 +chrM 10224 10490 - 1.44361 0.52968 +chrM 10490 10756 - 1.82331 0.866559 +chrM 10756 11022 - 1.12406 0.168719 +chrM 11022 11287 - 4.27925 2.09736 +chrM 11287 11553 - 2.93609 1.5539 +chrM 11553 11819 - 1.06015 0.0842689 +chrM 11819 12084 - 2.40377 1.2653 +chrM 12084 12350 - 0.736842 -0.440573 +chrM 12350 12616 - 0.736842 -0.440573 +chrM 12616 12882 - 2.48872 1.3154 +chrM 12882 13147 - 4.50943 2.17295 +chrM 13147 13413 - 1.47368 0.559427 +chrM 13413 13679 - 2.95865 1.56494 +chrM 13679 13944 - 1.64906 0.721641 +chrM 13944 14210 - 0.890977 -0.166539 +chrM 14210 14476 - 2.21053 1.14439 +chrM 14476 14742 - 4.45489 2.15539 +chrM 14746 14987 - 8.14523 3.02596 +chrM 14987 15228 - 2.48133 1.31111 +chrM 15228 15470 - 1.11157 0.152599 +chrM 15470 15711 - 3.9751 1.99099 +chrM 15711 15953 - 0.809917 -0.304153 +chrM 15955 16023 - 0 -20 |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/tumor-diagram.pdf --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tumor-diagram.pdf Fri Sep 29 15:45:16 2023 +0000 |
| [ |
| @@ -0,0 +1,86 @@ +%PDF-1.4 +%���� ReportLab Generated PDF document http://www.reportlab.com +1 0 obj +<< +/F1 2 0 R /F2 3 0 R /F3 4 0 R /F4 5 0 R +>> +endobj +2 0 obj +<< +/BaseFont /Helvetica /Encoding /WinAnsiEncoding /Name /F1 /Subtype /Type1 /Type /Font +>> +endobj +3 0 obj +<< +/BaseFont /Times-Roman /Encoding /WinAnsiEncoding /Name /F2 /Subtype /Type1 /Type /Font +>> +endobj +4 0 obj +<< +/BaseFont /Helvetica-Bold /Encoding /WinAnsiEncoding /Name /F3 /Subtype /Type1 /Type /Font +>> +endobj +5 0 obj +<< +/BaseFont /Times-BoldItalic /Encoding /WinAnsiEncoding /Name /F4 /Subtype /Type1 /Type /Font +>> +endobj +6 0 obj +<< +/Contents 10 0 R /MediaBox [ 0 0 792 612 ] /Parent 9 0 R /Resources << +/Font 1 0 R /ProcSet [ /PDF /Text /ImageB /ImageC /ImageI ] +>> /Rotate 0 /Trans << + +>> + /Type /Page +>> +endobj +7 0 obj +<< +/PageMode /UseNone /Pages 9 0 R /Type /Catalog +>> +endobj +8 0 obj +<< +/Author (anonymous) /CreationDate (D:20230926163933+00'00') /Creator (ReportLab PDF Library - www.reportlab.com) /Keywords () /ModDate (D:20230926163933+00'00') /Producer (ReportLab PDF Library - www.reportlab.com) + /Subject (unspecified) /Title (untitled) /Trapped /False +>> +endobj +9 0 obj +<< +/Count 1 /Kids [ 6 0 R ] /Type /Pages +>> +endobj +10 0 obj +<< +/Filter [ /ASCII85Decode /FlateDecode ] /Length 5025 +>> +stream +Gau0G9<T[$&`(d:kTrWkZ-27\2A/DE@0+R^Z&"-r&7m2!!oiZiNaH(?e),@2!A_gj^#a-u?*9O+NrA,0caTP8hJ_/HDms*Reo+m'[t!/Fm^g+1I/D1C2rDC?V^LB3p<+OB"9%-Pj*1:uRl>ir$YY#1I364MdmfPG]/H+:Z*(&jip_AG0PnJm61K<-"'j2)h`4dEENc3T1#hHlgFrQu`VY.4qrROtJ%bmMj"ImNhe[3qiN%HAr-u):%pMYqjLj*'pYTmlGCTPhD?!hRlrd9DZJ.6lkdMtW(YQIUP2E#[XmOGj=-"0O?Yd/qgXg@-[$e"L4Ho>k(UIh^F1()A8Wd;1VER@KUE_AX=tt_+.g;HD_`Y5s,U[i<l<\7oZrA2[WHB!dFjOSk@1+^S>!a(5:m6Eqp[!