| Previous changeset 11:5bbf9eada9c2 (2020-03-11) Next changeset 13:d220115f882b (2021-07-10) |
|
Commit message:
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/snippy commit 7dec701af24e00b3328459f0a823eefd461237bb" |
|
modified:
macros.xml snippy-core.xml snippy.xml snippy_clean_full_aln.xml |
|
added:
test-data/a_1.fastq.gz test-data/a_2.fastq.gz |
|
removed:
test-data/a_1.fastq test-data/a_2.fastq |
| b |
| diff -r 5bbf9eada9c2 -r fa016f1eea1a macros.xml --- a/macros.xml Wed Mar 11 03:50:47 2020 -0400 +++ b/macros.xml Wed Apr 07 11:24:48 2021 +0000 |
| [ |
| @@ -1,12 +1,15 @@ <macros> <xml name="requirements"> <requirements> - <requirement type="package" version="@VERSION@">snippy</requirement> + <requirement type="package" version="@WRAPPER_VERSION@">snippy</requirement> <requirement type="package" version="1.32">tar</requirement> <yield /> </requirements> </xml> + <token name="@WRAPPER_VERSION@">4.5.0</token> + <token name="@VERSION_SUFFIX@">1</token> + <xml name="version_command"> <version_command><![CDATA[snippy --version]]></version_command> </xml> @@ -52,13 +55,11 @@ </param> </when> <when value="history"> - <param name="ref_file" type="data" format="fasta,genbank" label="Use the following dataset as the reference sequence" help="You can upload a FASTA or FASTQ sequence to the history and use it as reference" /> + <param name="ref_file" type="data" format="fasta,fasta.gz,genbank" label="Use the following dataset as the reference sequence" help="You can upload a FASTA or FASTQ sequence to the history and use it as reference" /> </when> </conditional> </xml> - <token name="@VERSION@">4.5.0</token> - <xml name="citations"> <citations> <citation type="bibtex">@UNPUBLISHED{Seemann2013, |
| b |
| diff -r 5bbf9eada9c2 -r fa016f1eea1a snippy-core.xml --- a/snippy-core.xml Wed Mar 11 03:50:47 2020 -0400 +++ b/snippy-core.xml Wed Apr 07 11:24:48 2021 +0000 |
| b |
| @@ -1,5 +1,5 @@ <?xml version="1.0" encoding="utf-8"?> -<tool id="snippy_core" name="snippy-core" version="@VERSION@"> +<tool id="snippy_core" name="snippy-core" version="@WRAPPER_VERSION@+galaxy@VERSION_SUFFIX@"> <description> Combine multiple Snippy outputs into a core SNP alignment </description> |
| b |
| diff -r 5bbf9eada9c2 -r fa016f1eea1a snippy.xml --- a/snippy.xml Wed Mar 11 03:50:47 2020 -0400 +++ b/snippy.xml Wed Apr 07 11:24:48 2021 +0000 |
| b |
| @@ -1,4 +1,4 @@ -<tool id="snippy" name="snippy" version="@VERSION@"> +<tool id="snippy" name="snippy" version="@WRAPPER_VERSION@+galaxy@VERSION_SUFFIX@"> <description> Snippy finds SNPs between a haploid reference genome and your NGS sequence reads. </description> @@ -69,17 +69,17 @@ <option value="paired_iv">Paired Interleaved</option> </param> <when value="paired"> - <param name="fastq_input1" type="data" format="fastqsanger,fasta" label="Select first set of reads" help="Specify dataset with forward reads"/> - <param name="fastq_input2" type="data" format="fastqsanger,fasta" label="Select second set of reads" help="Specify dataset with reverse reads"/> + <param name="fastq_input1" type="data" format="fastqsanger,fastqsanger.gz,fasta,fasta.gz" label="Select first set of reads" help="Specify dataset with forward reads"/> + <param name="fastq_input2" type="data" format="fastqsanger,fastqsanger.gz,fasta,fasta.gz" label="Select second set of reads" help="Specify dataset with reverse reads"/> </when> <when value="single"> - <param name="fastq_input_single" type="data" format="fastqsanger,fasta" label="Select fastq dataset" help="Specify dataset with single reads"/> + <param name="fastq_input_single" type="data" format="fastqsanger,fastqsanger.gz,fasta,fasta.gz" label="Select fastq dataset" help="Specify dataset with single reads"/> </when> <when value="paired_collection"> - <param