| Previous changeset 7:5830a37dfa76 (2017-04-07) Next changeset 9:45db1ba16163 (2017-05-21) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/stacks commit dc23703c260d004a28fe24a2a7c00cb4371bc32e |
|
modified:
macros.xml stacks_populations.xml |
|
added:
test-data/demultiplexed/PopA_01.1.fq.gzip test-data/denovo_map/popmap_cstacks.tsv test-data/procrad/R1.fq.gzip test-data/ustacks/ustacks.out |
| b |
| diff -r 5830a37dfa76 -r f5115df39480 macros.xml --- a/macros.xml Fri Apr 07 11:48:24 2017 -0400 +++ b/macros.xml Thu Apr 27 04:18:58 2017 -0400 |
| [ |
| @@ -2,14 +2,14 @@ <macros> <xml name="requirements"> <requirements> - <requirement type="package" version="1.42">stacks</requirement> + <requirement type="package" version="1.46">stacks</requirement> <requirement type="package" version="1.2.10">velvet</requirement> - <container type="docker">quay.io/biocontainers/stacks:1.42--2</container> + <requirement type="package" version="1.1">stacks_summary</requirement> <yield/> </requirements> </xml> - <token name="@WRAPPER_VERSION@">1.42</token> + <token name="@WRAPPER_VERSION@">1.46</token> <xml name="stdio"> <stdio> @@ -90,6 +90,7 @@ <option value="bsaHI">bsaHI</option> <option value="hpaII">hpaII</option> <option value="ncoI">ncoI</option> + <option value="ApaLI">ApaLI</option> </xml> <xml name="cross_types"> @@ -100,6 +101,19 @@ <option value="GEN">GEN (generic, unspecific to any map type)</option> </xml> + <token name="@CLEAN_EXT@"> + <![CDATA[ + #from os.path import splitext + #import re + #def clean_ext($identifier) + #while $identifier.endswith(('.1', '.fa', '.fq', '.fasta', '.fastq', '.gz', '.gzip', '.sam', '.bam')) + #set $identifier = splitext($identifier)[0] + #end while +$identifier#slurp + #end def + ]]> + </token> + <token name="@NORM_GENOTYPES_OUTPUT_LIGHT@"> <![CDATA[ ## We need to do this as the output file names contains the value of an option (min progeny) |
| b |
| diff -r 5830a37dfa76 -r f5115df39480 stacks_populations.xml --- a/stacks_populations.xml Fri Apr 07 11:48:24 2017 -0400 +++ b/stacks_populations.xml Thu Apr 27 04:18:58 2017 -0400 |
| [ |
| b'@@ -12,36 +12,39 @@\n \n &&\n \n- #if str($options_usage.input_type) == \'stacks\':\n- #for $input_file in $options_usage.input_col:\n+ #if str($options_usage.input_type) == \'stacks\'\n+ #for $input_file in $options_usage.input_col\n #set $filename = str($input_file.element_identifier)\n- #if not $filename.endswith(\'.tsv\'):\n+ #if not $filename.endswith(\'.tsv\')\n #set $filename = $filename + ".tsv"\n #end if\n- #if re.search(\'\\.(tags|snps|alleles|matches)(\\.tsv)?$\', $filename):\n- ln -s "${input_file}" "stacks_outputs/${filename}" &&\n+ #if re.search(\'\\.(tags|snps|alleles|matches)(\\.tsv)?$\', $filename)\n+ ln -s \'${input_file}\' \'stacks_outputs/${filename}\' &&\n #end if\n #end for\n+ #else if str($options_usage.input_type) == \'vcf\'\n+ ln -s \'$options_usage.input_vcf\' \'stacks_outputs/batch_1.vcf\' &&\n #end if\n \n populations\n \n -t \\${GALAXY_SLOTS:-1}\n \n- #if str($options_usage.input_type) == \'vcf\':\n- -V "$options_usage.input_vcf"\n- #else:\n+ #if str($options_usage.input_type) == \'vcf\'\n+ -V \'stacks_outputs/batch_1.vcf\'\n+ -O stacks_outputs\n+ #else\n -P stacks_outputs\n -b $advanced_options.batchid\n #end if\n \n- -M "$options_usage.popmap"\n+ -M \'$options_usage.popmap\'\n \n ## Data filtering\n $options_filtering.write_single_snp\n $options_filtering.write_random_snp\n \n- #if str($options_filtering.lnl):\n+ #if str($options_filtering.lnl)\n --lnl_lim $options_filtering.lnl\n #end if\n \n@@ -49,12 +52,12 @@\n -p $options_filtering.minpop\n -m $options_filtering.mindepth\n \n- #if str($options_filtering.max_obs_het):\n+ #if str($options_filtering.max_obs_het)\n --max_obs_het $options_filtering.max_obs_het\n #end