#d-f4#<Ge_jlFjQYB!a==J=IWX4jAXS\Ltb:=12,'fD\1`7aCW^$>but'&"QUui5Hgc8Tg1?`sR*9hMq%5+&]lNcrUeP>S?*/1dX`CE,5bi'X[9or-0s.&CVD(fL#u!Bdjf[L4*!__(p:s/J$KG%CqZHKomQ#9&lW/SZe\pHqM-#1aWGGIL@pg%(0][M`hgA`1X*mEs53U3o1Tf(;s(S=c;@IO!$_Tai.#mbb4j,$KP<DCgBmAMjc>UpOhTC>7Tf"Q/'@m$lgBVF^0#`SH_Ai)2`j.Ymb;d`UokQDD/t'RZ@L_r!2r"P7e:VO$R!XM[kr._<IgN@<H^scr=`_9m:9;F;j9ODMl[T0>>mX*\:"fX@qSu:)pZ6"5idVe"A;f<C>GFG2llpL#u+''G>2NZDW$=>ug=/TG:$)mjbcXF:IhgQ40nBk[;rOPEM`#V+#9CT,p^5.B*TJe#m4`Up";@S!&coJld_=,YV27E\T!J2$4;Wlft-'fJlD>lIIoB@B3;BE;3.*NLa**(Y3b%`a_$V'Jr<2/<7a`-Gek#Sh%A#+s`'/MPFL"P!ZQ2Oi#rGj"Z+X0GA2m\FCOq&$KZg=@CY6F*n6DFaO^G?SP+\?b+c<SOSYB4fPZ>OL3J7c@IfSNshKmUZ:i$A$dq'cljR7_QHi%1b9cdWB,iI^?X[%iH6/Ai;B7Y!3H8r@K(*_;S`_B58.=U3_Li3fKXb.e+F86/VVD-dHTY8/3<&Mll.HMWREOG9Fa7&LFW_&LA<SM_"C2l[F:f@)F/q3Q.T[Ml\LgaJF-nFkd2ON3)#>?Cnt%/2\DW<V&VQ+L4B_n0JUpQV^Z_E[).eAmm::lG"J`WNoq^0-BQ"7PpO!C9H_2,qsGjt/".StdS^G43QRpMfKi)MT5fGfKNoEi+dPm@Q>nPpYg]Bk;Pi)\-2.:GB^h^VLS3)([YIcY'(K'qHKp/_I--0P6/iB@7JRd4:al,5I%"$1c8[s]5/M*`o@QK$\-rMeP;(p*i!W:8_k&#<Q'5kn_C@msBa`i8U[!-*i-0REI*@m#^1Xrc]CUiPQuG#68>*[UV)]4ri<rCP:C7o,):t']_Xo;edjd%<:6KqOo>#T=_&IG$F@sbk%]_nFJ@+Xa\DW8VfZVABK`cB2LTLom%$S"ENG+t:i#'p51_;s^nIY2\Qq04t&if^BJr=V.d$^(rU4Y*=rbu,8AXClf_(gKk"[a+saCrmG(k2iiLn'TIX.UWT5Ti#R(Gmd"=>(*r"QS#no0g^Aale;0@*=BHT`HudGnh8b5`<U$nOKNLbY9><kRitCK,-]u:$;Wf5$?E(\3pQD_C6%J"u27Z&MPH9#KN)MJJGNn=e#OIBGi7ug-AB$_\?oP#;%+)GT6EDMo!#(JcM6S$SFpn_1a9'X%bQ=PG6%Y,pYK=*1OZ1l<aoY8"'MuN._"PUdG_P%V)OtD'I6rW+"+)d(n1i9uB6>d(NAh7N1nYS#d)FA-1<9jH$[>73>)FBWrgIG9iBF@BZ'K*D%VmfQi[LJq?1g-@[<J*nY)8Ofg3#.82Kj=q"43P;JKcRBRdD2+SeJ1'oohLe9Qu-ctnX,F=HjQY[=a;NUI+4Vj,+9N04+JVU7s73BPYdW-eQ*_/aoNoE$Y/Yji7@#d1A5p+#dK1Nmd"aaKh2!h_4<KVr?$hj)?BO69RUn,h_hnJoM3<_T-r2k/c%`.,m`>I@#1"HAGN:HI`gW,s/&h"_tZPIq$Mt?2.Y"&obbG930'lFRTfmX*+!kCV/5(:%jqT3+O$,L.sOMGjW[>j9jf+"#eDXn*,QiVRM,?TLTcaL*km^g5tIcT03@tGPX2ANE:Q'Yd[ZRgn:cWF6#/=-F=LC)56Z+TM9_(pYt6^C\:UaktW#(O<@,Vnb"X$HO"I2ED5[uN=NFkg@@-2k#Kn;;hLMVue"iJ#tYD7JlA_%8fr`3>aL.cWk=G\B78D%&(EDD6IWStJm6nWP,-/FOn\#-4)6oO;\85!U?\/Zbi<f;#M#=_=JKQ6j2VAXS[k+b`3c:]u>n[Uf3,lNTudie+'e=JK/5%QM0F(a8I*e[@nQp=s&Cjlm]Dr!k`:]eO'gO-f@B$n3ul>=0V+dJVl4)3)PN!T'F`2tMR8'-'okeTU&fm(1*^)[D!@3M!Xf,,o;]Z!-AK@!UFJK4V9Fo^IO"A&:]L$f&Ftr16H.QQ8#pa[p[sF!AL3/*8!s[29mO1\k>NggGAIY:ipX,-kSZJCu-;jp+ZPHdHnfTaUkA$DA?#kdP2/1B*d*H.DRKb>cGF=estLJfR1<*5^+37:(2oi5gPnZUJI;+>Y"SdVAXtYBk(?bjNDGgrT_rKS':n2Hu\bU3+`\T^)g*FCM0r92lt0&HufO@,S0qog.1=L0Db6Q8k<%F#dcs6AtcTm8CXa]"sQeK+,r_X]YPAIpgWQ\M;kIlXl/k26hsMOrBHT0QS4Ne&:RT)_A]!B.S%1K>%N/K;39'07.RjF?pt+N&eXl4D&(Tf_2c@dWO1-/9-QgO4X056<h[:4Bhst;]%qqAJCPL%lBVY2cqF$Co;%Ar&D^u5bWfPD--2LXrAq"atr,b3:(-[AY@;KD;'!cFb=6RqLiF?b&<q7cGMNjeb7e_ZKh]fam%JbL;3eTCCL#PRp7UnDD:^^4B\G#KuMQlk1K7oY9*Al@-H#pc,&Y[[k)='.