Galaxy |

Changeset 5:b89bb51eba83 (2012-01-16)

Previous changeset 4:4d47ab2b7bcc (2012-01-13) Next changeset 6:4a4aca3d57c9 (2012-01-16)

Commit message:
Uploaded

added:
weblogolib/cluster18.aln

removed:
weblogolib/.___init__.py
weblogolib/__init__.py
weblogolib/_cgi.py
weblogolib/color.py
weblogolib/colorscheme.py
weblogolib/htdocs/create.cgi
weblogolib/htdocs/create_html_template.html
weblogolib/htdocs/examples.html
weblogolib/htdocs/img/example.png
weblogolib/htdocs/img/feed-icon-16x16.png
weblogolib/htdocs/img/weblogo-fig1.png
weblogolib/htdocs/img/weblogo_create.png
weblogolib/htdocs/index.html
weblogolib/htdocs/logo.css
weblogolib/htdocs/manual.html
weblogolib/htdocs/test.html
weblogolib/template.eps

diff -r 4d47ab2b7bcc -r b89bb51eba83 weblogolib/.___init__.py

Binary file weblogolib/.___init__.py has changed

diff -r 4d47ab2b7bcc -r b89bb51eba83 weblogolib/__init__.py
--- a/weblogolib/__init__.py Fri Jan 13 07:18:19 2012 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

[

b'@@ -1,2084 +0,0 @@\n-#!/usr/bin/env python\n-\n-# -------------------------------- WebLogo --------------------------------\n-\n-# Copyright (c) 2003-2004 The Regents of the University of California.\n-# Copyright (c) 2005 Gavin E. Crooks\n-# Copyright (c) 2006, The Regents of the University of California, through print\n-# Lawrence Berkeley National Laboratory (subject to receipt of any required\n-# approvals from the U.S. Dept. of Energy). All rights reserved.\n-\n-# This software is distributed under the new BSD Open Source License.\n-# <http://www.opensource.org/licenses/bsd-license.html>\n-#\n-# Redistribution and use in source and binary forms, with or without \n-# modification, are permitted provided that the following conditions are met: \n-#\n-# (1) Redistributions of source code must retain the above copyright notice, \n-# this list of conditions and the following disclaimer. \n-#\n-# (2) Redistributions in binary form must reproduce the above copyright \n-# notice, this list of conditions and the following disclaimer in the \n-# documentation and or other materials provided with the distribution. \n-#\n-# (3) Neither the name of the University of California, Lawrence Berkeley \n-# National Laboratory, U.S. Dept. of Energy nor the names of its contributors \n-# may be used to endorse or promote products derived from this software \n-# without specific prior written permission. \n-#\n-# THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" \n-# AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE \n-# IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE \n-# ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE \n-# LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR \n-# CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF \n-# SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS \n-# INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN \n-# CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) \n-# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE \n-# POSSIBILITY OF SUCH DAMAGE. \n-\n-# Replicates README.txt\n-\n-"""\n-WebLogo (http://code.google.com/p/weblogo/) is a tool for creating sequence \n-logos from biological sequence alignments. It can be run on the command line,\n-as a standalone webserver, as a CGI webapp, or as a python library.\n-\n-The main WebLogo webserver is located at http://bespoke.lbl.gov/weblogo/\n-\n-\n-Codonlogo is based on Weblogo. \n-\n-Please consult the manual for installation instructions and more information:\n-(Also located in the weblogolib/htdocs subdirectory.)\n-\n-For help on the command line interface run\n- ./codonlogo --help\n-\n-To build a simple logo run\n- ./codonlogo < cap.fa > logo0.eps\n- \n-To run as a standalone webserver at localhost:8080 \n- ./codonlogo --server\n-\n-To create a logo in python code:\n- >>> from weblogolib import *\n- >>> fin = open(\'cap.fa\')\n- >>> seqs = read_seq_data(fin) \n- >>> data = LogoData.from_seqs(seqs)\n- >>> options = LogoOptions()\n- >>> options.title = "A Logo Title"\n- >>> format = LogoFormat(data, options)\n- >>> fout = open(\'cap.eps\', \'w\') \n- >>> eps_formatter( data, format, fout)\n-\n-\n--- Distribution and Modification --\n-This package is distributed under the new BSD Open Source License. \n-Please see the LICENSE.txt file for details on copyright and licensing.\n-The WebLogo source code can be downloaded from http://code.google.com/p/weblogo/\n-WebLogo requires Python 2.3, 2.4 or 2.5, the corebio python toolkit for computational \n-biology (http://code.google.com/p/corebio), and the python array package \n-\'numpy\' (http://www.scipy.org/Download)\n-\n-# -------------------------------- CodonLogo --------------------------------\n-\n-\n-"""\n-\n-from math import *\n-import random\n-from itertools import izip, count\n-import sys\n-import copy\n-import os\n-from '..b'def mean_x(self, x) :\n- x = asarray(x, float64)\n- if shape(x) != shape(self.alpha) :\n- raise ValueError("Argument must be same dimension as Dirichlet")\n- return sum( x * self.mean()) \n-\n- def variance_x(self, x) :\n- x = asarray(x, float64)\n- if shape(x) != shape(self.alpha) :\n- raise ValueError("Argument must be same dimension as Dirichlet") \n- \n- cv = self.covariance()\n- var = na.dot(na.dot(na.transpose( x), cv), x)\n- return var\n-\n-\n- def mean_entropy(self) :\n- """Calculate the average entropy of probabilities sampled\n- from this Dirichlet distribution. \n- \n- Returns:\n- The average entropy.\n- \n- Ref:\n- Wolpert & Wolf, PRE 53:6841-6854 (1996) Theorem 7\n- (Warning: this paper contains typos.)\n- Status:\n- Alpha\n- Authors:\n- GEC 2005\n- \n- """\n- # TODO: Optimize\n- alpha = self.alpha\n- A = float(sum(alpha))\n- ent = 0.0\n- for a in alpha:\n- if a>0 : ent += - 1.0 * a * digamma( 1.0+a) # FIXME: Check\n- ent /= A\n- ent += digamma(A+1.0)\n- return ent \n-\n-\n-\n- def variance_entropy(self):\n- """Calculate the variance of the Dirichlet entropy. \n-\n- Ref:\n- Wolpert & Wolf, PRE 53:6841-6854 (1996) Theorem 8\n- (Warning: this paper contains typos.)\n- """\n- alpha = self.alpha\n- A = float(sum(alpha))\n- A2 = A * (A+1)\n- L = len(alpha)\n- \n- dg1 = zeros( (L) , float64)\n- dg2 = zeros( (L) , float64)\n- tg2 = zeros( (L) , float64) \n- \n- for i in range(L) :\n- dg1[i] = digamma(alpha[i] + 1.0)\n- dg2[i] = digamma(alpha[i] + 2.0)\n- tg2[i] = trigamma(alpha[i] + 2.0)\n-\n- dg_Ap2 = digamma( A+2. )\n- tg_Ap2 = trigamma( A+2. )\n- \n- mean = self.mean_entropy()\n- var = 0.0\n- \n- for i in range(L) :\n- for j in range(L) :\n- if i != j :\n- var += (\n- ( dg1[i] - dg_Ap2 ) * (dg1[j] - dg_Ap2 ) - tg_Ap2 \n- ) * (alpha[i] * alpha[j] ) / A2\n- else : \n- var += (\n- ( dg2[i] - dg_Ap2 ) **2 + ( tg2[i] - tg_Ap2 )\n- ) * ( alpha[i] * (alpha[i]+1.) ) / A2\n-\n- var -= mean**2\n- return var\n- \n- \n- \n- def mean_relative_entropy(self, pvec) :\n- ln_p = na.log(pvec)\n- return - self.mean_x(ln_p) - self.mean_entropy() \n- \n- \n- def variance_relative_entropy(self, pvec) :\n- ln_p = na.log(pvec)\n- return self.variance_x(ln_p) + self.variance_entropy()\n- \n- \n- def interval_relative_entropy(self, pvec, frac) :\n- mean = self.mean_relative_entropy(pvec) \n- variance = self.variance_relative_entropy(pvec) \n- # If the variance is small, use the standard 95% \n- # confidence interval: mean +/- 1.96 * sd\n- if variance< 0.1 :\n- sd = sqrt(variance)\n- return max(0.0, mean - sd*1.96), mean + sd*1.96\n- sd = sqrt(variance)\n- return max(0.0, mean - sd*1.96), mean + sd*1.96\n- \n- g = gamma.from_mean_variance(mean, variance)\n- low_limit = g.inverse_cdf( (1.-frac)/2.)\n- high_limit = g.inverse_cdf( 1. - (1.-frac)/2. )\n- \n- return low_limit, high_limit\n-\n-\n-# Standard python voodoo for CLI\n-if __name__ == "__main__":\n- ## Code Profiling. Uncomment these lines\n- #import hotshot, hotshot.stats\n- #prof = hotshot.Profile("stones.prof")\n- #prof.runcall(main)\n- #prof.close()\n- #stats = hotshot.stats.load("stones.prof")\n- #stats.strip_dirs()\n- #stats.sort_stats(\'cumulative\', \'calls\')\n- #stats.print_stats(40)\n- #sys.exit()\n-\n- main()\n- \n-\n-\n-\n-\n-\n'

diff -r 4d47ab2b7bcc -r b89bb51eba83 weblogolib/_cgi.py
--- a/weblogolib/_cgi.py Fri Jan 13 07:18:19 2012 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