if\n \n --min_maf $options_filtering.minminor\n- #if str( $options_filtering.correction_select.correction ) != "no_corr":\n+ #if str( $options_filtering.correction_select.correction ) != "no_corr"\n -f $options_filtering.correction_select.correction\n --p_value_cutoff $options_filtering.correction_select.pcutoff\n #end if\n@@ -62,26 +65,26 @@\n ## Fstats\n $fstats\n \n- #if $options_kernel.kernel:\n+ #if $options_kernel.kernel\n -k\n --window_size $options_kernel.window\n #end if\n \n ## Bootstrap resampling options\n- #if $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_all:\n+ #if $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_all\n --bootstrap\n- #else:\n+ #else\n $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_pifis\n $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_fst\n $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_div\n $bootstrap_resampling.bootstrap_resampling_mode.bootstrap_phist\n #end if\n \n- #if str($bootstrap_resampling.bootstrap_reps):\n+ #if str($bootstrap_resampling.bootstrap_reps)\n --bootstrap_reps $bootstrap_resampling.bootstrap_reps\n #end if\n- #if $bootstrap_resampling.bootstrap_wl:\n- --bootstrap_wl "$bootstrap_resampling.bootstrap_wl"\n+ #if $bootstrap_resampling.bootstrap_wl\n+ --bootstrap_wl \'$bootstrap_resampling.bootstrap_wl\'\n #end if\n \n ## output section\n@@ -103,7 +106,7 @@\n $populations_output.phylip_var_all\n $populations_output.treemix\n \n- #if $populations_output.options_genomic.genomic:\n+ #if $populations_output.options_genomic.genomic\n --genomic\n -e $populations_output.options_genomic.enzyme\n #e'..b'options_usage.popmap\'\n ]]></command>\n \n <inputs>\n <conditional name="options_usage">\n <param name="input_type" type="select" label="Input type" help="select input file type" >\n <option value="stacks">Stacks output</option>\n- <!--option value="vcf">VCF file</option--> <!-- broken in 1.42 -->\n+ <option value="vcf">VCF file</option>\n </param>\n <when value="stacks">\n <param name="input_col" format="tabular,txt" type="data_collection" collection_type="list" label="Output from previous Stacks pipeline steps (e.g. denovo_map or refmap)" argument="-P" />\n@@ -152,7 +159,7 @@\n <option value="bonferroni_win">bonferroni_win</option>\n <option value="bonferroni_gen">bonferroni_gen</option>\n </param>\n- <when value="no_corr"></when>\n+ <when value="no_corr"/>\n <when value="p_value">\n <param name="pcutoff" type="float" value="0.05" label="P-value cutoff" help="required p-value to keep an Fst measurement (0.05 by default). Also used as base for Bonferroni correction" />\n </when>\n@@ -238,6 +245,8 @@\n </inputs>\n <outputs>\n <expand macro="populations_output_full"/>\n+\n+ <data format="html" name="output_summary" label="Summary from ${tool.name} on ${on_string}" from_work_dir="stacks_outputs/summary.html" />\n </outputs>\n \n <tests>\n@@ -279,9 +288,15 @@\n <param name="populations_output|phylip_var_all" value="true" />\n <param name="populations_output|treemix" value="true" />\n \n- <param name="populations_output|options_genomic|genomic" value="true" />\n+ <param name="populations_output|options_genomic|genomic" value="false" />\n <param name="populations_output|options_genomic|enzyme" value="ecoRI" />\n \n+ <output name="output_summary">\n+ <assert_contents>\n+ <has_text text="Stacks Statistics" />\n+ </assert_contents>\n+ </output>\n+\n <!-- populations -->\n <output name="out_haplotypes">\n <assert_contents>\n@@ -324,7 +339,7 @@\n </assert_contents>\n </output>\n </test>\n- <!