>BmKor@>#N`tHV/,ra!Va[4lL@Wf2h,[aAq[NLRcujtP%Sm6EOX8GIB$8*<:lXeD)_>-0H,d,q,?-+Jqg#T?j^m$QQI!!SB8nJsrf=M!:gE2YT^)ePp!<OC7Fk`(C9+k0VI+K%@*'n;A!S[:^n=.q,k>/().%LA?j@'f[R+e1AdH;GBjC$b8RHVRc4Xd=B?<N$N\q:@%\HGL4m-D.%@3o%.'cqbBOc=Fm;+R_IfGh@r3GVmbETjWQ9L#>4D;/_lR1qso:YCRbD=W#AQclQYW,N8gr.:XCU@BM=$8JZ'"%:UNAseCE'E$>E[[L=K<?.EKDc5MEfE<,?aJa'^F.B[Iqi_GHu6?bq%D,D(Q%iq8D22Tp?h<G$h2lc1#W+nKs1frg"LWTe?&W)^>#i8c<p6o190]@Yg<an":D!(VntnQ4'ZR+oadA$UR]LQ/2\%@A]lMWZ)Hf%fgVW*rgpDIc\O>RNo$(A6sGX3flE.,\pK_X9j("R/#<tb5!hd:7!B?56kV#_fi4\6KUt2nHBk^b?Y7!274n%kF@tCj^4^Y$,dosmZT+jGMe9)Q-I+t8.@GK$"L[j=J??ui)YbcZ.,F\sn^+h^k=b0)2haM(4FqXk((>V/-.l`9Mk8'hUUTndT34gVUfOAbKQMkcD)p(OMP#:$AP^W=WLpT<?62PU*`hsBQVfp>)4k)M\^bJ0T6>'SeuKE@2/0/K@P?q.:.8J[*]*5YS&JbW#S;)mMoK/32ZSab/pk^P)qE\GKSHokCG3+um=k"pBT(U$[hA&,pl3`T+WB2Qah;=AJ'rWt*GPdYGM1R&^!f.-?q^)4MN[l/<XHMVIXCS7QMPCGZ'$[aTFq6lk.;Wp:bcpi8f\1idQ[QhCk2jg.2SM..himi1\:icaH^'sZNWS#N5j$I,EZJ7MI`t+6j+\s.i*1l^!!g``Fcp#po$oL4+8DC(96-rjH6t&Z%rR9E.epg=Nh%0Y3,Ota-JR^d6,^+TYN9*(:T1pJQ*f:@6?F:/6G1iGmlTM09BNj")QH60ad#`\[eAeU1p'fe:MNon^C#MO*+,+Ms/lQjpSd'a&c1UmtCJOn)jrig'eZd4[5UhJP,3h+W(]23Y&Mo6P]iWlNV$5!g!IlDA!2oW<8CeM\GSXRfP@NI.)+5_$PJr$#X&g5%*BF6JPMj1146*7Kj]*D08+E3nt(6)V`f-Fi(FL'4JIci*4I-&M,gBo*U`-U3/F4BW<Atc+q=9/48h*Se4R(ip>/VOD/m&M.![F-IU/aC*M[(lmHi!Y&Y`QX>C+mcO+OKorMsWY0ZOP`;eN(RQ*UFVZT\-[sk%]XbKMkU=H&r@^I%4d>g[N-RdF.n%_\%24kFQCCLr6Brttj2@nhO^eSBl$idagFeV:+4\mo61&Hef[GG>$;lpk((fo[63mQ9cU]lK1IVXLHNIP0j>2oi(#1rXnL"/&0F^]TUs..No_b2Y5nDVM;N7^,fKf1i/@A/iYr)i/o'5&*'fu0Y>L,O$eJYnLt[]n:/$8)aqM3\OMD5-=4FIVL+Yhpd"09!DtjpOh"UAi$"S*XNkdnLU_0^L.@Qr&!jPUo58a^#[&hW-X(@;g1[Ku>o1dmEDjghJ#09b+UL!17#.>nf7r\ojX\A:Ek$J]SJTr</<UY'UR(iuGNK9O><56la>7]Js=tgi^BKAA[XRL<5h7Fc@WN*d9Y=p,t'XQkXsT%l&q=\3j`2rH6T-S-dc+'Q\G"2cn3@A)2)YB9@<M`gg2_N>ZfG3H!CfB;"8hc>clg(Nk`_eT%5E3-cP=IZ>)qq%,M/AaSUoZs)57.g./FU[!G[Fe^G7k7KHYLYJt2^&.ZdmsfGEC7M#j+#O/['&k!-*hd$VXQ]9oIfj\W)ri'hnD;2<rQ\UDE=DL';VNGmjZP@G(5_R^h]r$bMnaadZ04C)]t?O933p6V?iQ0#-5]dDq0r>!%mQTHbCA99rr?Ej9^r~>endstream +endobj +xref +0 11 +0000000000 65535 f +0000000073 00000 n +0000000134 00000 n +0000000241 00000 n +0000000350 00000 n +0000000462 00000 n +0000000576 00000 n +0000000770 00000 n +0000000838 00000 n +0000001134 00000 n +0000001193 00000 n +trailer +<< +/ID +[<5ccdb050c51ab6d81ad0299b61b60455><5ccdb050c51ab6d81ad0299b61b60455>] +% ReportLab generated PDF document -- digest (http://www.reportlab.com) + +/Info 8 0 R +/Root 7 0 R +/Size 11 +>> +startxref +6310 +%%EOF |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/tumor-heatmap.png |
| b |
| Binary file test-data/tumor-heatmap.png has changed |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/tumor-scatter.pdf |
| b |