[

b'@@ -1,446 +0,0 @@\n-#!/usr/bin/env python\n-\n-# Copyright (c) 2003-2004 The Regents of the University of California.\n-# Copyright (c) 2005 Gavin E. Crooks\n-# Copyright (c) 2006, The Regents of the University of California, through \n-# Lawrence Berkeley National Laboratory (subject to receipt of any required\n-# approvals from the U.S. Dept. of Energy). All rights reserved.\n-\n-# This software is distributed under the new BSD Open Source License.\n-# <http://www.opensource.org/licenses/bsd-license.html>\n-#\n-# Redistribution and use in source and binary forms, with or without \n-# modification, are permitted provided that the following conditions are met: \n-#\n-# (1) Redistributions of source code must retain the above copyright notice, \n-# this list of conditions and the following disclaimer. \n-#\n-# (2) Redistributions in binary form must reproduce the above copyright \n-# notice, this list of conditions and the following disclaimer in the \n-# documentation and or other materials provided with the distribution. \n-#\n-# (3) Neither the name of the University of California, Lawrence Berkeley \n-# National Laboratory, U.S. Dept. of Energy nor the names of its contributors \n-# may be used to endorse or promote products derived from this software \n-# without specific prior written permission. \n-#\n-# THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" \n-# AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE \n-# IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE \n-# ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE \n-# LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR \n-# CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF \n-# SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS \n-# INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN \n-# CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) \n-# ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE \n-# POSSIBILITY OF SUCH DAMAGE. \n-\n-import sys\n-import cgi as cgilib\n-import cgitb; cgitb.enable()\n-\n-#print "Content-Type: text/html\\n\\n"\n-#print "HELLO WORLD"\n-#print __name__\n-\n-from StringIO import StringIO\n-from color import *\n-from colorscheme import ColorScheme, ColorGroup\n-\n-import weblogolib\n-from corebio.utils import *\n-from corebio._future import Template\n-\n-\n-# TODO: Check units\n-\n-# TODO: In WebLogo2: why slash create.cgi? I think this was a workaround\n-# for some browser quirk\n-#<form method="post" action="/create.cgi" enctype="multipart/form-data">\n- \n-def resource_string(resource, basefilename) :\n- import os\n- fn = os.path.join(os.path.dirname(basefilename), resource)\n- return open( fn ).read()\n-\n-mime_type = {\n- \'eps\': \'application/postscript\', \n- \'pdf\': \'application/pdf\',\n- \'png\': \'image/png\',\n- \'png_print\': \'image/png\', \n- \'txt\' : \'text/plain\', \n- \'jpeg\' : \'image/jpeg\',\n-}\n-\n-extension = {\n- \'eps\': \'eps\',\n- \'pdf\': \'pdf\',\n- \'png\': \'png\',\n- \'png_print\': \'png\',\n- \'txt\' : \'txt\', \n- \'jpeg\' : \'png\'\n-}\n-\n-\n-alphabets = {\n- \'alphabet_auto\': None, \n- \'alphabet_protein\': weblogolib.unambiguous_protein_alphabet, \n- \'alphabet_rna\': weblogolib.unambiguous_rna_alphabet,\n- \'alphabet_dna\': weblogolib.unambiguous_dna_alphabet}\n-\n-color_schemes = {}\n-for k in weblogolib.std_color_schemes.keys():\n- color_schemes[ \'color_\'+k.replace(\' \', \'_\')] = weblogolib.std_color_schemes[k]\n- \n-\n-composition = {\'comp_none\' : \'none\',\n- \'comp_auto\' : \'auto\',\n- \'comp_equiprobable\':\'equiprobable\',\n- \'comp_CG\': \'percentCG\',\n- \'comp_Celegans\' : \'C. elegans\',\n- \'comp_Dmelanogaster\' : \'D. melanogaster\',\n- \'comp_Ecoli\' : \'E. coli\',\n- \'comp_Hsapiens\': \'H. sapiens\',\n- \'comp_Mmusculus\' : \'M. musculus\',\n- \'comp_Scerevisiae\': \'S. cerevisiae\'\n-}\n-\n-class Field(object) :\n- """ A represe'..b'comp = form["composition"].get_value()\n- percentCG = form["percentCG"].get_value()\n- ignore_lower_case = form_values.has_key("ignore_lower_case") \n- seqs = weblogolib.read_seq_data(StringIO( sequences), \n- alphabet=logooptions.alphabet,\n- ignore_lower_case=ignore_lower_case\n- )\n- if comp==\'percentCG\': comp = str(percentCG/100)\n- prior = weblogolib.parse_prior(comp, seqs.alphabet)\n- data = weblogolib.LogoData.from_seqs(seqs, prior) \n- logoformat = weblogolib.LogoFormat(data, logooptions)\n- format = form["format"].value \n- weblogolib.formatters[format](data, logoformat, logo) \n- except ValueError, err :\n- errors.append( err.args )\n- except IOError, err :\n- errors.append( err.args)\n- except RuntimeError, err :\n- errors.append( err.args )\n- \n- if form_values.has_key("cmd_validate") or errors :\n- send_form(controls, errors, htdocs_directory) \n- return \n- \n- \n- #\n- # RETURN LOGO OVER HTTP\n- #\n-\n- print "Content-Type:", mime_type[format]\n- # Content-Disposition: inline Open logo in browser window\n- # Content-Disposition: attachment Download logo \n- if form_values.has_key("download") :\n- print \'Content-Disposition: attachment; \' \\\n- \'filename="logo.%s"\' % extension[format] \n- else : \n- print \'Content-Disposition: inline; \' \\\n- \'filename="logo.%s"\' % extension[format] \n- \n- \n- # Seperate header from data\n- print \n- \n- # Finally, and at last, send the logo.\n- print logo.getvalue() \n-\n- \n-def send_form(controls, errors=[], htdocs_directory=None) :\n- if htdocs_directory is None :\n- htdocs_directory = os.path.join(\n- os.path.dirname(__file__, "htdocs") )\n-\n- subsitutions = {}\n- subsitutions["version"] = weblogolib.release_description \n- \n- for c in controls :\n- if c.options :\n- for opt in c.options :\n- subsitutions[opt.replace(\'/\',\'_\')] = \'\'\n- subsitutions[c.value.replace(\'/\',\'_\')] = \'selected\'\n- else :\n- value = c.value\n- if value == None : value = \'auto\'\n- if value==\'true\':\n- subsitutions[c.name] = \'checked\'\n- elif type(value)==bool :\n- if value :\n- subsitutions[c.name] = \'checked\'\n- else :\n- subsitutions[c.name] = \'\'\n- else :\n- subsitutions[c.name] = str(value)\n- subsitutions[c.name+\'_err\'] = \'\'\n- \n- if errors :\n- print >>sys.stderr, errors\n- error_message = []\n- for e in errors :\n- if type(e) is str :\n- msg = e\n- elif len(e)==2:\n- subsitutions[e[0]+"_err"] = "class=\'error\'" \n- msg = e[1]\n- else :\n- msg = e[0]\n-\n-\n- error_message += "ERROR: " \n- error_message += msg\n- error_message += \' <br />\'\n- \n- error_message += \\\n- "<input style=\'float:right; font-size:small\' type=\'submit\' name=\'cmd_validate\' value=\'Clear Error\' /> "\n- subsitutions["error_message"] = \'\'.join(error_message)\n- else :\n- subsitutions["error_message"] = ""\n- \n- \n- template = resource_string("create_html_template.html", htdocs_directory)\n- html = Template(template).safe_substitute(subsitutions) #FIXME\n-\n- print "Content-Type: text/html\\n\\n"\n- print html\n-\n- # DEBUG\n- # keys = subsitutions.keys()\n- # keys.sort()\n- # for k in keys :\n- # print k,"=", subsitutions[k], " <br />" \n-\n- #for k in controls :\n- # print k.name,"=", k.get_value(), " <br />" \n-\n-\n-\n-if __name__=="__main__" :\n- main()\n-\n-\n-\n-\n'

diff -r 4d47ab2b7bcc -r b89bb51eba83 weblogolib/cluster18.aln
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/weblogolib/cluster18.aln Mon Jan 16 06:59:52 2012 -0500

[

b'@@ -0,0 +1,18043 @@\n+CLUSTAL FORMAT for T-COFFEE Version_5.72 [http://www.tcoffee.org] [MODE: ], CPU=1.22 sec, SCORE=0, Nseq=857, Len=1224 \n+\n+Y_234_CP000713.1 ATGAAAAAATCAAGATTGACCGACACTCAAATCGTTAATATACTCAAACAAGCAGAACAA\n+Y_4022_CP000082.1 ATGAAAAAGACACGCTTTAGCGACAACCAAATCGTCAACATCCTCAAACAAGCAGAACAA\n+Y_4030_CP000082.1 ATGAAAAAATCACGCTTTAGCGACAACCAAATCGTCAACATCCTCAAACAAGCGGAACAA\n+Y_4032_CP000082.1 ATGAAAAAATCACGCTTTAGCGACAACCAAATCGTCAACATCCTCAAACAAGCGGAACAA\n+Y_160_AF121266.1 ATGAAAACATCGAAATTTACTGACAGTCAGATCATGTCCATCTTGAAGCAGGCGGAATCT\n+Y_152_AE014299.1 ATGAAAACATCAAAATTCACCGATAGCCAAATCATGGCAATCCTTAAACAAGCTGAAGCC\n+Y_154_AE014299.1 ATGAAAACATCAAAATTCACCGATAGCCAAATCATGGCAATCCTTAAACAAGCTGAAGCC\n+Y_156_AE014299.1 ATGAAAACATCAAAATTCACCGATAGCCAAATCATGGCAATCCTTAAACAAGCTGAAGCC\n+Y_158_AE014299.1 ATGAAAACATCAAAATTCACCGATAGCCAAATCATGGCAATCCTTAAACAAGCTGAAGCC\n+Y_4700_CP000514.1 ATGAAGAAGTCTCGATTCACCGACAGCCAGATCATGGCGATCCTGAAGCAGCACGAAGCC\n+Y_4713_CP000516.1 ATGAAGAAGTCTCGATTCACCGACAGCCAGATCATGGCGATCCTGAAGCAGCACGAAGCC\n+Y_4079_CP000112.1 ATGAAGAAATCGCGTTACACAGACAGTCAAATTTTAAATATTTTGAAGCAGGCCGAGAAT\n+Y_2598_AP011170.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2097_AP011121.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2169_AP011128.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2241_AP011135.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2313_AP011142.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2385_AP011149.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2457_AP011156.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2527_AP011163.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2624_AP011172.1 ATGAAGAGTGATCGCTTTACTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2123_AP011123.1 ATGAAGAGTGATCGCTTTACTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2195_AP011130.1 ATGAAGAGTGATCGCTTTACTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2267_AP011137.1 ATGAAGAGTGATCGCTTTACTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2339_AP011144.1 ATGAAGAGTGATCGCTTTACTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2411_AP011151.1 ATGAAGAGTGATCGCTTTACTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2483_AP011158.1 ATGAAGAGTGATCGCTTTACTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2552_AP011165.1 ATGAAGAGTGATCGCTTTACTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2570_AP011166.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2620_AP011171.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2632_AP011172.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2642_AP011173.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2119_AP011122.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2131_AP011123.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2141_AP011124.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2191_AP011129.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2203_AP011130.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2213_AP011131.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2263_AP011136.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2275_AP011137.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2285_AP011138.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2335_AP011143.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2347_AP011144.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2357_AP011145.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2407_AP011150.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2419_AP011151.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2429_AP011152.1 ATGAAGAGTGATCGCTTTAGTGACGCCCAGATCATGGGTGTGATCCGCCAGGCTGAGGGC\n+Y_2479_AP011157.1 ATGAAGAGTGATCGCTTTAGTGACGCCCA'..b'1510.1 ------------------------\n+Y_7194_CP001510.1 ------------------------\n+Y_7196_CP001510.1 ------------------------\n+Y_7198_CP001510.1 ------------------------\n+Y_7207_CP001511.1 ------------------------\n+Y_7208_CP001511.1 ------------------------\n+Y_7200_CP001510.1 ------------------------\n+Y_7202_CP001510.1 ------------------------\n+Y_4664_CP000494.1 ------------------------\n+Y_1498_AM039952.1 ------------------------\n+Y_167_AP007255.1 ------------------------\n+Y_169_AP007255.1 ------------------------\n+Y_7294_CP001623.1 ------------------------\n+Y_1424_AL672114.1 ------------------------\n+Y_1427_AL672115.1 ------------------------\n+Y_4203_CP000157.1 ------------------------\n+Y_4205_CP000157.1 ------------------------\n+Y_4207_CP000157.1 ------------------------\n+Y_4209_CP000157.1 ------------------------\n+Y_4210_CP000157.1 ------------------------\n+Y_4212_CP000157.1 ------------------------\n+Y_4214_CP000157.1 ------------------------\n+Y_298_AB196775.2 ------------------------\n+Y_7014_CP001472.1 ------------------------\n+Y_1758_AM902716.1 ------------------------\n+Y_8248_FP885897.1 ------------------------\n+Y_8249_FP885897.1 ------------------------\n+Y_8250_FP885897.1 ------------------------\n+Y_7672_CU694393.1 ------------------------\n+Y_7678_CU695238.1 ------------------------\n+Y_7680_CU695240.1 ------------------------\n+Y_255_CU695240.1 ------------------------\n+Y_7798_DQ402419.1 ------------------------\n+Y_2922_BX640444.1 ------------------------\n+Y_1743_AM902716.1 ------------------------\n+Y_1762_AM902716.1 ------------------------\n+Y_6838_CP001359.1 ------------------------\n+Y_1671_AM747720.1 ------------------------\n+Y_1680_AM747720.1 ------------------------\n+Y_1692_AM747721.1 ------------------------\n+Y_6658_CP001131.1 ------------------------\n+Y_6204_CP001001.1 ------------------------\n+Y_6206_CP001001.1 ------------------------\n+Y_6208_CP001001.1 ------------------------\n+Y_6210_CP001001.1 ------------------------\n+Y_6217_CP001002.1 ------------------------\n+Y_244_CP001298.1 ------------------------\n+Y_245_CP001299.1 ------------------------\n+Y_247_CP001511.1 ------------------------\n+Y_250_CP001511.1 ------------------------\n+Y_8196_FP103042.2 ------------------------\n+Y_258_FP103042.2 ------------------------\n+Y_259_FP103042.2 ------------------------\n+Y_6604_CP001089.1 ------------------------\n+Y_1408_AL646052.1 ------------------------\n+Y_1411_AL646052.1 ------------------------\n+Y_1418_AL646053.1 ------------------------\n+Y_240_CP000965.1 ------------------------\n+Y_242_CP000965.1 ------------------------\n+Y_3138_CP000026.1 ------------------------\n+Y_7980_FM200053.1 ------------------------\n+Y_236_CP000880.1 ------------------------\n+Y_6115_CP000950.1 ------------------------\n+Y_1100_AE017042.1 ------------------------\n+Y_4423_CP000305.1 ------------------------\n+Y_4425_CP000308.1 ------------------------\n+Y_5431_CP000668.1 ------------------------\n+Y_5941_CP000901.1 ------------------------\n+Y_818_AE009952.1 ------------------------\n+Y_6113_CP000950.1 ------------------------\n+Y_2931_BX936399.2 ------------------------\n+Y_6282_CP001049.1 ------------------------\n+Y_2928_BX936398.1 ------------------------\n+Y_6279_CP001048.1 ------------------------\n+Y_1104_AE017043.1 ------------------------\n+Y_1186_AF053946.1 ------------------------\n+Y_1193_AF074612.1 ------------------------\n+Y_1366_AL117189.1 ------------------------\n+Y_4429_CP000311.1 ------------------------\n+Y_5435_CP000669.1 ------------------------\n+Y_5569_CP000722.1 ------------------------\n+Y_7236_CP001586.1 ------------------------\n+Y_7240_CP001590.1 ------------------------\n+Y_7245_CP001594.1 ------------------------\n+Y_5944_CP000902.1 ------------------------\n+Y_2735_AY641982.1 ------------------------\n+Y_7259_CP001600.1 ------------------------\n+Y_252_CP001600.1 ------------------------\n+ \n+\n+\n+\n'

