| Previous changeset 16:8ccbdbe9a695 (2017-06-01) Next changeset 18:121110a12cc9 (2017-11-24) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/bowtie2 commit 0f9578a65e86cc159aadf1a9b37aaf3621f19456 |
|
modified:
bowtie2_macros.xml bowtie2_wrapper.xml |
| b |
| diff -r 8ccbdbe9a695 -r 66f992977578 bowtie2_macros.xml --- a/bowtie2_macros.xml Thu Jun 01 11:14:22 2017 -0400 +++ b/bowtie2_macros.xml Tue Nov 14 15:02:18 2017 -0500 |
| b |
| @@ -6,7 +6,7 @@ #if hasattr($input1, 'element_identifier') #return $input1.element_identifier #else - #return $input1.name.rstrip('.gz').rstrip('.fastq').rstrip('.fq').rstrip('bz2') + #return $input1.name.rstrip('.gz').rstrip('.fastq').rstrip('.fq').rstrip('.bz2') #end if #end def |
| b |
| diff -r 8ccbdbe9a695 -r 66f992977578 bowtie2_wrapper.xml --- a/bowtie2_wrapper.xml Thu Jun 01 11:14:22 2017 -0400 +++ b/bowtie2_wrapper.xml Tue Nov 14 15:02:18 2017 -0500 |
| [ |
| @@ -668,7 +668,7 @@ <tests> <test> - <!-- basic test on single paired default run --> + <!-- test on paired-end datasets --> <param name="type" value="paired"/> <param name="paired_options_selector" value="no"/> <param name="unaligned_file" value="false"/> @@ -680,7 +680,23 @@ <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> </test> <test> - <!-- basic test on single paired default run --> + <!-- test on paired collection --> + <param name="type" value="paired_collection"/> + <param name="paired_options_selector" value="no"/> + <param name="unaligned_file" value="false"/> + <param name="analysis_type_selector" value="simple"/> + <param name="source" value="history" /> + <param name="input_1"> + <collection type="paired"> + <element name="forward" value="bowtie2-fq1.fq" ftype="fastqsanger" /> + <element name="reverse" value="bowtie2-fq2.fq" ftype="fastqsanger" /> + </collection> + </param> + <param name="own_file" value="bowtie2-ref.fasta" /> + <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> + </test> + <test> + <!-- test on paired-end datasets with read group info --> <param name="type" value="paired"/> <param name="paired_options_selector" value="no"/> <param name="unaligned_file" value="false"/> @@ -695,7 +711,7 @@ <output name="output" file="bowtie2-test2.bam" ftype="bam" lines_diff="2"/> </test> <test> - <!-- basic test on single paired default run with stats--> + <!-- test on paired-end datasets with stats output --> <param name="type" value="paired"/> <param name="paired_options_selector" value="no"/> <param name="unaligned_file" value="false"/> @@ -713,7 +729,7 @@ </output> </test> <test> - <!-- basic test on interleaved paired default run --> + <!-- test on interleaved dataset --> <param name="type" value="paired_interleaved"/> <!-- <param name="paired_options_selector" value="no"/> --> <param name="unaligned_file" value="false"/> @@ -727,7 +743,7 @@ <output name="output" file="bowtie2-test_il.bam" ftype="bam" lines_diff="2"/> </test> <test> - <!-- test fastqsanger.gz input --> + <!-- test on fastqsanger.gz paired-end datasets --> <param name="type" value="paired"/> <param name="paired_options_selector" value="no"/> <param name="unaligned_file" value="false"/> @@ -739,7 +755,7 @@ <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> </test> <test> - <!-- test fastqsanger.bz2 input --> + <!-- test on fastqsanger.bz2 paired-end datasets --> <param name="type" value="paired"/> <param name="paired_options_selector" value="no"/> <param name="unaligned_file" value="false"/> @@ -751,7 +767,7 @@ <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> </test> <test> - <!-- test fasta input --> + <!-- test on fasta paired-end datasets --> <param name="type" value="paired"/> <param name="paired_options_selector" value="no"/> <param name="unaligned_file" value="false"/> @@ -765,7 +781,6 @@ </tests> <help><![CDATA[ - **Bowtie2 Overview** Bowtie2_ is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters to relatively long (e.g. mammalian) genomes. Bowtie 2 supports gapped, local, and paired-end alignment modes. Galaxy wrapper for Bowtie 2 outputs alignments in `BAM format`_, enabling interoperation with a large number of other tools available at this site. @@ -1234,13 +1249,9 @@ CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC + HHHHHHHHHHHHHGHHHHHHGHHHHHHHHHHHFHHHFHHHHHHHHHHH - - - - ]]></help> <citations> - <citation type="doi">10.1186/gb-2009-10-3-r25</citation> - <citation type="doi">10.1038/nmeth.1923</citation> - </citations> + <citation type="doi">10.1186/gb-2009-10-3-r25</citation> + <citation type="doi">10.1038/nmeth.1923</citation> + </citations> </tool> |