| Binary file test-data/tumor-scatter.pdf has changed |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/tumor-scatter.png |
| b |
| Binary file test-data/tumor-scatter.png has changed |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/tumor.antitargetcoverage.cnn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tumor.antitargetcoverage.cnn Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,1 @@ +chromosome start end gene log2 |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/tumor.bam |
| b |
| Binary file test-data/tumor.bam has changed |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/tumor.bam.bai |
| b |
| Binary file test-data/tumor.bam.bai has changed |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/tumor.bintest.cns --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tumor.bintest.cns Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,34 @@ +chromosome start end gene depth log2 weight probes p_bintest +chrM 1394 1667 - 3.78022 1.83095 0.659673 1 0.00305626 +chrM 1667 1940 - 1.80586 1.51502 0.947315 1 2.21288e-10 +chrM 2212 2485 - 1.65201 1.13169 0.859195 1 0.0043234 +chrM 3579 3853 - 2.30292 1.39081 0.949177 1 3.36615e-09 +chrM 3853 4126 - 2.74359 1.7165 0.950488 1 8.22011e-14 +chrM 5284 5579 - 5.97966 3.04522 0.33087 1 0.000409792 +chrM 5586 5655 - 0 -19.5746 0.90138 1 0 +chrM 5656 5729 - 0 -18.4148 0.481257 1 6.28915e-143 +chrM 5760 5891 - 1.79389 1.41828 0.927253 1 4.90435e-07 +chrM 5903 6171 - 2.15299 1.33821 0.949892 1 9.37152e-09 +chrM 6708 6977 - 2.03717 1.04921 0.91555 1 0.000589447 +chrM 6977 7245 - 3.05597 1.2395 0.927373 1 1.2045e-05 +chrM 7517 7767 - 1.944 1.55628 0.749834 1 0.00324207 +chrM 8365 8630 - 1.0717 1.55444 0.732013 1 0.00437839 +chrM 8630 8896 - 2.07895 1.36838 0.913995 1 9.21442e-06 +chrM 8896 9162 - 3.66165 1.94013 0.947786 1 1.58627e-16 +chrM 9162 9427 - 3.60755 2.19544 0.759338 1 2.06073e-05 +chrM 9693 9959 - 2.07143 1.61872 0.803258 1 0.000525673 +chrM 9959 10224 - 0.00377358 -7.0323 0.80602 1 2.93745e-56 +chrM 10224 10490 - 1.44361 1.44622 0.930173 1 1.59322e-07 +chrM 10490 10756 - 1.82331 1.58765 0.834811 1 0.000230056 +chrM 10756 11022 - 1.12406 2.10303 0.817954 1 2.62602e-06 +chrM 11022 11287 - 4.27925 2.56694 0.949534 1 3.32731e-29 +chrM 11287 11553 - 2.93609 1.75192 0.940891 1 3.45973e-12 +chrM 12616 12882 - 2.48872 1.20906 0.894503 1 0.000409792 +chrM 12882 13147 - 4.50943 1.65031 0.911105 1 1.1997e-07 +chrM 13147 13413 - 1.47368 0.874788 0.94844 1 0.000274482 +chrM 13413 13679 - 2.95865 1.34513 0.949837 1 8.56465e-09 +chrM 14210 14476 - 2.21053 1.53132 0.832178 1 0.000409792 +chrM 14746 14987 - 8.14523 2.66335 0.577696 1 0.00010697 +chrM 15470 15711 - 3.9751 2.55959 0.947021 1 8.98929e-28 +chrM 15711 15953 - 0.809917 