diff -r 4d47ab2b7bcc -r b89bb51eba83 weblogolib/color.py
--- a/weblogolib/color.py Fri Jan 13 07:18:19 2012 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

b'@@ -1,324 +0,0 @@\n-\n-\n-# Copyright (c) 2005 Gavin E. Crooks\n-#\n-# This software is distributed under the MIT Open Source License.\n-# <http://www.opensource.org/licenses/mit-license.html>\n-#\n-# Permission is hereby granted, free of charge, to any person obtaining a \n-# copy of this software and associated documentation files (the "Software"),\n-# to deal in the Software without restriction, including without limitation\n-# the rights to use, copy, modify, merge, publish, distribute, sublicense,\n-# and/or sell copies of the Software, and to permit persons to whom the\n-# Software is furnished to do so, subject to the following conditions:\n-#\n-# The above copyright notice and this permission notice shall be included\n-# in all copies or substantial portions of the Software.\n-#\n-# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR \n-# IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, \n-# FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE\n-# AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER \n-# LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,\n-# OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN \n-# THE SOFTWARE.\n-\n-""" Color specifications using CSS2 (Cascading Style Sheet) syntax."""\n-\n-class Color: \n- """ Color specifications using CSS2 (Cascading Style Sheet) syntax.\n- \n- http://www.w3.org/TR/REC-CSS2/syndata.html#color-units\n-\n- Usage:\n- \n- red = Color(255,0,0)\n- red = Color(1., 0., 0.)\n- red = Color.by_name("red")\n- red = Color.from_rgb(1.,0.,0.)\n- red = Color.from_rgb(255,0,0)\n- red = Color.from_hsl(0.,1., 0.5)\n- \n- red = Color.from_string("red") \n- red = Color.from_string("RED") \n- red = Color.from_string("#F00") \n- red = Color.from_string("#FF0000") \n- red = Color.from_string("rgb(255, 0, 0)")\n- red = Color.from_string("rgb(100%, 0%, 0%)")\n- red = Color.from_string("hsl(0, 100%, 50%)")\n-\n- """\n- def __init__(self, red, green, blue) :\n- \n- if ( type(red) is not type(green) ) or (type(red) is not type(blue)):\n- raise TypeError("Mixed floats and integers?")\n-\n- if type(red) is type(1) : red = float(red)/255.\n- if type(green) is type(1) : green = float(green)/255. \n- if type(blue) is type(1) : blue = float(blue)/255.\n-\n- self.red = max(0., min(float(red), 1.0))\n- self.green = max(0., min(float(green), 1.0))\n- self.blue = max(0., min(float(blue), 1.0))\n-\n- #@staticmethod\n- def names():\n- "Return a list of standard color names."\n- return _std_colors.keys()\n- names = staticmethod(names)\n-\n- #@classmethod\n- def from_rgb(cls, r, g, b):\n- return cls(r,g,b)\n- from_rgb = classmethod(from_rgb)\n- \n- #@classmethod\n- def from_hsl(cls, hue_angle, saturation, lightness ):\n- def hue_to_rgb( v1, v2, vH) :\n- if vH < 0.0 : vH += 1.0\n- if vH > 1.0 : vH -= 1.0\n- if vH*6.0 < 1.0 : return (v1 + (v2 - v1) * 6.0 * vH)\n- if vH*2.0 < 1.0 : return v2\n- if vH*3.0 < 2.0 : return (v1 + (v2 - v1) * ((2.0/3.0) - vH) * 6.0)\n- return v1 \n- \n- hue = (((hue_angle % 360.) + 360.) % 360.)/360.\n- \n- if not (saturation >= 0.0 and saturation <=1.0) :\n- raise ValueError("Out-of-range saturation %f"% saturation)\n- if not (lightness >= 0.0 and lightness <=1.0) :\n- raise ValueError("Out-of-range lightness %f"% lightness)\n- \n- if saturation == 0 :\n- # greyscale\n- return cls.from_rgb( lightness, lightness, lightness)\n- \n- if lightness < 0.5 :\n- v2 = lightness * (1.0+ saturation)\n- else :\n- v2 = (lightness + saturation) - (saturation* lightness) \n-\n- v1 = 2.0 * lightness - v2\n- r = hue_to_rgb( v'..b',245), #fff0f5\n- lawngreen = Color(124,252,0), #7cfc00\n- lemonchiffon = Color(255,250,205), #fffacd\n- lightblue = Color(173,216,230), #add8e6\n- lightcoral = Color(240,128,128), #f08080\n- lightcyan = Color(224,255,255), #e0ffff\n- lightgoldenrodyellow = Color(250,250,210), #fafad2\n- lightgray = Color(211,211,211), #d3d3d3\n- lightgreen = Color(144,238,144), #90ee90\n- lightgrey = Color(211,211,211), #d3d3d3\n- lightpink = Color(255,182,193), #ffb6c1\n- lightsalmon = Color(255,160,122), #ffa07a\n- lightseagreen = Color(32,178,170), #20b2aa\n- lightskyblue = Color(135,206,250), #87cefa\n- lightslategray = Color(119,136,153), #778899\n- lightslategrey = Color(119,136,153), #778899\n- lightsteelblue = Color(176,196,222), #b0c4de\n- lightyellow = Color(255,255,224), #ffffe0\n- lime = Color(0,255,0), #00ff00\n- limegreen = Color(50,205,50), #32cd32\n- linen = Color(250,240,230), #faf0e6\n- magenta = Color(255,0,255), #ff00ff\n- maroon = Color(128,0,0), #800000\n- mediumaquamarine = Color(102,205,170), #66cdaa\n- mediumblue = Color(0,0,205), #0000cd\n- mediumorchid = Color(186,85,211), #ba55d3\n- mediumpurple = Color(147,112,219), #9370db\n- mediumseagreen = Color(60,179,113), #3cb371\n- mediumslateblue = Color(123,104,238), #7b68ee\n- mediumspringgreen = Color(0,250,154), #00fa9a\n- mediumturquoise = Color(72,209,204), #48d1cc\n- mediumvioletred = Color(199,21,133), #c71585\n- midnightblue = Color(25,25,112), #191970\n- mintcream = Color(245,255,250), #f5fffa\n- mistyrose = Color(255,228,225), #ffe4e1\n- moccasin = Color(255,228,181), #ffe4b5\n- navajowhite = Color(255,222,173), #ffdead\n- navy = Color(0,0,128), #000080\n- oldlace = Color(253,245,230), #fdf5e6\n- olive = Color(128,128,0), #808000\n- olivedrab = Color(107,142,35), #6b8e23\n- orange = Color(255,165,0), #ffa500\n- orangered = Color(255,69,0), #ff4500\n- orchid = Color(218,112,214), #da70d6\n- palegoldenrod = Color(238,232,170), #eee8aa\n- palegreen = Color(152,251,152), #98fb98\n- paleturquoise = Color(175,238,238), #afeeee\n- palevioletred = Color(219,112,147), #db7093\n- papayawhip = Color(255,239,213), #ffefd5\n- peachpuff = Color(255,218,185), #ffdab9\n- peru = Color(205,133,63), #cd853f\n- pink = Color(255,192,203), #ffc0cb\n- plum = Color(221,160,221), #dda0dd\n- powderblue = Color(176,224,230), #b0e0e6\n- purple = Color(128,0,128), #800080\n- red = Color(255,0,0), #ff0000\n- rosybrown = Color(188,143,143), #bc8f8f\n- royalblue = Color(65,105,225), #4169e1\n- saddlebrown = Color(139,69,19), #8b4513\n- salmon = Color(250,128,114), #fa8072\n- sandybrown = Color(244,164,96), #f4a460\n- seagreen = Color(46,139,87), #2e8b57\n- seashell = Color(255,245,238), #fff5ee\n- sienna = Color(160,82,45), #a0522d\n- silver = Color(192,192,192), #c0c0c0\n- skyblue = Color(135,206,235), #87ceeb\n- slateblue = Color(106,90,205), #6a5acd\n- slategray = Color(112,128,144), #708090\n- slategrey = Color(112,128,144), #708090\n- snow = Color(255,250,250), #fffafa\n- springgreen = Color(0,255,127), #00ff7f\n- steelblue = Color(70,130,180), #4682b4\n- tan = Color(210,180,140), #d2b48c\n- teal = Color(0,128,128), #008080\n- thistle = Color(216,191,216), #d8bfd8\n- tomato = Color(255,99,71), #ff6347\n- turquoise = Color(64,224,208), #40e0d0\n- violet = Color(238,130,238), #ee82ee\n- wheat = Color(245,222,179), #f5deb3\n- white = Color(255,255,255), #ffffff\n- whitesmoke = Color(245,245,245), #f5f5f5\n- yellow = Color(255,255,0), #ffff00\n- yellowgreen = Color(154,205,50) #9acd32\n- )\n- \n- \n'

diff -r 4d47ab2b7bcc -r b89bb51eba83 weblogolib/colorscheme.py
--- a/weblogolib/colorscheme.py Fri Jan 13 07:18:19 2012 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