name="fastq_input" format="fastqsanger,fasta" type="data_collection" collection_type="paired" label="Select a paired collection" help="See help section for an explanation of dataset collections"/> + <param name="fastq_input" format="fastqsanger,fastqsanger.gz,fasta,fasta.gz" type="data_collection" collection_type="paired" label="Select a paired collection" help="See help section for an explanation of dataset collections"/> </when> <when value="paired_iv"> - <param name="fastq_input_interleaved" type="data" format="fastqsanger" label="Select fastq dataset" help="Specify dataset with interleaved reads"/> + <param name="fastq_input_interleaved" type="data" format="fastqsanger,fastqsanger.gz" label="Select fastq dataset" help="Specify dataset with interleaved reads"/> </when> </conditional> @@ -148,8 +148,8 @@ <param name="ref_file" value="reference.fasta" ftype="fasta"/> </conditional> <param name="fastq_input_selector" value="paired" /> - <param name="fastq_input1" ftype="fastqsanger" value="a_1.fastq" /> - <param name="fastq_input2" ftype="fastqsanger" value="a_2.fastq" /> + <param name="fastq_input1" ftype="fastqsanger.gz" value="a_1.fastq.gz" /> + <param name="fastq_input2" ftype="fastqsanger.gz" value="a_2.fastq.gz" /> <param name="mincov" value="2" /> <param name="minqual" value="60" /> <param name="outputs" value="outgff,outsum" /> |
| b |
| diff -r 5bbf9eada9c2 -r fa016f1eea1a snippy_clean_full_aln.xml --- a/snippy_clean_full_aln.xml Wed Mar 11 03:50:47 2020 -0400 +++ b/snippy_clean_full_aln.xml Wed Apr 07 11:24:48 2021 +0000 |
| b |
| @@ -1,5 +1,5 @@ <?xml version="1.0" encoding="utf-8"?> -<tool id="snippy_clean_full_aln" name="snippy-clean_full_aln" version="@VERSION@"> +<tool id="snippy_clean_full_aln" name="snippy-clean_full_aln" version="@WRAPPER_VERSION@+galaxy@VERSION_SUFFIX@"> <description> Replace any non-standard sequence characters in snippy 'core.full.aln' file. </description> |
| b |
| diff -r 5bbf9eada9c2 -r fa016f1eea1a test-data/a_1.fastq --- a/test-data/a_1.fastq Wed Mar 11 03:50:47 2020 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| b |
| @@ -1,20 +0,0 @@ -@1 -tccacaagccattgtgtgtaattaaccactaattgtgtataagtttaaact -+ -IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII -@2 -tccacaagccattgtgtgtaattaaccactaattgtgtataagtttaaact -+ -IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII -@3 -tccacaagccattgtgtgtaattaaccactaattgtgtataagtttaaact -+ -IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII -@4 -tccacaagccattgtgtgtaattaaccactaattgtgtataagtttaaact -+ -IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII -@5 -tccacaagccattgtgtgtaattaaccactaattgtgtataagtttaaact -+ -IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII |
| b |
| diff -r 5bbf9eada9c2 -r fa016f1eea1a test-data/a_1.fastq.gz |
| b |
| Binary file test-data/a_1.fastq.gz has changed |
| b |
| diff -r 5bbf9eada9c2 -r fa016f1eea1a test-data/a_2.fastq --- a/test-data/a_2.fastq Wed Mar 11 03:50:47 2020 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| b |
| @@ -1,20 +0,0 @@ -@1 -agtttaaacttatacacaattagtggttaattacacacaatggcttgtgga -+ -IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII -@2 -agtttaaacttatacacaattagtggttaattacacacaatggcttgtgga -+ -IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII -@3 -agtttaaacttatacacaattagtggttaattacacacaatggcttgtgga -+ -IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII -@4 -agtttaaacttatacacaattagtggttaattacacacaatggcttgtgga -+ -IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII -@5 -agtttaaacttatacacaattagtggttaattacacacaatggcttgtgga -+ -IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII |
| b |
| diff -r 5bbf9eada9c2 -r fa016f1eea1a test-data/a_2.fastq.gz |
| b |
| Binary file test-data/a_2.fastq.gz has changed |