0.743495 0.944938 1 0.00285344 +chrM 15955 16023 - 0 -19.8307 0.900795 1 0 |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/tumor.call.cns --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tumor.call.cns Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,2 @@ +chromosome start end gene log2 cn depth p_ttest probes weight +chrM 848 16023 - 0 2 2.06481 0.0731783 51 39.1851 |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/tumor.cnr --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tumor.cnr Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,52 @@ +chromosome start end gene depth log2 weight +chrM 848 1121 - 5.9011 1.10765 0.461544 +chrM 1121 1394 - 1.4359 0.5119 0.42727 +chrM 1394 1667 - 3.78022 1.00545 0.83803 +chrM 1667 1940 - 1.80586 -0.141849 0.898961 +chrM 2212 2485 - 1.65201 -0.341112 0.939111 +chrM 2485 2758 - 4.0696 0.227416 0.0932326 +chrM 2758 3031 - 0.717949 -0.74495 0.631914 +chrM 3031 3304 - 1.33333 -0.242655 0.920093 +chrM 3306 3579 - 0.626374 -1.60223 0.635989 +chrM 3579 3853 - 2.30292 0.419897 0.823341 +chrM 3853 4126 - 2.74359 0.492218 0.954299 +chrM 4401 4695 - 0.94898 -0.75838 0.810217 +chrM 4695 4990 - 5.01695 0.833877 0.745894 +chrM 4990 5284 - 1.73129 -0.166905 0.52302 +chrM 5284 5579 - 5.97966 1.47869 0.301566 +chrM 5586 5655 - 0 -20.2111 0.909096 +chrM 5656 5729 - 0 -19.9628 0.789733 +chrM 5760 5891 - 1.79389 -0.439065 0.721317 +chrM 5903 6171 - 2.15299 0.879609 0.881613 +chrM 6171 6440 - 2.02974 -0.56855 0.540091 +chrM 6440 6708 - 1.51493 -0.533208 0.953875 +chrM 6708 6977 - 2.03717 0.010185 0.924831 +chrM 6977 7245 - 3.05597 0.140146 0.861631 +chrM 7517 7767 - 1.944 -0.010185 0.932072 +chrM 8018 8269 - 1.00797 -0.730833 0.739629 +chrM 8365 8630 - 1.0717 -0.175653 0.333588 +chrM 8630 8896 - 2.07895 -0.906325 0.953701 +chrM 8896 9162 - 3.66165 0.578937 0.922022 +chrM 9162 9427 - 3.60755 0.713289 0.953614 +chrM 9427 9693 - 0.808271 -0.874973 0.24358 +chrM 9693 9959 - 2.07143 0.093785 0.870609 +chrM 10490 10756 - 1.82331 0.051865 0.901124 +chrM 10756 11022 - 1.12406 -0.367165 0.23713 +chrM 11022 11287 - 4.27925 0.646415 0.94264 +chrM 11287 11553 - 2.93609 0.0993253 0.941632 +chrM 11553 11819 - 1.06015 -0.671504 0.923937 +chrM 11819 12084 - 2.40377 -0.123249 0.829158 +chrM 12084 12350 - 0.736842 -1.27337 0.953701 +chrM 12350 12616 - 0.736842 -1.07369 0.953701 +chrM 12616 12882 - 2.48872 -0.24473 0.918407 +chrM 12882 13147 - 4.50943 0.330991 0.612262 +chrM 13147 13413 - 1.47368 0.0980097 0.895383 +chrM 13413 13679 - 2.95865 0.764085 0.898039 +chrM 13679 13944 - 1.64906 0.200821 0.200719 +chrM 13944 14210 - 0.890977 -1.20825 0.935464 +chrM 14210 14476 - 2.21053 0.220457 0.911385 +chrM 14987 15228 - 2.48133 0.0611491 