[

b'@@ -1,455 +0,0 @@\n-\n-# Copyright (c) 2003-2005 The Regents of the University of California.\n-# Copyright (c) 2005 Gavin E. Crooks\n-\n-# This software is distributed under the MIT Open Source License.\n-# <http://www.opensource.org/licenses/mit-license.html>\n-#\n-# Permission is hereby granted, free of charge, to any person obtaining a \n-# copy of this software and associated documentation files (the "Software"),\n-# to deal in the Software without restriction, including without limitation\n-# the rights to use, copy, modify, merge, publish, distribute, sublicense,\n-# and/or sell copies of the Software, and to permit persons to whom the\n-# Software is furnished to do so, subject to the following conditions:\n-#\n-# The above copyright notice and this permission notice shall be included\n-# in all copies or substantial portions of the Software.\n-#\n-# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR \n-# IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, \n-# FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE\n-# AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER \n-# LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,\n-# OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN \n-# THE SOFTWARE.\n-\n-""" Popular color codings for nucleic and amino acids. \n-\n-Classes:\n- ColorScheme -- A color scheme\n- ColorGroup \n- \n- \n-Generic\n- monochrome\n-\n-Nucleotides\n- nucleotide\n- base pairing\n-\n-Amino Acid\n- hydrophobicity\n- chemistry\n- charge\n- taylor\n-\n-Status : Beta - Needs documentation.\n-\n-"""\n-# Good online references include bioruby and the JalView alignment editor.\n-# Clamp, M., Cuff, J., Searle, S. M. and Barton, G. J. (2004), \n-# "The Jalview Java Alignment Editor," Bioinformatics, 12, 426-7\n-# http://www.jalview.org\n-\n-import sys\n-\n-from corebio import seq\n-from color import Color\n-codon_alphabetU=[\'AAA\', \'AAU\', \'AAC\', \'AAG\', \'AUA\', \'AUU\', \'AUC\', \'AUG\', \'ACA\', \'ACU\', \'ACC\', \'ACG\', \'AGA\', \'AGU\', \'AGC\', \'AGG\', \'UAA\', \'UAU\', \'UAC\', \'UAG\', \'UUA\', \'UUU\', \'UUC\', \'UUG\', \'UCA\', \'UCU\', \'UCC\', \'UCG\', \'UGA\', \'UGU\', \'UGC\', \'UGG\', \'CAA\', \'CAU\', \'CAC\', \'CAG\', \'CUA\', \'CUU\', \'CUC\', \'CUG\', \'CCA\', \'CCU\', \'CCC\', \'CCG\', \'CGA\', \'CGU\', \'CGC\', \'CGG\', \'GAA\', \'GAU\', \'GAC\', \'GAG\', \'GUA\', \'GUU\', \'GUC\', \'GUG\', \'GCA\', \'GCU\', \'GCC\', \'GCG\', \'GGA\', \'GGU\', \'GGC\', \'GGG\']\n-codon_alphabetT=[\'AAA\', \'AAT\', \'AAC\', \'AAG\', \'ATA\', \'ATT\', \'ATC\', \'ATG\', \'ACA\', \'ACT\', \'ACC\', \'ACG\', \'AGA\', \'AGT\', \'AGC\', \'AGG\', \'TAA\', \'TAT\', \'TAC\', \'TAG\', \'TTA\', \'TTT\', \'TTC\', \'TTG\', \'TCA\', \'TCT\', \'TCC\', \'TCG\', \'TGA\', \'TGT\', \'TGC\', \'TGG\', \'CAA\', \'CAT\', \'CAC\', \'CAG\', \'CTA\', \'CTT\', \'CTC\', \'CTG\', \'CCA\', \'CCT\', \'CCC\', \'CCG\', \'CGA\', \'CGT\', \'CGC\', \'CGG\', \'GAA\', \'GAT\', \'GAC\', \'GAG\', \'GTA\', \'GTT\', \'GTC\', \'GTG\', \'GCA\', \'GCT\', \'GCC\', \'GCG\', \'GGA\', \'GGT\', \'GGC\', \'GGG\']\n-\n-class ColorScheme(object):\n- """ A coloring of an alphabet.\n- \n- title : string -- A human readable description\n- defualt_color : Color --\n- groups : list of color groups \n- alphabet : string -- The set of colored symbols\n- color -- A map between a symbol and a Coloring\n- \n-\n- """\n- \n- def __init__(self, \n- groups = [], \n- title = "", \n- description = "",\n- default_color = "black", \n- alphabet = seq.generic_alphabet) :\n- """ """\n- self.title= title\n- self.description = description\n- self.default_color = Color.from_string(default_color)\n- self.groups = groups\n- self.alphabet = alphabet\n- #print >> sys.stderr, groups\n-\taltype="codons"\n-\t#print >> sys.stderr,altype\n-\t#if(alphabet==codon_alphabet):\n-\t #print >> sys.stderr,"haleyulia it works"\n-\n- color = {}\n- #print >> sys.stderr, groups\n- if(alphabet!=codon_alphabetT and alphabet!=codon_alphabetU):\n-\t for'..b'FFFF\'),\n-\n-\n-ColorGroup( \'GAT\', \'#FF0000\'),\n-ColorGroup( \'GAU\', \'#FF0000\'),\n-ColorGroup( \'GAC\', \'#FF0000\'),\n-\n-ColorGroup( \'GAA\', \'#FF0000\'),\n-ColorGroup( \'GAG\', \'#FF0000\'),\n-\n-\n-ColorGroup( \'TCT\', \'#00FF00\'),\n-ColorGroup( \'UCU\', \'#00FF00\'),\n-ColorGroup( \'TCC\', \'#00FF00\'),\n-ColorGroup( \'UCC\', \'#00FF00\'),\n-ColorGroup( \'TCA\', \'#00FF00\'),\n-ColorGroup( \'UCA\', \'#00FF00\'),\n-ColorGroup( \'TCG\', \'#00FF00\'),\n-ColorGroup( \'UCG\', \'#00FF00\'),\n-ColorGroup( \'AGT\', \'#00FF00\'),\n-ColorGroup( \'AGU\', \'#00FF00\'),\n-ColorGroup( \'AGC\', \'#00FF00\'),\n-\n-ColorGroup( \'ACT\', \'#00FF00\'),\n-ColorGroup( \'ACU\', \'#00FF00\'),\n-ColorGroup( \'ACC\', \'#00FF00\'),\n-ColorGroup( \'ACA\', \'#00FF00\'),\n-ColorGroup( \'ACG\', \'#00FF00\'),\n-\n-ColorGroup( \'CAA\', \'#00FF00\'),\n-ColorGroup( \'CAG\', \'#00FF00\'),\n-\n-ColorGroup( \'AAT\', \'#00FF00\'),\n-ColorGroup( \'AAU\', \'#00FF00\'),\n-ColorGroup( \'AAC\', \'#00FF00\'),\n-\n-\n-ColorGroup( \'GCT\', \'#5555FF\'),\n-ColorGroup( \'GCU\', \'#5555FF\'),\n-ColorGroup( \'GCC\', \'#5555FF\'),\n-ColorGroup( \'GCA\', \'#5555FF\'),\n-ColorGroup( \'GCG\', \'#5555FF\'),\n-\n-ColorGroup( \'GTT\', \'#5555FF\'),\n-ColorGroup( \'GUU\', \'#5555FF\'),\n-ColorGroup( \'GTC\', \'#5555FF\'),\n-ColorGroup( \'GUC\', \'#5555FF\'),\n-ColorGroup( \'GTA\', \'#5555FF\'),\n-ColorGroup( \'GUA\', \'#5555FF\'),\n-ColorGroup( \'GTG\', \'#5555FF\'),\n-ColorGroup( \'GUG\', \'#5555FF\'),\n-\n-ColorGroup( \'CTT\', \'#5555FF\'),\n-ColorGroup( \'CUU\', \'#5555FF\'),\n-ColorGroup( \'CTC\', \'#5555FF\'),\n-ColorGroup( \'CUC\', \'#5555FF\'),\n-ColorGroup( \'CTA\', \'#5555FF\'),\n-ColorGroup( \'CUA\', \'#5555FF\'),\n-ColorGroup( \'CTG\', \'#5555FF\'),\n-ColorGroup( \'CUG\', \'#5555FF\'),\n-ColorGroup( \'TTA\', \'#5555FF\'),\n-ColorGroup( \'UUA\', \'#5555FF\'),\n-ColorGroup( \'TTG\', \'#5555FF\'),\n-ColorGroup( \'UUG\', \'#5555FF\'),\n-\n-ColorGroup( \'ATT\', \'#5555FF\'),\n-ColorGroup( \'AUU\', \'#5555FF\'),\n-ColorGroup( \'ATC\', \'#5555FF\'),\n-ColorGroup( \'AUC\', \'#5555FF\'),\n-ColorGroup( \'ATA\', \'#5555FF\'),\n-ColorGroup( \'AUA\', \'#5555FF\'),\n-\n-ColorGroup( \'ATG\', \'#5555FF\'),\n-ColorGroup( \'AUG\', \'#5555FF\'),\n-\n-\n-ColorGroup( \'TTT\', \'#FF00FF\'),\n-ColorGroup( \'UUU\', \'#FF00FF\'),\n-ColorGroup( \'TTC\', \'#FF00FF\'),\n-ColorGroup( \'UUC\', \'#FF00FF\'),\n-\n-ColorGroup( \'TAT\', \'#FF00FF\'),\n-ColorGroup( \'UAU\', \'#FF00FF\'),\n-ColorGroup( \'TAC\', \'#FF00FF\'),\n-ColorGroup( \'UAC\', \'#FF00FF\'),\n-\n-ColorGroup( \'TGG\', \'#FF00FF\'),\n-ColorGroup( \'UGG\', \'#FF00FF\'),\n-\n-\n-ColorGroup( \'GGT\', \'#996600\'),\n-ColorGroup( \'GGU\', \'#996600\'),\n-ColorGroup( \'GGC\', \'#996600\'),\n-ColorGroup( \'GGA\', \'#996600\'),\n-ColorGroup( \'GGG\', \'#996600\'),\n-\n-ColorGroup( \'CCT\', \'#996600\'),\n-ColorGroup( \'CCU\', \'#996600\'),\n-ColorGroup( \'CCC\', \'#996600\'),\n-ColorGroup( \'CCA\', \'#996600\'),\n-ColorGroup( \'CCG\', \'#996600\'),\n-\n-\n-ColorGroup( \'TGT\', \'#FFFF00\'),\n-ColorGroup( \'UGU\', \'#FFFF00\'),\n-ColorGroup( \'TGC\', \'#FFFF00\'),\n-ColorGroup( \'UGC\', \'#FFFF00\'),\n-\n-ColorGroup( \'TAA\', \'#000000\'),\n-ColorGroup( \'UAA\', \'#000000\'),\n-ColorGroup( \'TAG\', \'#000000\'),\n-ColorGroup( \'UAG\', \'#000000\'),\n-ColorGroup( \'TGA\', \'#000000\'), \n-ColorGroup( \'UGA\', \'#000000\')],\n- alphabet = codon_alphabetT\n- )\n-\n-\n-\n-\n-charge = ColorScheme([\n- ColorGroup("KRH", "blue", "Positive" ),\n- ColorGroup( "DE", "red", "Negative") ],\n- alphabet = seq.unambiguous_protein_alphabet\n- )\n-\n-\n-taylor = ColorScheme([\n- ColorGroup( \'A\', \'#CCFF00\' ),\n- ColorGroup( \'C\', \'#FFFF00\' ),\n- ColorGroup( \'D\', \'#FF0000\'),\n- ColorGroup( \'E\', \'#FF0066\' ),\n- ColorGroup( \'F\', \'#00FF66\'),\n- ColorGroup( \'G\', \'#FF9900\'),\n- ColorGroup( \'H\', \'#0066FF\'),\n- ColorGroup( \'I\', \'#66FF00\'),\n- ColorGroup( \'K\', \'#6600FF\'),\n- ColorGroup( \'L\', \'#33FF00\'),\n- ColorGroup( \'M\', \'#00FF00\'),\n- ColorGroup( \'N\', \'#CC00FF\'),\n- ColorGroup( \'P\', \'#FFCC00\'),\n- ColorGroup( \'Q\', \'#FF00CC\'),\n- ColorGroup( \'R\', \'#0000FF\'),\n- ColorGroup( \'S\', \'#FF3300\'),\n- ColorGroup( \'T\', \'#FF6600\'),\n- ColorGroup( \'V\', \'#99FF00\'),\n- ColorGroup( \'W\', \'#00CCFF\'),\n- ColorGroup( \'Y\', \'#00FFCC\')],\n- title = "Taylor",\n- description = "W. Taylor, Protein Engineering, Vol 10 , 743-746 (1997)",\n- alphabet = seq.unambiguous_protein_alphabet\n- )\n- \n-\n-\n'

diff -r 4d47ab2b7bcc -r b89bb51eba83 weblogolib/htdocs/create.cgi
--- a/weblogolib/htdocs/create.cgi Fri Jan 13 07:18:19 2012 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