--test>\n+ <test>\n <param name="options_usage|input_type" value="vcf" />\n <param name="options_usage|input_vcf" value="populations/batch_1.vcf" />\n <param name="options_usage|popmap" ftype="tabular" value="denovo_map/popmap.tsv" />\n@@ -348,11 +363,16 @@\n <param name="populations_output|phylip_var_all" value="true" />\n <param name="populations_output|treemix" value="true" />\n \n- <param name="populations_output|options_genomic|genomic" value="true" />\n- <param name="populations_output|options_genomic|enzyme" value="ecoRI" /-->\n+ <param name="populations_output|options_genomic|genomic" value="false" />\n+\n+ <output name="output_summary">\n+ <assert_contents>\n+ <has_text text="Stacks Statistics" />\n+ </assert_contents>\n+ </output>\n \n <!-- populations -->\n- <!--output name="out_haplotypes">\n+ <output name="out_haplotypes">\n <assert_contents>\n <has_text text="PopA_01" />\n </assert_contents>\n@@ -389,10 +409,10 @@\n </output>\n <output name="out_fasta">\n <assert_contents>\n- <has_text text="AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC" />\n+ <has_text text="CLocus_0_Sample_1_Locus_0_Allele_1" />\n </assert_contents>\n </output>\n- </test--> <!-- broken in 1.42 -->\n+ </test>\n </tests>\n <help>\n <![CDATA[\n' |
| b |
| diff -r 5830a37dfa76 -r f5115df39480 test-data/demultiplexed/PopA_01.1.fq.gzip |
| b |
| Binary file test-data/demultiplexed/PopA_01.1.fq.gzip has changed |
| b |
| diff -r 5830a37dfa76 -r f5115df39480 test-data/denovo_map/popmap_cstacks.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/denovo_map/popmap_cstacks.tsv Thu Apr 27 04:18:58 2017 -0400 |
| b |
| @@ -0,0 +1,1 @@ +PopA_01 myPopA |
| b |
| diff -r 5830a37dfa76 -r f5115df39480 test-data/procrad/R1.fq.gzip |
| b |
| Binary file test-data/procrad/R1.fq.gzip has changed |
| b |
| diff -r 5830a37dfa76 -r f5115df39480 test-data/ustacks/ustacks.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/ustacks/ustacks.out Thu Apr 27 04:18:58 2017 -0400 |
| b |
| @@ -0,0 +1,41 @@ +ustacks parameters selected: + Sample ID: 1 + Min depth of coverage to create a stack: 2 + Max distance allowed between stacks: 2 + Max distance allowed to align secondary reads: 4 + Max number of stacks allowed per de novo locus: 3 + Deleveraging algorithm: disabled + Removal algorithm: enabled + Model type: SNP + Alpha significance level for model: 0.05 + Gapped alignments: disabled +Parsing stacks_inputs/PopA_01.fq +Loading RAD-Tags...done +Loaded 66 RAD-Tags. + Inserted 7 elements into the RAD-Tags hash map. + 0 reads contained uncalled nucleotides that were modified. +4 initial stacks were populated; 3 stacks were set aside as secondary reads. +Initial coverage mean: 15.75; Std Dev: 7.46241; Max: 27 +Deleveraging trigger: 23; Removal trigger: 31 +Calculating distance for removing repetitive stacks. + Distance allowed between stacks: 1; searching with a k-mer length of 47 (48 k-mers per read); 1 k-mer hits required. +Removing repetitive stacks. + Removed 0 stacks. + 4 stacks remain for merging. +Post-Repeat Removal, coverage depth Mean: 15.75; Std Dev: 7.46241; Max: 27 +Calculating distance between stacks... + Distance allowed between stacks: 2; searching with a k-mer length of 31 (64 k-mers per read); 2 k-mer hits required. +Merging stacks, maximum allowed distance: 2 nucleotide(s) + 4 stacks merged into 3 loci; deleveraged 0 loci; blacklisted 0 loci. +After merging, coverage depth Mean: 21; Std Dev: 4.24264; Max: 27 +Merging remainder radtags + 3 remainder sequences left to merge. + Distance allowed between stacks: 4; searching with a k-mer length of 17 (78 k-mers per read); 10 k-mer hits required. + Matched 3 remainder reads; unable to match 0 remainder reads. +After remainders merged, coverage depth Mean: 22; Std Dev: 4.32049; Max: 28 +Calling final consensus sequences, invoking SNP-calling model... +Number of utilized reads: 66 +Writing loci, SNPs, and alleles to 'stacks_outputs/'... + Refetching sequencing IDs from stacks_inputs/PopA_01.fq... read 66 sequence IDs. +done. +ustacks is done. |