0.887423 +chrM 15228 15470 - 1.11157 -0.517988 0.95146 +chrM 15470 15711 - 3.9751 0.858538 0.951359 +chrM 15711 15953 - 0.809917 -0.698856 0.917254 +chrM 15955 16023 - 0 -20.8746 0.88741 |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/tumor.cns --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tumor.cns Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,2 @@ +chromosome start end gene log2 depth probes weight ci_lo ci_hi +chrM 848 16023 - -1.4129 2.06481 51 39.1851 -1.84016 -0.943 |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/tumor.targetcoverage.cnn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tumor.targetcoverage.cnn Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,62 @@ +chromosome start end gene depth log2 +chrM 576 848 - 91.9926 6.52345 +chrM 848 1121 - 5.9011 2.56098 +chrM 1121 1394 - 1.4359 0.521953 +chrM 1394 1667 - 3.78022 1.91847 +chrM 1667 1940 - 1.80586 0.852687 +chrM 1940 2212 - 0.0404412 -4.62803 +chrM 2212 2485 - 1.65201 0.724226 +chrM 2485 2758 - 4.0696 2.02489 +chrM 2758 3031 - 0.717949 -0.478047 +chrM 3031 3304 - 1.33333 0.415037 +chrM 3306 3579 - 0.626374 -0.674905 +chrM 3579 3853 - 2.30292 1.20346 +chrM 3853 4126 - 2.74359 1.45606 +chrM 4126 4400 - 0.748175 -0.418552 +chrM 4401 4695 - 0.94898 -0.075551 +chrM 4695 4990 - 5.01695 2.32681 +chrM 4990 5284 - 1.73129 0.79185 +chrM 5284 5579 - 5.97966 2.58006 +chrM 5586 5655 - 0 -20 +chrM 5656 5729 - 0 -20 +chrM 5760 5891 - 1.79389 0.843094 +chrM 5903 6171 - 2.15299 1.10634 +chrM 6171 6440 - 2.02974 1.02129 +chrM 6440 6708 - 1.51493 0.599247 +chrM 6708 6977 - 2.03717 1.02657 +chrM 6977 7245 - 3.05597 1.61163 +chrM 7245 7514 - 1.24907 0.320855 +chrM 7517 7767 - 1.944 0.959028 +chrM 7767 8018 - 2.24701 1.16801 +chrM 8018 8269 - 1.00797 0.01145 +chrM 8294 8364 - 0 -20 +chrM 8365 8630 - 1.0717 0.0998986 +chrM 8630 8896 - 2.07895 1.05585 +chrM 8896 9162 - 3.66165 1.8725 +chrM 9162 9427 - 3.60755 1.85102 +chrM 9427 9693 - 0.808271 -0.30709 +chrM 9693 9959 - 2.07143 1.05063 +chrM 9959 10224 - 0.00377358 -8.04985 +chrM 10224 10490 - 1.44361 0.52968 +chrM 10490 10756 - 1.82331 0.866559 +chrM 10756 11022 - 1.12406 0.168719 +chrM 11022 11287 - 4.27925 2.09736 +chrM 11287 11553 - 2.93609 1.5539 +chrM 11553 11819 - 1.06015 0.0842689 +chrM 11819 12084 - 2.40377 1.2653 +chrM 12084 12350 - 0.736842 -0.440573 +chrM 12350 12616 - 0.736842 -0.440573 +chrM 12616 12882 - 2.48872 1.3154 +chrM 12882 13147 - 4.50943 2.17295 +chrM 13147 13413 - 1.47368 0.559427 +chrM 13413 13679 - 2.95865 1.56494 +chrM 13679 13944 - 1.64906 0.721641 +chrM 13944 14210 - 0.890977 -0.166539 +chrM 14210 14476 - 2.21053 1.14439 +chrM 14476 14742 - 4.45489 2.15539 +chrM 14746 14987 - 8.14523 3.02596 +chrM 14987 15228 - 2.48133 1.31111 +chrM 15228 15470 - 1.11157 0.152599 +chrM 15470 15711 - 3.9751 1.99099 +chrM 15711 15953 - 0.809917 -0.304153 +chrM 15955 16023 - 0 -20 |