@@ -1,48 +0,0 @@
-#!/usr/bin/env python
-
-#  Copyright (c) 2003-2004 The Regents of the University of California.
-#  Copyright (c) 2005 Gavin E. Crooks
-#  Copyright (c) 2006, The Regents of the University of California, through
-#  Lawrence Berkeley National Laboratory (subject to receipt of any required
-#  approvals from the U.S. Dept. of Energy).  All rights reserved.
-
-#  This software is distributed under the new BSD Open Source License.
-#  <http://www.opensource.org/licenses/bsd-license.html>
-#
-#  Redistribution and use in source and binary forms, with or without
-#  modification, are permitted provided that the following conditions are met:
-#
-#  (1) Redistributions of source code must retain the above copyright notice,
-#  this list of conditions and the following disclaimer.
-#
-#  (2) Redistributions in binary form must reproduce the above copyright
-#  notice, this list of conditions and the following disclaimer in the
-#  documentation and or other materials provided with the distribution.
-#
-#  (3) Neither the name of the University of California, Lawrence Berkeley
-#  National Laboratory, U.S. Dept. of Energy nor the names of its contributors
-#  may be used to endorse or promote products derived from this software
-#  without specific prior written permission.
-#
-#  THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS"
-#  AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
-#  IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
-#  ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE
-#  LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR
-#  CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF
-#  SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
-#  INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN
-#  CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE)
-#  ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE
-#  POSSIBILITY OF SUCH DAMAGE.
-
-import cgi
-import cgitb; cgitb.enable()
-import weblogolib
-
-if __name__=="__main__" :
-    weblogolib.cgi(__file__)
-
-
-
-

diff -r 4d47ab2b7bcc -r b89bb51eba83 weblogolib/htdocs/create_html_template.html
--- a/weblogolib/htdocs/create_html_template.html Fri Jan 13 07:18:19 2012 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

b'@@ -1,350 +0,0 @@\n-<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN"\n- "http://www.w3.org/TR/html4/transitional.dtd">\n-<html>\n-<head>\n-<link rel="stylesheet" type="text/css" href="logo.css" >\n-\n-\n-<title>CodonLogo 1.0- Create </title>\n-<meta name="author" content="Gavin E. Crooks" >\n-\n-\n-<style type="text/css">\n-td {\n- border-left : white solid 4pt\n-}\n-.error { \n- color: #900;\n- border-left: red solid +4pt;\n-}\n-\n-.err_msg { \n- color: #900;\n-}\n-\n-</style>\n-</head>\n-\n-<body style="align:center">\n-\n-\n-\n-\n-\n-<form method="post" action="create.cgi" enctype="multipart/form-data" >\n-<table width="80%" border = \'0\' cellspacing=\'0\' cellpadding=\'1\' align="center">\n-<tr><td >\n-<h1> Codonlogo 1.0 : Create</h1>\n-\n-</td><td align = "right"> \n- · \n- <a href="./">about</a> ·\n- <a class="selected" href="create.cgi">create</a> · \n- <a href="examples.html">examples</a> · \n- <a href="manual.html">manual</a> · \n-<br>\n-<span style="font-size:small">$version</span>  \n-</td></tr>\n-\n-<tr><td >\n-Sequence data\n-</td><td > \n-<input type="file" name="sequences_file" > \n-</td></tr>\n-\n-<tr><td >\n-</td><td> \n-<span style="font-size:small ">(or paste sequence data below)</span>\n-</td></tr>\n-\n-\n-\n-<tr><td colspan=\'2\' ${sequences_err} >\n-<textarea name="sequences" rows="12" cols ="100" style="width:100%">${sequences}</textarea>\n-</td></tr>\n-\n-\n-\n-<tr><td>\n-</td><td align="right">\n-<input style="font-size:large" type="submit" name="cmd_create" value=" Create Logo    " > <br>\n-<span style="font-size:small"><input type="checkbox" name="download" value="false" >Download</span>\n-</td></tr>\n- \n-\n- \n-\n-\n-<tr><td colspan=\'2\' style="height:30pt;border-left-width:90pt;" class="err_msg">\n-${error_message}\n-</td></tr>\n-\n- \n- \n-<tr><td ${format_err} >\n-Output format </td><td>\n-<select name="format">\n-<option ${png} value="png">PNG (low res.)</option>\n-<option ${png_print} value="png_print">PNG (high res.)</option>\n-<option ${jpeg} value="jpeg">JPEG (low res.)</option>\n-<option ${eps} value="eps">EPS (vector)</option>\n-<option ${pdf} value="pdf">PDF (vector)</option>\n-<option ${txt} value="txt">Data (plain text)</option> \n-</select> \n-\n-</td></tr>\n-\n-<tr><td ${size_err} >\n-Logo size \n-</td><td >\n-<select name="size" >\n-<option ${small} >small</option>\n-<option ${medium}>medium</option>\n-<option ${large} >large</option>\n-</select> \n-</td></tr>\n-\n-\n-<tr><td ${stacks_per_line_err}>\n- Stacks per line\n-</td><td>\n-<input type="text" name="stacks_per_line" value="${stacks_per_line}" size="4" maxlength="4" >\n-</td></tr>\n-\n-<tr><td ${alphabet_err}>\n-Sequence type </td><td>\n-\n-<select name="alphabet">\n-<option ${alphabet_auto} value="alphabet_auto" >auto</option>\n-<option ${alphabet_protein} value="alphabet_protein">protein</option>\n-<option ${alphabet_dna} value="alphabet_dna">dna</option>\n-<option ${alphabet_rna} value="alphabet_rna">rna</option>\n-</select> \n-</td></tr>\n-\n-<tr><td>\n-Ignore lower case\n-</td><td>\n-<input type="checkbox" name="ignore_lower_case" value="true" ${ignore_lower_case} > \n-</td></tr>\n-\n-<tr><td>\n-Use codons:\n-</td><td>\n-<input type="checkbox" name="altype" value="true" ${altype} > \n-</td></tr>\n-\n-\n-<tr><td>\n-Units </td><td>\n-<select name="unit_name" >\n-<option ${probability} >probability</option>\n-<option ${bits} >bits</option>\n-<option ${nats} >nats</option>\n-<option ${kT} >kT</option>\n-<option ${kJ_mol} >kJ/mol</option>\n-<option ${kcal_mol} >kcal/mol</option>\n-</select> \n-\n-</td></tr>\n-\n-<tr><td ${first_index_err}>\n-First position number\n-</td><td>\n-<input type="text" name="first_index" value="${first_index}" size="4" maxlength="80" >\n-</td></tr>\n-\n-<tr'..b'true" ${show_yaxis} > \n-Label: <input type="text" name="yaxis_label" value="${yaxis_label}" size="20" maxlength="32" > \n-\n-</td></tr>\n-\n-<tr><td ${yaxis_scale_err} >\n-Y-axis scale:\n-</td><td>\n-<input type="text" name="yaxis_scale" value="${yaxis_scale}" size="4" maxlength="100" > \n-</td></tr>\n-\n- <tr><td ${yaxis_tic_interval_err} >\n-Y-axis tic spacing:\n-</td><td>\n-<input type="text" name="yaxis_tic_interval" value="${yaxis_tic_interval}" size="4" maxlength="100" > \n-</td></tr>\n-\n-\n-\n-<tr><td>\n-Sequence end labels\n-</td><td>\n-<input type="checkbox" name="show_ends" value="true" ${show_ends} > \n-</td></tr>\n- \n-<tr><td>\n-Version fineprint \n- </td><td>\n-<input type="checkbox" name="show_fineprint" value="true" ${show_fineprint} >\n-</td></tr>\n-\n-\n-\n-\n-<tr><td ${color_scheme_err}>Color scheme\n-</td><td>\n-<select name="color_scheme" >\n-<option ${color_auto} value="color_auto">Auto</option>\n-<option ${color_monochrome} value="color_monochrome" >Monochrome</option>\n-<option ${color_base_pairing} value="color_base_pairing">Base pairing (NA default)</option>\n-<option ${color_classic} value="color_classic">Classic (NA)</option>\n-<option ${color_hydrophobicity} value="color_hydrophobicity">Hydrophobicity (AA default)</option>\n-<option ${color_chemistry} value="color_chemistry">Chemistry (AA)</option>\n-<option ${color_charge} value="color_charge">Charge (AA)</option>\n-<option ${color_custom} value="color_custom">Custom (Specify below)</option>\n-</select> \n-\n-</td></tr>\n-\n-<tr><td></td><td>\n-<table cellpadding="0" cellspacing="0" style="font-size:small">\n-<tr>\n-<td>Symbols</td><td>Color</td> \n-</tr>\n-\n-<tr >\n-<td ${color0_err}><input name="symbols0" type="text" size="16" maxlength="64" value="${symbols0}"></td>\n-<td><input name="color0" type="text" size="16" maxlength="64" value="${color0}"></td>\n-\n-</tr>\n-\n-<tr >\n-<td ${color1_err}><input name="symbols1" type="text" size="16" maxlength="64" value="${symbols1}"></td>\n-<td><input name="color1" type="text" size="16" maxlength="64" value="${color1}"></td>\n-\n-</tr>\n-\n-<tr>\n-<td ${color2_err}><input name="symbols2" type="text" size="16" maxlength="64" value="${symbols2}"></td>\n-<td><input name="color2" type="text" size="16" maxlength="64" value="${color2}"></td>\n-\n-</tr>\n-\n-<tr>\n-<td ${color3_err}><input name="symbols3" type="text" size="16" maxlength="64" value="${symbols3}"></td>\n-<td><input name="color3" type="text" size="16" maxlength="64" value="${color3}"></td>\n-\n-</tr>\n-\n-<tr>\n-<td ${color4_err}><input name="symbols4" type="text" size="16" maxlength="64" value="${symbols4}"></td>\n-<td><input name="color4" type="text" size="16" maxlength="64" value="${color4}"></td>\n-\n-</tr>\n-\n-\n-\n-</table>\n-</td></tr>\n-\n- <tr><td>\n-  \n-</td><td>\n- \n-</td></tr>\n- \n-<tr><td>\n-<input type="submit" name="cmd_reset" value="Reset defaults" >\n-</td><td align="right">\n-<input style="font-size:large" type="submit" name="cmd_create" value=" Create Logo    " >\n-</td></tr>\n- \n- \n-\n-\n-</table>\n-</form>\n-\n-<script type="text/javascript">\n-var gaJsHost = (("https:" == document.location.protocol) ? "https://ssl." : "http://www.");\n-document.write(unescape("%3Cscript src=\'" + gaJsHost + "google-analytics.com/ga.js\' type=\'text/javascript\'%3E%3C/script%3E"));\n-</script>\n-<script type="text/javascript">\n-var pageTracker = _gat._getTracker("UA-5951066-1");\n-pageTracker._trackPageview();\n-</script>\n-</body>\n-</html>\n'

diff -r 4d47ab2b7bcc -r b89bb51eba83 weblogolib/htdocs/examples.html
--- a/weblogolib/htdocs/examples.html Fri Jan 13 07:18:19 2012 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

[

b'@@ -1,2210 +0,0 @@\n-<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN"\n- "http://www.w3.org/TR/html4/transitional.dtd">\n- \n-<html>\n-<head>\n-<link rel="stylesheet" type="text/css" href="logo.css" >\n-<title>CodonLogo - Examples</title>\n-<meta name="author" content="Gavin E. Crooks" >\n-<meta name="author" content="Steven E. Brenner" >\n-<meta name="ID" content="$ID:" >\n-\n-<style type="text/css">\n-img {\n- display: block;\n- margin-left: auto;\n- margin-right: auto }\n-\n-</style>\n-</head>\n-\n-<body>\n-\n-<table width="80%" border = \'0\' cellspacing=\'0\' cellpadding=\'1\' align="center">\n-<tr><td >\n-<h1> CodonLogo 1.0: Examples</h1>\n-\n-</td><td align = "right"> \n- · \n- <a href="./">about</a> ·\n- <a href="create.cgi">create</a> · \n- <a class="selected" href="examples.html">examples</a> · \n- <a href="manual.html">manual</a> · \n-<br>\n- \n-</td></tr>\n-\n-\n-<tr><td colspan="2" class="discourse" >\n-\n-<ul>\n- <li> <a href="#CAP">CAP HTH motif</a> </li>\n- <li> <a href="#trans">Transcription Factors</a> </li>\n- <li> <a href="#promoters"><i>E. coli</i> Promoters</a> </li> \n- <li> <a href="#globins">Globins</a> </li>\n- <li> <a href="#HTH">HTH motif</a> </li>\n- <li> <a href="#splice">Splice Signals</a> </li> \n-</ul>\n-<p> \n-The <strong>Edit Logo</strong> buttons will transfer the relevant\n-sequence data to the <a class="in" href="create.cgi">Logo creation form</a>. \n-There you can examine the sequence data and recreate the logo for \n-yourself. \n-\n-</p>\n-\n-\n-\n-\n-\n-\n--->\n-\n-</td></tr>\n-\n-\n-\n-\n-\n-</table>\n-\n-<script type="text/javascript">\n-var gaJsHost = (("https:" == document.location.protocol) ? "https://ssl." : "http://www.");\n-document.write(unescape("%3Cscript src=\'" + gaJsHost + "google-analytics.com/ga.js\' type=\'text/javascript\'%3E%3C/script%3E"));\n-</script>\n-<script type="text/javascript">\n-var pageTracker = _gat._getTracker("UA-5951066-1");\n-pageTracker._trackPageview();\n-</script>\n-</body></html>\n'

diff -r 4d47ab2b7bcc -r b89bb51eba83 weblogolib/htdocs/img/example.png

Binary file weblogolib/htdocs/img/example.png has changed

diff -r 4d47ab2b7bcc -r b89bb51eba83 weblogolib/htdocs/img/feed-icon-16x16.png

Binary file weblogolib/htdocs/img/feed-icon-16x16.png has changed

diff -r 4d47ab2b7bcc -r b89bb51eba83 weblogolib/htdocs/img/weblogo-fig1.png

Binary file weblogolib/htdocs/img/weblogo-fig1.png has changed

diff -r 4d47ab2b7bcc -r b89bb51eba83 weblogolib/htdocs/img/weblogo_create.png

Binary file weblogolib/htdocs/img/weblogo_create.png has changed

diff -r 4d47ab2b7bcc -r b89bb51eba83 weblogolib/htdocs/index.html
--- a/weblogolib/htdocs/index.html Fri Jan 13 07:18:19 2012 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

