| Next changeset 1:4a81db403bd9 (2017-09-13) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/ucsc-tools/twobittofa commit 454df102c5630d90af25d1b9ff8050a6c7b82ffc |
|
added:
test-data/input.2bit test-data/output.fasta twobittofa.xml |
| b |
| diff -r 000000000000 -r d025a40bbff1 test-data/input.2bit |
| b |
| Binary file test-data/input.2bit has changed |
| b |
| diff -r 000000000000 -r d025a40bbff1 test-data/output.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/output.fasta Fri Aug 19 06:30:41 2016 -0400 |
| b |
| @@ -0,0 +1,6 @@ +>s1 +ATGCATGCATGCATGCATGCATGCATGCATGCATGC +>s2 +ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT +GCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC +ATGCATGC |
| b |
| diff -r 000000000000 -r d025a40bbff1 twobittofa.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/twobittofa.xml Fri Aug 19 06:30:41 2016 -0400 |
| [ |
| @@ -0,0 +1,85 @@ +<tool id="ucsc-twobittofa" name="twoBitToFa" version="@WRAPPER_VERSION@"> + <macros> + <token name="@WRAPPER_VERSION@">332</token> + </macros> + + <description>Convert all or part of .2bit file to fasta</description> + + <requirements> + <requirement type="package" version="@WRAPPER_VERSION@">ucsc-twobittofa</requirement> + </requirements> + + <version_command><![CDATA[ echo "@WRAPPER_VERSION@" ]]></version_command> + + <command> +<![CDATA[ + twoBitToFa + '$twobit_input' + '$fasta_output' + + #if $seq + -seq='$seq' + #end if + + #if $start + -start=$start + #end if + + #if $end + -end=$end + #end if + + #if $seqList + -seqList='$seqList' + #end if + + $noMask +]]> + </command> + + <inputs> + <param name="twobit_input" type="data" format="twobit" + label="Input TwoBit file" help=""/> + + <param argument="-seq" type="text" label="Restrict this to just one sequence + (Optional)" help="" optional="True"/> + + <param argument="-start" type="integer" label="Start at given position in + sequence (Optional)" help="Zero-based" optional="True"/> + + <param argument="-end" type="integer" label="End at given position in + sequence (Optional)" help="Non-inclusive" optional="True"/> + + <param argument="-seqList" type="data" format="txt" + label="File containing list of the desired sequence names (Optional)" + help="It must be in the format seqSpec[:start-end], e.g. chr1 or chr1:0-189 + where coordinates are half-open zero-based, i.e. [start,end)" + optional="True"/> + + <param argument="-noMask" type="boolean" truevalue="-noMask" falsevalue="" + checked="false" label="Convert sequence to all upper case?" help=""/> + </inputs> + + <outputs> + <data format="fasta" name="fasta_output"/> + </outputs> + + <tests> + <test> + <param name="twobit_input" value="input.2bit"/> + <output name="fasta_output" file="output.fasta" /> + </test> + </tests> + + <help><![CDATA[ +**What it does** + +twoBitToFa is a tool to convert all or part of .2bit file to fasta. + +For more information, check the `user manual <https://genome.ucsc.edu/goldenpath/help/twoBit.html/>`_. + + ]]></help> + + <citations> + </citations> +</tool> |