| b |
| diff -r 000000000000 -r ef9a50eb20ce test-data/tumor_1.bam |
| b |
| Binary file test-data/tumor_1.bam has changed |
| b |
| diff -r 000000000000 -r ef9a50eb20ce tool-data/fasta_indexes.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/fasta_indexes.loc.sample Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,29 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Samtools indexed sequences data files. You will need +#to create these data files and then create a fasta_indexes.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The fasta_indexes.loc +#file has this format (white space characters are TAB characters): +# +# <unique_build_id> <dbkey> <display_name> <file_base_path> +# +#So, for example, if you had hg19 Canonical indexed stored in +# +# /depot/data2/galaxy/hg19/sam/, +# +#then the fasta_indexes.loc entry would look like this: +# +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /depot/data2/galaxy/hg19/sam/hg19canon.fa +# +#and your /depot/data2/galaxy/hg19/sam/ directory +#would contain hg19canon.fa and hg19canon.fa.fai files. +# +#Your fasta_indexes.loc file should include an entry per line for +#each index set you have stored. The file in the path does actually +#exist, but it should never be directly used. Instead, the name serves +#as a prefix for the index file. For example: +# +#hg18canon hg18 Human (Homo sapiens): hg18 Canonical /depot/data2/galaxy/hg18/sam/hg18canon.fa +#hg18full hg18 Human (Homo sapiens): hg18 Full /depot/data2/galaxy/hg18/sam/hg18full.fa +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /depot/data2/galaxy/hg19/sam/hg19canon.fa +#hg19full hg19 Human (Homo sapiens): hg19 Full /depot/data2/galaxy/hg19/sam/hg19full.fa |
| b |
| diff -r 000000000000 -r ef9a50eb20ce tool_data_table_conf.xml.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,8 @@ +<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> +<tables> + <!-- Location of SAMTools indexes for FASTA files --> + <table name="fasta_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/fasta_indexes.loc" /> + </table> +</tables> \ No newline at end of file |
| b |
| diff -r 000000000000 -r ef9a50eb20ce tool_data_table_conf.xml.test --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.test Fri Sep 29 15:45:16 2023 +0000 |
| b |
| @@ -0,0 +1,7 @@ +<tables> + <!-- Location of SAMTools indexed FASTA files --> + <table name="fasta_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="${__HERE__}/test-data/fasta_indexes.loc" /> + </table> +</tables> \ No newline at end of file |