[

@@ -1,135 +0,0 @@
-<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN"
-    "http://www.w3.org/TR/html4/transitional.dtd">
-<html>
-<head>
-<link rel="stylesheet" type="text/css" href="logo.css" >
-<title>CodonLogo - About</title>
-<meta name="author" content="Gavin E. Crooks" >
-</head>
-
-<body style="align: center">
-
-
-
-
-<table width="80%" border = '0' cellspacing='0' cellpadding='1' align="center">
-<tr><td >
-<h1>CodonLogo 1.0</h1>
-
-</td><td align = "right">
-    ·
-  <a class="selected" href="./">about</a> ·
-  <a href="create.cgi">create</a> ·
-  <a href="examples.html">examples</a> ·
-  <a href="manual.html">manual</a> ·
-<br>
-<span style="font-size:small"> </span>  
-
-</td></tr>
-
-
-
-<tr><td colspan="2" style="font-size:small">
-   <a href="examples.html"><img
-   alt="CodonLogo" width="284" height="359"
-   src="img/Replacethis1.png" align="right" vspace="40" hspace="10"></a>
-
-
-<h3>Introduction</h3>
-<p>
-Codonlogo is based on <a href="http://weblogo.berkeley.edu/">WebLogo</a>,a web based application designed to make the
-generation of sequence logos easy and painless.CodonLogo Extends Weblogo to allow generation of sequence logos with codons rather than amino acids or nucleotides.
- </p>
-
-<p>
-<a href="http://www.lecb.ncifcrf.gov/~toms/sequencelogo.html">Sequence logos</a> are a graphical representation of an amino acid
-or nucleic acid multiple sequence alignment developed by
-<a href="http://www.lecb.ncifcrf.gov/~toms/schneider.html">Tom Schneider</a>
- and <a href="http://www.lecb.ncifcrf.gov/~toms/sipinfo.html">Mike
- Stephens</a>.
-Each logo consists of stacks of symbols, one stack for each position in the
-sequence. The overall height of the stack indicates the sequence conservation
-at that position, while the height of symbols within the stack indicates the
-relative frequency of each codon at that position. In general,
-a sequence logo provides a richer and more precise description of, for example,
-a binding site, than would a consensus sequence.
-</p>
-
-<ul>
-<li><a href="create.cgi">Create your own logos </a>
-</li><li><a href="examples.html">View example sequence logos and input data.</a>
-</li><li><a href="manual.html">Read the User's Manual</a>
-</li><li> <a href="http://code.google.com/p/weblogo/"> Download WebLogo source code</a>
-</li><li>  <a href="http://groups.google.com/group/WebLogo">WebLogo discussion group</a>
-</li>
-</ul>
-
-
-<h3>References</h3>
-
-
-<p>
-<small>
-<a href="http://bespoke.lbl.gov/">Crooks GE</a>,
-<a href="http://compbio.berkeley.edu/">Hon G</a>,
-<a href="http://compbio.berkeley.edu/">Chandonia JM</a>,
-<a href="http://compbio.berkeley.edu/people/brenner/">Brenner SE</a>
-CodonLogo: A sequence logo
-generator, <br >
-<em>Genome Research</em>, 14:1188-1190, (2004)
-[<a href="http://bespoke.lbl.gov/pubs/fulltext/Crooks2004a-GR-WebLogo.pdf">Full Text</a> ]
-</small>
-</p>
-
-<p>
-<small>
-Schneider TD, Stephens RM. 1990.
-<a class="out" href="http://www.lecb.ncifcrf.gov/~toms/paper/logopaper/">Sequence Logos: A New Way to Display Consensus Sequences.</a>
-<em>Nucleic Acids Res.</em> <em>18</em>:6097-6100
-</small>
-</p>
-
-
-
-
-
-<h3>Disclaimer</h3>
-
-<p>
-While no permanent records are kept of submitted sequences, we cannot
-undertake to guarantee that data sent to CodonLogo remains secure. Moreover,
-no guarantees whatsoever are provided about data generated by CodonLogo.
-</p>
-
-
-
-<h3>Feedback</h3>
-<p>
-Suggestions on how to improve CodonLogo are heartily welcomed!
-Please direct questions to murphy.david@gmail.com
-</p>
-
-</td></tr>
-
-
-
-</table>
-<script type="text/javascript">
-var gaJsHost = (("https:" == document.location.protocol) ? "https://ssl." : "http://www.");
-document.write(unescape("%3Cscript src='" + gaJsHost + "google-analytics.com/ga.js' type='text/javascript'%3E%3C/script%3E"));
-</script>
-<script type="text/javascript">
-var pageTracker = _gat._getTracker("UA-5951066-1");
-pageTracker._trackPageview();
-</script>a
-</body>
-</html>
-
-
-
-
-
-
-
-
-

diff -r 4d47ab2b7bcc -r b89bb51eba83 weblogolib/htdocs/logo.css
--- a/weblogolib/htdocs/logo.css Fri Jan 13 07:18:19 2012 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

@@ -1,67 +0,0 @@
-
-/*
-   Logo Cascading Style Sheet
-*/
-
-body {
-  font-family: sans-serif;
-  color: black;
-  background: white;
-}
-a:link { color: #369; background: transparent }
-a:visited { color: #066; background: transparent }
-a:active { color: #C00; background: transparent }
-
-a.selected:visited {
-  color: #000;
-  background: #EEE;
-  text-decoration: none;
-}
-
-li {margin-bottom: 0.5em}
-
-
-th, td { /* ns 4 */
-  font-family: sans-serif;
-}
-
-h1, h2, h3, h4, h5, h6 { text-align: left }
-h1  { color: #900 }
-h1 { text-align: left }
-h1 { font: 170% sans-serif}
-h2 { font: bold 140% sans-serif }
-h3 { font: bold 120% sans-serif }
-h4 { font: bold 100% sans-serif }
-h5 { font: italic 100% sans-serif }
-h6 { font: small-caps 100% sans-serif }
-
-h2 { margin-top: 2em}
-h4 { margin-bottom: 0.2em}
-
-.discourse {
-    font-size: small
-    }
-
-
-p {text-align: justify; margin-top: 0em}
-p.copyright { font-size: small; text-align: center }
-
-pre { margin-left: 2em ; }
-
-dt, dd { margin-top: 0; margin-bottom: 0 } /* opera 3.50 */
-dt { font-weight: bold }
-
-/* navigator 4 requires this */
-pre, code {
-            font-family: monospace ;
-
-}
-
-
-
-
-
-
-
-
-

diff -r 4d47ab2b7bcc -r b89bb51eba83 weblogolib/htdocs/manual.html
--- a/weblogolib/htdocs/manual.html Fri Jan 13 07:18:19 2012 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

[

b'@@ -1,576 +0,0 @@\n-<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN"\n- "http://www.w3.org/TR/html4/transitional.dtd">\n-<html>\n-<head>\n-<link rel="stylesheet" type="text/css" href="logo.css" >\n-<title>CodonLogo - User\'s Manual</title>\n-<meta name="author" content="Gavin E. Crooks" >\n-\n-<style type="text/css">\n-</style>\n-</head>\n-\n-<body style="align:center">\n-\n-<table width="80%" border = \'0\' cellspacing=\'0\' cellpadding=\'1\' align="center">\n-<tr><td >\n-<h1>CodonLogo 1.0: User\'s Manual</h1>\n-\n-</td><td align = "right" > \n- · \n- <a href="./">about</a> ·\n- <a href="create.cgi">create</a> · \n- <a href="examples.html">examples</a> · \n- <a class="selected" href="manual.html">manual</a> · \n-<br>\n-<span style="font-size:small"> </span>  \n-\n-</td></tr>\n-\n-<tr><td colspan="2" class="discourse">\n-\n-<h4>Contents</h4>\n-\n-<img alt="Sequence logo example." \n-\t src="img/example.png" align="right" vspace="5" hspace="10">\n-\n-\n-<ul>\n-<li><a href="#intro">Introduction</a>\n-</li><li><a href="#create">Creating Sequences Logos using the Web interface</a>\n-</li><li><a href="#download">Downloading and Installing CodonLogo</a>\n-</li><li><a href="#CLI"> Command Line Interface (CLI)</a>\n-</li><li><a href="#API"> Application Programmer Interface (API)</a>\n-</li><li><a href="#dev"> Development and Future Features</a>\n-</li><li><a href="#misc">Miscellanea</a>\n-</li>\n-</ul>\n-\n-\n-<a name="intro" ></a><h2>Introduction</h2>\n-\n-\n-<p>\n-<strong>CodonLogo</strong>\n-is a web based application designed to make the \n-<a href="create.cgi">generation</a> of \n-codon sequence logos as easy and painless as possible.\n-It is almost entirely based on the application WebLogo.\n-</p>\n-\n-\n-<p>\n-<a href="http://www.lecb.ncifcrf.gov/~toms/sequencelogo.html">Sequence logos</a> \n-are a graphical representation of an amino acid\n-or nucleic acid multiple sequence alignment.\n-Each logo consists of stacks of symbols, one stack for each position in the\n-sequence. The overall height of the stack indicates the sequence conservation\n-at that position, while the height of symbols within the stack indicates the\n-relative frequency of each amino or nucleic acid at that position. The width of the stack is proportional to the fraction of valid symbols in that position. (Positions with many gasp have thin stacks.) In general, a sequence logo provides a richer and more precise description of, for example,\n-a binding site, than would a consensus sequence. \n-</p>\n-\n-\n-\n-\n-\n-\n-\n-\n-\n-<h4>References</h4>\n-\n-\n-<p>\n-<a href="http://bespoke.lbl.gov/">Crooks GE</a>, \n-<a href="http://compbio.berkeley.edu/">Hon G</a>, \n-<a href="http://compbio.berkeley.edu/">Chandonia JM</a>,\n-<a href="http://compbio.berkeley.edu/people/brenner/">Brenner SE</a> \n-WebLogo: A sequence logo \n-generator, \n-<em>Genome Research</em>, 14:1188-1190, (2004) \n-[<a href="http://bespoke.lbl.gov/pubs/fulltext/Crooks2004a-GR-WebLogo.pdf">Full Text</a> ]\n-</p>\n-\n-<p>\n-Schneider TD, Stephens RM. 1990.\n-<a class="out" href="http://www.lecb.ncifcrf.gov/~toms/paper/logopaper/">Sequence Logos: A New Way to Display Consensus Sequences.</a>\n-<em>Nucleic Acids Res.</em> <em>18</em>:6097-6100\n-</p>\n-\n-\n-\n-\n-\n-\n-\n-<a name="create" ></a>\n-<h2>Creating Sequences Logos using the Web interface</h2>\n-\n-\n-<h4>Sequence Data</h4>\n-Enter your multiple sequence alignment here, or select a file to upload. Supported file formats include CLUSTALW, FASTA, plain flatfile, MSF, NBRF, PIR, NEXUS and PHYLIP. All sequences must be the same length, else CodonLogo will return an error and report the first sequence that differed in length from previous sequences.\n-\n-<h4>Output format</h4>\n-\n-<ul>\n-<li> PNG : (600 DPI) Print resolution bitmap\n-</li><li> PNG : (low res,'..b' antialiased.\n-\t --scale-width YES/NO Scale the visible stack width by the fraction\n-\t of symbols in the column? (i.e. columns with\n-\t many gaps of unknowns are narrow.) (default:\n-\t yes)\n-\t --debug YES/NO Output additional diagnostic information.\n-\t (default: False)\n-\n-\t CodonLogo Server:\n-\t Run a standalone webserver on a local port.\n-\n-\t --serve Start a standalone CodonLogo server for creating\n-\t sequence logos.\n-\t --port PORT Listen to this local port. (Default: 8080)\n-</pre >\n-\n-<a name="API" ></a>\n-<h2>WebLogo Application Programmer Interface (API)</h2>\n-\n-The WebLogo python libraries provide even greater flexibility than the command line client. The code is split between two principle packages, <code>weblogo</code> itself, which contains specialized sequence logo generation code, and <code>corebio</code>, a package that contains code of more general utility. \n-Please consult the <a href="http://weblogo.googlecode.com/svn/trunk/apidocs/index.html">WebLogo</a> and <a href="http://corebio.googlecode.com/svn/tags/0.5.0/apidocs/index.html">CoreBio</a> API documentation.\n-\n-\n-\n-\n-<a name="dev" ></a>\n-<h2>WebLogo Development and Future Features</h2>\n-<p>\n-The development project is hosted at \n-<a href="http://code.google.com/p/weblogo/">http://code.google.com/p/weblogo</a>.\n-\n-If you wish to extend WebLogo or to contribute code, then you should download the full source code development package directly from the subversion repository.\n-</p>\n-<pre>\n-> svn checkout http://weblogo.googlecode.com/svn/trunk/ weblogo\n-> cd weblogo\n-> ./weblogo < cap.fa > cap.eps\n-</pre>\n-<p>\n-Please consult the developer notes, <code>DEVELOPERS.txt</code> and software license <code>LICENSE.txt</code>\n-</p>\n-\n-<p> Outstanding bugs and feature requests are listed on the <a href="http://code.google.com/p/weblogo/issues/list">WebLogo issue tracker.</a>\n-</p>\n-\n-<a name="misc" ></a>\n-<h2>Miscellanea</h2>\n-<h4> Release Notes and Known Bugs</h4>\n-The <a href="weblogo_changelog.txt">WebLogo release notes</a> detail changes to WebLogo and known issues with particular versions.\n-\n-<h4>WebLogo 2</h4>\n-The legacy WebLogo 2 sever can be found <a href="http://weblogo.berkeley.edu/">here.</a>\n-\n-\n-\n-<h4>Acknowledgments</h4>\n-\n-<p>\n-WebLogo was created by \n-<a href="http://threeplusone.com/">Gavin E. Crooks</a>, \n-<a href="http://compbio.berkeley.edu/">Liana Lareau</a>,\n-<a href="http://compbio.berkeley.edu/">Gary Hon</a>, \n-<a href="http://compbio.berkeley.edu/">John-Marc Chandonia</a> and\n-<a href="http://compbio.berkeley.edu/people/brenner/">Steven E. Brenner</a>.\n-<a href="weblogo_changelog.txt">Many others</a> have provided suggestions, bug fixes and moral support.\n-</p>\n-\n-<p>\n-WebLogo was originally based upon the programs \n-<a href="http://www.lecb.ncifcrf.gov/~toms/delila/alpro.html">alpro</a> and \n-<a href="http://www.lecb.ncifcrf.gov/~toms/delila/makelogo.html">makelogo</a>, \n-both of which are part of Tom Schneider\'s \n-<a href="http://www.lecb.ncifcrf.gov/~toms/delila.html">delila</a> package. Many thanks\n-are due to him for making this software freely available and for encouraging its use. \n-</p>\n-\n-\n-\n-\n-\n-</td></tr>\n-</table>\n-\n-\n-<script type="text/javascript">\n-var gaJsHost = (("https:" == document.location.protocol) ? "https://ssl." : "http://www.");\n-document.write(unescape("%3Cscript src=\'" + gaJsHost + "google-analytics.com/ga.js\' type=\'text/javascript\'%3E%3C/script%3E"));\n-</script>\n-<script type="text/javascript">\n-var pageTracker = _gat._getTracker("UA-5951066-1");\n-pageTracker._trackPageview();\n-</script>\n-</body>\n-</html>\n-\n-\n-\n-\n-\n-\n-\n-\n-\n'

diff -r 4d47ab2b7bcc -r b89bb51eba83 weblogolib/htdocs/test.html
--- a/weblogolib/htdocs/test.html Fri Jan 13 07:18:19 2012 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

b'@@ -1,543 +0,0 @@\n-<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN"\n- "http://www.w3.org/TR/html4/transitional.dtd">\n-<html>\n-<head>\n-<link rel="stylesheet" type="text/css" href="logo.css" >\n-\n-<title>CodonLogo - Tests </title>\n-<meta name="author" content="Gavin E. Crooks" >\n-<meta name="ID" content="$ID:" >\n-\n-<style type="text/css">\n-td {\n- border-left : white solid 4pt\n-}\n-.error { \n- color: #900;\n- border-left: red solid +4pt;\n-}\n-\n-.err_msg { \n- color: #900;\n-}\n-\n-</style>\n-</head>\n-\n-<body style="align:center">\n-\n-\n-<table width="80%" border = \'0\' cellspacing=\'0\' cellpadding=\'1\' align="center">\n-<tr><td >\n-<h1> CodonLogo: Tests</h1>\n-\n-</td><td align = "right"> \n- · \n- <a href="./">about</a> ·\n- <a href="create.cgi">create</a> · \n- <a href="examples.html">examples</a> · \n- <a href="manual.html">manual</a> · \n-<br>\n- \n-</td></tr>\n-\n-<tr><td colspan=\'2\'>\n-\n-Various tests of the CodonLogo webapp. <br >\n-\n-<hr >\n-\n-<dl>\n-<dt>Relative Entropy Test</dt>\n-<dd>\n-The entropy should be 2 bits, 1 bit, 0 bits\n-(The small sample correction should be turned off.) \n-<br >\n-<form method="post" action="create.cgi">\n-<input type="submit" name="cmd_edit" value="Edit" >\n-<input type="submit" name="cmd_create" value="Create" >\n-<input type="hidden" name="show_yaxis" value="true" >\n-<input type="hidden" name="show_xaxis" value="true" >\n-<input type="hidden" name="show_fineprint" value="true" >\n-<input type="hidden" name="show_errorbars" value="true" >\n-<input type="hidden" name="download" value="true" >\n-<input type="hidden" name="composition" value="comp_none" >\n-\n-<input type="hidden" name="sequences" value=\n-">\n-GTTGTTGTTGTT\n->\n-GTCGTCGTCGTC\n->\n-GGGGGGGGGGGG\n->\n-GGAGGAGGAGGA\n-" >\n-</form>\n-</dd>\n-\n-\n-<dt>Title And Labels Test</dt>\n-<dd>\n-Replace and display x-label, y-label and title. \n-<form method="post" action="create.cgi">\n-<input type="submit" name="cmd_edit" value="Edit" >\n-<input type="submit" name="cmd_create" value="Create" >\n-<input type="hidden" name="show_yaxis" value="true" >\n-<input type="hidden" name="show_xaxis" value="true" >\n-<input type="hidden" name="show_fineprint" value="true" >\n-<input type="hidden" name="show_errorbars" value="true" >\n-<input type="hidden" name="download" value="true" >\n-\n-<input type="hidden" name="yaxis_label" value="The Y-axis" > \n-<input type="hidden" name="xaxis_label" value="The X-axis" > \n-<input type="hidden" name="logo_title" value="This is the TITLE" > \n-<input type="hidden" name="sequences" value=\n-">\n-AAAGTGAAAGTGAAAGTGAAAGTG\n->\n-AAAGCGAAAGCGAAAGCGAAAGCG\n->\n-TGCCCTTGCCCTTGCCCTTGCCCT\n->\n-TGCCTTTGCCTTTGCCTTTGCCTT\n-" >\n-</form>\n-\n-Same, but do not show axes\n-<form method="post" action="create.cgi">\n-<input type="submit" name="cmd_edit" value="Edit" >\n-<input type="submit" name="cmd_create" value="Create" >\n-<input type="hidden" name="show_fineprint" value="true" >\n-<input type="hidden" name="show_errorbars" value="true" >\n-<input type="hidden" name="download" value="true" >\n-\n-<input type="hidden" name="yaxis_label" value="This is the Y-axis" > \n-<input type="hidden" name="xaxis_label" value="This is the X-axis" > \n-<input type="hidden" name="logo_title" value="This is the TITLE" > \n-<input type="hidden" name="sequences" value=\n-">\n-AAAGTGAAAGTGAAAGTGAAAGTG\n->\n-AAAGCGAAAGCGAAAGCGAAAGCG\n->\n-TGCCCTTGCCCTTGCCCTTGCCCT\n->\n-TGCCTTTGCCTTTGCCTTTGCCTT\n-" >\n-</form>\n-</dd>\n-\n-\n-\n-<dt>Format Test</dt>\n-<dd>\n-Ensure that this logo can be created in each of the available formats\n-<form method="post" action="create.cgi">\n-<input type="submit" name="cmd_edit" value="Edit" >\n-<input type="submit" name="cmd_create" value="Create" >\n-<input type="hidden" name="show_yaxis" value="true" >\n-<input type="hidden" name="show_xaxis" value="true" >\n-<input type="hidden" name="show_fineprint" value="true" >\n-<input type="hidden" name="show_errorbars" value="true" >\n-<input type="hidden" name="download" value="true" >\n-\n-Format: <sele'..b'e="true" >\n-<input type="hidden" name="show_errorbars" checked="checked" >\n-<input type="hidden" name="download" value="true" >\n-<input type="hidden" name="sequences" value=">\n-GGGGGGGGGGGGGG------------------\n->\n-GGGGGGGGGGGGG-------------------\n->\n-" >\n-</form>\n-\n-<form method="post" action="create.cgi">\n-<input type="submit" name="cmd_create" value="Fail: Malformed data" >\n-<input type="hidden" name="show_yaxis" value="true" >\n-<input type="hidden" name="show_xaxis" value="true" >\n-<input type="hidden" name="download" value="true" >\n-<input type="hidden" name="show_fineprint" value="true" >\n-<input type="hidden" name="show_errorbars" checked="checked" >\n-<input type="hidden" name="sequences" value=">\n-GGGGGGGGGGGGGG------------------\n->\n-GGGGGGGGGGGGG------------------\n->\n-" >\n-</form>\n-\n-\n-</dd>\n-\n-\n-\n-<dt> Logos Sizes</dt>\n-<dd>\n-Same sequences, three different sizes.\n-<form method="post" action="create.cgi">\n-<input type="submit" name="cmd_edit" value="Edit" >\n-<input type="hidden" name="download" value="true" >\n-<input type="submit" name="cmd_create" value="Create" >\n-<input type="hidden" name="show_yaxis" value="true" >\n-<input type="hidden" name="show_xaxis" value="true" >\n-<input type="hidden" name="show_fineprint" value="true" >\n-Size: \n-<select name="size" >\n-<option selected="selected" >small</option>\n-<option >medium</option>\n-<option >large</option>\n-</select> \n-\n-\n-<input type="hidden" name="sequences" value=\n-">aldB -18->4\n-attcgtgatagctgtcgtaaag\n->ansB 103->125\n-ttttgttacctgcctctaactt\n->araB1 109->131\n-aagtgtgacgccgtgcaaataa\n->araB2 147->169 \n-tgccgtgattatagacactttt\n->cdd 1 107->129\n-atttgcgatgcgtcgcgcattt\n->cdd 2 57->79\n-taatgagattcagatcacatat\n->crp 1 115->137\n-taatgtgacgtcctttgcatac\n->crp 2\n-gaaggcgacctgggtcatgctg\n->cya 151->173 \n-aggtgttaaattgatcacgttt\n->cytR 1 125->147\n-cgatgcgaggcggatcgaaaaa\n->cytR 2 106->128\n-aaattcaatattcatcacactt\n->dadAX 1 95->117\n-agatgtgagccagctcaccata\n->dadAX 2 32->54\n-agatgtgattagattattattc\n->deoP2 1 75->97\n-aattgtgatgtgtatcgaagtg\n->deoP2 2 128->150 \n-ttatttgaaccagatcgcatta\n->fur 136->158\n-aaatgtaagctgtgccacgttt\n->gal 56->78\n-aagtgtgacatggaataaatta\n->glpACB (glpTQ) 1 54->76 \n-ttgtttgatttcgcgcatattc\n->glpACB (glpTQ) 2 94->116\n-aaacgtgatttcatgcgtcatt\n->glpACB (glpTQ) 144->166 \n-atgtgtgcggcaattcacattt\n->glpD (glpE) 95->117 \n-taatgttatacatatcactcta\n->glpFK 1 120->142\n-ttttatgacgaggcacacacat\n->glpFK 2 95->117\n-aagttcgatatttctcgttttt\n->gut (srlA) 72->94\n-ttttgcgatcaaaataacactt\n->ilvB 87->109\n-aaacgtgatcaacccctcaatt\n->lac 1 (lacZ) 88->110\n-taatgtgagttagctcactcat\n->lac 2 (lacZ) 16->38 \n-aattgtgagcggataacaattt\n->malEpKp1 110->132\n-ttgtgtgatctctgttacagaa\n->malEpKp2 139->161\n-TAAtgtggagatgcgcacaTAA\n->malEpKp3 173->195\n-TTTtgcaagcaacatcacgAAA\n->malEpKp4 205->227\n-GACctcggtttagttcacaGAA\n->malT 121->143\n-aattgtgacacagtgcaaattc\n->melR 52->74\n-aaccgtgctcccactcgcagtc\n->mtl 302->324\n-TCTTGTGATTCAGATCACAAAG\n->nag 156->178\n-ttttgtgagttttgtcaccaaa\n->nupG2 97->119\n-aaatgttatccacatcacaatt\n->nupG1 47->69\n-ttatttgccacaggtaacaaaa\n->ompA 166->188\n-atgcctgacggagttcacactt\n->ompR 161->183\n-taacgtgatcatatcaacagaa\n->ptsH A 316->338\n-Ttttgtggcctgcttcaaactt\n->ptsH B 188->210\n-ttttatgatttggttcaattct\n->rhaS (rhaB) 161->183 \n-aattgtgaacatcatcacgttc\n->rot 1 (ppiA) 182->204 \n-ttttgtgatctgtttaaatgtt\n->rot 2 (ppiA) 129->151\n-agaggtgattttgatcacggaa\n->tdcA 60->82\n-atttgtgagtggtcgcacatat\n->tnaL 73->95\n-gattgtgattcgattcacattt\n->tsx 2 146->168\n-gtgtgtaaacgtgaacgcaatc\n->tsx 1 107->129\n-aactgtgaaacgaaacatattt\n->uxuAB 165->187\n-TCTTGTGATGTGGTTAACCAAT\n-" >\n-</form>\n-</dd>\n-\n-\n-\n-\n-</dl>\n-\n-\n-\n-</td></tr>\n-\n-\n-\n-\n-</table>\n-\n-<script type="text/javascript">\n-var gaJsHost = (("https:" == document.location.protocol) ? "https://ssl." : "http://www.");\n-document.write(unescape("%3Cscript src=\'" + gaJsHost + "google-analytics.com/ga.js\' type=\'text/javascript\'%3E%3C/script%3E"));\n-</script>\n-<script type="text/javascript">\n-var pageTracker = _gat._getTracker("UA-5951066-1");\n-pageTracker._trackPageview();\n-</script>\n-</body></html>\n'

diff -r 4d47ab2b7bcc -r b89bb51eba83 weblogolib/template.eps
--- a/weblogolib/template.eps Fri Jan 13 07:18:19 2012 -0500
+++ /dev/null Thu Jan 01 00:00:00 1970 +0000

b"@@ -1,669 +0,0 @@\n-%!PS-Adobe-3.0 EPSF-3.0\n-%%Title: Sequence Logo: ${logo_title}\n-%%Creator: ${creator_text}\n-%%CreationDate: ${creation_date}\n-%%BoundingBox: 0 0 ${logo_width} ${logo_height} \n-%%Pages: 0\n-%%DocumentFonts: \n-%%EndComments\n-\n-\n-% ---- VARIABLES ----\n-\n-/True true def\n-/False false def\n-\n-/debug ${debug} def\n-\n-/logo_height ${logo_height} def\n-/logo_width ${logo_width} def\n-/logo_title (${logo_title}) def\n-/show_title ${show_title} def\n-\n-/logo_margin ${logo_margin} def\n-/xaxis_label_height ${xaxis_label_height} def\n-/title_height ${title_height} def\n-/stroke_width ${stroke_width} def\n-/tic_length ${tic_length} def\n-\n-/lines_per_logo ${lines_per_logo} def\n-/line_width ${line_width} def\n-/line_height ${line_height} def\n-/line_margin_left ${line_margin_left} def\n-/line_margin_right ${line_margin_right} def\n-/line_margin_bottom ${line_margin_bottom} def\n-/line_margin_top ${line_margin_top} def\n-\n-/stack_width ${stack_width} def\n-/stack_height ${stack_height} def\n-/stacks_per_line ${stacks_per_line} def\n-/stack_margin ${stack_margin} def\n-\n-/show_yaxis ${show_yaxis} def \n-/show_yaxis_label ${show_yaxis_label} def\n-/yaxis_label (${yaxis_label}) def\n-/yaxis_scale ${yaxis_scale} def % height in units \n-/yaxis_tic_interval ${yaxis_tic_interval} def % in units\n-/yaxis_minor_tic_interval ${yaxis_minor_tic_interval} def % in units\n-\n-/show_xaxis_label ${show_xaxis_label} def % True or False\n-/show_xaxis ${show_xaxis} def % True or False\n-/xaxis_label (${xaxis_label}) def\n-/xaxis_tic_interval ${xaxis_tic_interval} def\n-/rotate_numbers ${rotate_numbers} def % True or False\n-/number_interval ${number_interval} def\n-/show_ends ${show_ends} def \n-/end_type (${end_type}) def % d: DNA, p: PROTEIN, -: none\n-\n-/show_fineprint ${show_fineprint} def\n-/fineprint (${fineprint}) def\n-/logo_label (${logo_label}) def\n-\n-/show_boxes ${show_boxes} def % True or False\n-/shrink ${shrink} def % True or False\n-/shrink_fraction ${shrink_fraction} def \n-\n-/show_errorbars ${show_errorbars} def % True or False\n-/errorbar_fraction ${errorbar_fraction} def\n-/errorbar_width_fraction ${errorbar_width_fraction} def\n-/errorbar_gray ${errorbar_gray} def\n-\n-/fontsize ${fontsize} def\n-/small_fontsize ${small_fontsize} def\n-/title_fontsize ${title_fontsize} def\n-/number_fontsize ${number_fontsize} def\n-\n-\n-/UseCIEColor true def % Fix for issue 4\n-/default_color ${default_color} def \n-/color_dict << \n-${color_dict}\n->> def\n-\n-\n-\n-% ---- DERIVED PARAMETERS ----\n-\n-/char_width stack_width 2 stack_margin mul sub def\n-/char_width2 char_width 2 div def\n-/char_width4 char_width 4 div def\n-\n-% movements to place 5'/N and 3'/C symbols\n-/leftEndDeltaX fontsize neg def\n-/leftEndDeltaY fontsize 1.25 mul neg def\n-/rightEndDeltaX fontsize 0.25 mul def\n-/rightEndDeltaY leftEndDeltaY def\n-\n-\n-% ---- PROCEDURES ----\n-\n-\n-/SetTitleFont {/${title_font} findfont title_fontsize scalefont setfont} bind def\n-/SetLogoFont {/${logo_font} findfont char_width scalefont setfont} bind def\n-/SetStringFont{/${text_font} findfont fontsize scalefont setfont} bind def\n-/SetPrimeFont {/Symbol findfont fontsize scalefont setfont} bind def\n-/SetSmallFont {/${text_font} findfont small_fontsize scalefont setfont} bind def\n-/SetNumberFont {/${text_font} findfont number_fontsize scalefont setfont} bind def\n-\n-/DrawBox { % width height \n- /hh exch def\n- /ww exch def\n- gsave\n- 0.2 setlinewidth\n- %0.5 setgray\n- \n- %0 0 moveto \n- "..b"dth mul char_height char DrawChar\n- grestore\n- \n- } if\n- 0 interval yaxis_scale div stack_height mul rmoveto\n-} bind def\n-\n-\n-/DrawChar { % <width> <height> <char> ShowChar\n- /tc exch def % The character\n- /ysize exch def % the y size of the character\n- /xsize exch def % the x size of the character\n- /xmulfactor 1 def \n- /ymulfactor 1 def\n- \n- gsave\n- SetLogoFont \n- tc SetColor\n-\n- % IReplacementHack\n- % Deal with the lack of bars on the letter 'I' in Arial and Helvetica\n- % by replacing with 'I' from Courier.\n- tc (I) eq {\n- /Courier findfont char_width scalefont setfont \n- } if\n-\n-\n- shrink {\n- xsize 1 shrink_fraction sub 2 div mul\n- ysize 1 shrink_fraction sub 2 div mul rmoveto \n- shrink_fraction shrink_fraction scale\n- } if\n- \n- % Calculate the font scaling factors\n- % Loop twice to catch small correction due to first scaling\n- 2 {\n- gsave\n- xmulfactor ymulfactor scale\n- \n- ysize % desired size of character in points\n- tc CharBoxHeight \n- dup 0.0 ne {\n- div % factor by which to scale up the character\n- /ymulfactor exch def\n- } {pop pop} ifelse\n-\n- xsize % desired size of character in points\n- tc CharBoxWidth \n- dup 0.0 ne {\n- div % factor by which to scale up the character\n- /xmulfactor exch def\n- } {pop pop} ifelse\n- grestore\n- } repeat\n-\n-\n- \n- % Draw the character\n- xmulfactor ymulfactor scale\n- % Move lower left corner of character to start point\n- tc CharBox pop pop % llx lly : Lower left corner\n- exch neg exch neg\n- rmoveto\n- \n- tc show \n-\n- grestore\n-} bind def\n-\n-/SetColor{ % <char> SetColor\n- dup color_dict exch known {\n- color_dict exch get aload pop setrgbcolor\n- } {\n- pop\n- default_color aload pop setrgbcolor\n- } ifelse \n-} bind def\n-\n-\n-/DrawErrorbar{ % interval_down interval_up DrawErrorbar\n- \n- gsave\n- /points_per_unit stack_height yaxis_scale div def \n- /height_up exch points_per_unit mul def \n- /height_down exch points_per_unit mul def\n- \n- show_errorbars {\n- \n- stroke_width setlinewidth\n- errorbar_gray setgray \n- stack_width 2 div 0 rmoveto\n- \n- /errorbar_width char_width errorbar_width_fraction mul def\n- /errorbar_width2 errorbar_width 2 div def\n- \n- gsave \n- 0 height_down neg rmoveto\n- errorbar_width2 neg 0 rlineto\n- errorbar_width 0 rlineto\n- errorbar_width2 neg 0 rlineto\n- 0 height_down errorbar_fraction mul rlineto \n- stroke\n- grestore\n-\n- gsave \n- 0 height_up rmoveto\n- errorbar_width2 neg 0 rlineto\n- errorbar_width 0 rlineto\n- errorbar_width2 neg 0 rlineto\n- 0 height_up neg errorbar_fraction mul rlineto \n- stroke\n- grestore\n- } if\n- \n- grestore\n- \n-} bind def\n-\n-/DrawErrorbarFirst{ % interval_down interval_up center DrawErrorbarFirst\n- gsave\n- /points_per_unit stack_height yaxis_scale div def \n- /center exch points_per_unit mul def \n-\n- 0 center rmoveto\n- DrawErrorbar\n- grestore\n-} bind def\n-\n-%%EndProlog\n-\n-%%Page: 1 1\n-\n-% Example Data\n-%StartLogo\n-% StartLine\n-% (1) StartStack\n-% 1.2 (C) ShowSymbol\n-% 2.2 (I) ShowSymbol\n-% 0.5 0.5 DrawErrorbar\n-% EndStack\n-% (2) StartStack\n-% 0.5 (I) ShowSymbol\n-% 0.9 (L) ShowSymbol\n-% 1.0 (G) ShowSymbol\n-% \n-% 0.5 0.5 DrawErrorbar \n-% EndStack\n-% (234) StartStack\n-% EndStack\n-% (235) StartStack\n-% EndStack\n-% EndLine\n-%EndLogo\n-\n-StartLogo\n-\n-${logo_data}\n-\n-EndLogo\n-\n-\n-%%EOF\n"